REPBIO 119 1–8 reproductive biology xxx (2014) xxx–xxx
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/repbio 1 2 3
Original Research Article
Celery oil modulates DEHP-induced reproductive toxicity in male rats
4 5
6 7
Q1
Mona A.M. Helal * Department of Zoology, Women's College for Arts, Science and Education, Ain Shams University, Cairo, Egypt
article info
abstract
Article history:
The objective of the study was to investigate the protective effect of Apium graveolens (AP)
Received 28 September 2013
against di-(2-ethylhexyl) phthalate (DEHP)-induced testes injury in rats. Adult rats were
Received in revised form
divided into nine groups: (1) control group (no treatment); (2) corn oil (60 mg/kg body weight –
6 April 2014
bwt); (3) AP (50 mg/kg bwt); (4) 300 mg DEHP/kg bwt; (5) 500 mg DEHP/kg bwt; (6) 1000 mg
Accepted 8 April 2014
DEHP/kg bwt; (7) 300 mg DEHP/kg bwt + AP; (8) 500 mg DEHP/kg bwt + AP; and (9) 1000 mg
Keywords:
decreased (p < 0.01) body weight, testis weight and serum concentrations of testosterone,
DEHP/kg bwt + AP. Oral administration of treatments was performed daily for 6 weeks. DEHP cholesterol and total proteins. Moreover, DEHP increased (p < 0.001) total antioxidant
Q2 DEHP
capacity in the testis and plasma DEHP level. In addition, DEHP decreased mRNA expression
Testes Cholesterol
of two testicular steroidogenic enzymes: 3b-hydroxysteroid dehydrogenase and 17b-hydro-
Testosterone
xysteroid dehydrogenase. DEHP also caused atrophy, vacuolar degeneration and aspermia of
3b-HSD
the seminiferous tubules. AP administered concurrently with DEHP effectively alleviated
17b-HSD
most of the DEHP-induced effects. In conclusion, in male rats, DEHP had adverse effects on
Histopathology
the testis including inhibition of androgen production. A concurrent administration of A. graveolens (celery oil) protected the testis against DEHP-induced toxicity. # 2014 Published by Elsevier Urban & Partner Sp. z o.o. on behalf of Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn.
10 8 119 12 13
1. 14 15 16 17 18 19
Introduction
Increased incidences of testicular cancer and reproductive abnormalities have been reported in association with exposure to chemicals in the environment in recent years [1]. Among the chemicals that cause these effects in humans are the abundantly used phthalates [2]. Phthalates are widely used in plastics technology to impart flexibility to rigid polymers [3].
In particular, di-(2-ethylhexyl) phthalate (DEHP) is used in polyvinyl chloride and other plastics. Flexible polyvinyl chloride is normally used for the production of storage containers, bags, waterproof clothing and flexible tubing [4]. Humans are daily exposed to this chemical through ingestion, inhalation and by dermal contact [5]. DEHP is not covalently bound to the vinyl polymer matrix and can be fairly easily released from these products into foods, beverages or directly into body fluids [6].
* Correspondence to: 12 Asmaa Fahmey St., Flat 16, Heliopolis, Cairo, Egypt. Tel.: +20 0224147745. E-mail address: [email protected] http://dx.doi.org/10.1016/j.repbio.2014.04.002 1642-431X/# 2014 Published by Elsevier Urban & Partner Sp. z o.o. on behalf of Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
20 21 22 23 24 25 26 27 28
REPBIO 119 1–8
2 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84
reproductive biology xxx (2014) xxx–xxx
Studies on animals showed that DEHP and various other phthalates cause developmental toxicity in rats [3]. DEHP acts through its main metabolite mono-2-ethylhexyl phthalate which has a significant effect on the male reproductive system [7]. Phthalates are negatively correlated to testosterone (T) level, decreased sperm count and poor sperm quality [8], and together with other endocrine disruptors can contribute to decreased fertility [9]. Prenatal phthalate exposure leads to anti-androgenic effects such as undescended testes and epididymal agenesis in male rats [10]. Celery oil is obtained from an old herb (Apium graveolens) that has been planted for over 3000 years, especially in Egypt. It was also known in China since the fifth century B.C., and was used throughout the history of mankind as a medicament or spice. Essential oils, including celery oil, are present in all parts of the plant, their content in the roots and leaves may be up to 1%, while in the seeds it may reach 7% [11]. The extract of celery seeds has been reported to possess a broad spectrum of pharmacological applications. Celery extract is known for its anti-inflammatory [12], hypocholesterolemic [13], anti-ulcer [14], antioxidant [15] and anticancer [16] effects. Celery was reported to have protective effects against reproductive toxicity in male rats [17]. The aim of the present study was to evaluate the effects of a six week exposure to different concentrations (300, 500 1000 mg/kg/day) of DEHP on testicular morphology and gene expression of steroidogenic enzymes, total antioxidant capacity of the testes, serum T concentration, as well as serum cholesterol and total protein content in Wistar rats. In addition, the protective effect of A. graveolens against DEHP was evaluated in the study.
2.
Materials and methods
2.1.
Experimental design and treatments
Transparent oily liquid DEHP was obtained from Sigma Chemical Co. (St. Louis, MO, USA). Freshly prepared raw A . graveolens (AP, celery oil) was obtained from Agricultural Herbs and Medicinal Plants Company, Cairo, Egypt; the oil was packed in dark brown bottles of 100 mL capacity each. The present study was carried out on male albino Wistar rats (120–130 g; 30–40 days old) obtained from the Animal House of El Salam Farm, Giza , Cairo, Egypt. The animals were housed under standard laboratory conditions (27 2 8C and 12-h light/dark cycle) and were fed on standard pellet diet and water ad libitum. After 7-day acclimatization period to laboratory conditions, the rats were divided into nine groups ( n = 10/group) receiving: (1) control group (no treatment); (2) corn oil (60 mg/kg body weight – bwt); (3) AP (50 mg/kg bwt); (4) 300 mg DEHP/kg bwt; (5) 500 mg DEHP/kg bwt; (6) 1000 mg DEHP/kg bwt; (7) 300 mg DEHP/kg bwt + AP; (8) 500 mg DEHP/kg bwt + AP; and (9) 1000 mg DEHP/kg bwt + AP. Phthalate, dissolved in corn oil, was administered daily to rats by oral intubation for six weeks [18,19]. The experimental procedures complied with the guidelines of the Committee on Care and Use of Experimental Animal Resources, Medical Research Center, Ain Shams University, Cairo, Egypt.
2.2.
Tissue preparation
85
During the experiment, the animals were monitored daily and weighed weekly. After six weeks of the treatment, male rats from each group (n = 10) were anesthetized by ether inhalation, and blood samples were collected from heart ventricles. The plasma was stored ( 70 8C) until determination of phthalate concentration and the serum was stored ( 70 8C) for measurement of T, total cholesterol and protein content. Both testes were dissected, freed of connective tissue, and weighed. Testicular samples were: (1) stored ( 70 8C) for semiquantitative RT-PCR of steroidogenic enzyme transcripts, (2) fixed in 10% formalin for histological examination, or (3) homogenized in cold potassium phosphate buffer (100 mM potassium phosphate, 2 mM EDTA, pH 7.0). The homogenate (20%) was centrifuged (1500 g, 30 min) and the supernatant was stored ( 70 8C) for determination of total antioxidant capacity. Testes immersed in 10% formalin were dehydrated and embedded in paraffin. Sections were cut (6 mm) and stained with hematoxylin and eosin (H&E).
86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103
2.3.
104
Biochemical analyses
Testosterone serum level was measured by Enzyme Immunoassay (EIA) test (kit, BioCheck Inc., Foster City, CA, USA). Total cholesterol and protein contents were determined by BioMed kit (BioMed Diagnostics, Cairo, Egypt) [20,21]. Measurement of total antioxidant capacity was described previously [22]. Determination of plasma DEHP concentration was conducted by high performance liquid chromatography (HPLC) equipped with an auto sampler (Beckman Instruments Inc., Fullerton, CA, USA) and UV detector (251658240 l= 230 nm). A Spherisorb C18 ODS2 column was used (inside diameter: 4.6 mm, length: 25 cm, 5-mm particle size; Beckman Ultrasphere Inc.). The mobile phase was carried out with orthophosphoric acid 0.1% (acetonitrile [90:10, vol/vol]), and the flow rate was 1 mL/min [23]. Two hundred microliters of plasma were extracted with 400 mL of NaOH (1 N), 100 mL of H3PO4 (50%), and 600 mL of acetonitrile. The extraction was repeated with 600 mL of acetonitrile. The supernatants collected after extraction were evaporated under nitrogen. The samples were dissolved in 400 mL of mobile phase and injected to the HPLC (injection volume: 100 mL). The retention times for DEHP were 9.8 min and 3.1 min, respectively [24]. DEHP concentration was expressed as an under-peak area and compared to DEHP standards of a calibration curve. The detection limit was 2 mg/ mL DEHP.
105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
2.4.
RNA isolation and semi-quantitative RT-PCR
129
Expression of mRNA encoding steroidogenic enzymes was determined by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). Total RNA was extracted from testes of control and treated rats with the use of RNeasy mini kit (Qiagen, Valencia, CA, USA). cDNA synthesis kit (Sigma Aldrich) was used to generate cDNA from 20 mg of total RNA. The primer sequences, annealing temperature and number of cycles for PCR (Table 1) for 17b-hydroxysteroid dehydrogenase III (17b-HSD III) were established according to the earlier reports [25], while those for 3b-hydroxysteroid dehydrogenase
130 131 132 133 134 135 136 137 138 139
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
REPBIO 119 1–8
3
reproductive biology xxx (2014) xxx–xxx
Table 1 – Primers and PCR conditions used in the experiment. Genes
Primers
3b-HSD
F: ATCCAGTGTATGTAGGCAATGTGGCCT R: AAGTGGCACATAGCCCAGATCTC F: TTCTGCAAGGCTTTACCAGG R: ACAAACTCATCGGCGGTCAA
95 8C, 72 8C, 95 8C, 72 8C,
5 min, 27 cycles (95 8C, 50 s, 55 8C, 30 s, 100 s), 72 8C, 10 min, 4 8C 5 min, 31 cycles (94 8C, 50 s, 50 8C, 30 s, 100 s), 72 8C, 10 min, 4 8C
365
F: AGACAGCCGCATCTTCTTGT R: CTTGCCGTGGGTAGAGTCAT
95 8C, 5 min, 27 cycles (95 8C, 50 s, 55 8C, 30 s, 72 8C, 100 s), 72 8C, 10 min, 4 8C
207
17b-HSDIII
GAPDH
PCR conditions
Product size (bp)
653
The primer sequences, annealing temperature and number of cycles as well as product size (base pairs, bp) of PCR.
Table 2 – Plasma DEHP and serum testosterone concentrations (mean W SEM) in rats treated with DEHP and/or AP.
significant differences among the experimental groups (software package version 10, SPSS Inc., Chicago, IL, USA).
152 153
Groups
3.
154
Control Corn oil AP (50 mg/kg) DEHP (300 mg/kg) DEHP (500 mg/kg) DEHP (1000 mg/kg) DEHP (300 mg/kg) + AP DEHP (500 mg/kg) + AP DEHP (1000 mg/kg) + AP
DEHP (mg/mL) Testosterone (ng/mL) a
1.96 0.24 1.54 0.31 a 1.27 0.18 a 12.51 3.21 c 13.57 5.43 c 14.11 2.65 c 10.72 1.11 b 11.06 2.75 b 13.35 1.15 c
Results
a
3.34 1.38 2.80 0.20 b 3.00 0.75 b 2.95 0.66 b 2.48 0.46 b 1.31 0.30 d 2.82 0.86 b 2.90 0.62 b 1.62 0.19 c
n = 10/group; different superscripts mean significant differences (p < 0.05) among means within a column; AP: Apium graveolens; DEHP: di-(2-ethylhexyl) phthalate.
140 141 142 143 144 145 146 147 148
I (3b-HSD I) were adapted from Song et al. [26]. PCR-amplified fragments were run alongside molecular weight markers on 2% agarose gels (Sigma Aldrich) and stained with ethidium bromide (Agagel Mini Horizontal Gel Electrophoresis Apparatus, Göttingen, Germany). Gels were visualized with UVP photo Doc-ItTM Imaging system (UVP, Upland, CA, USA). The relative intensities of the bands were normalized to the corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) band intensities.
149
2.5.
150 151
Data were expressed as mean SEM. One-way analysis of variance followed by the LSD test was used to assess
Statistical analysis
DEHP was found in all plasma samples from all examined groups (Table 2). Mean plasma DEHP concentrations were higher (p < 0.01) in DEHP-treated groups compared with control, corn oil and AP groups. The combined treatment of AP and DEHP (300 or 500 mg/kg) caused significant (p < 0.05) decrease in plasma DEHP level as compared to the rats treated with DEHP only. However, AP had no effect on DEHP level when the phthalate was administered together with 1000 mg/kg DEHP. Mean final body weight as well as mean testis and relative testis weights were lower (p < 0.001) in all DEHP groups than in controls (Table 3). A. graveolens treatment alleviated (p < 0.05) the adverse effects of the two lower DEHP doses, but not that of the highest DEHP dose. The latter dose of DEHP (1000 mg/kg) decreased (p < 0.01) serum T level, and the AP treatment partially mitigated (p < 0.05) the DEHP effect on T level (Table 2). Serum T was not affected by the lower doses of DEHP (300 and 500 mg/kg). The highest dose of DEHP reduced serum levels of total cholesterol and protein, whereas the two lower doses of DEHP were not effective. In contrast, total antioxidant capacity of testicular tissue was higher in all DEHP-treated groups as compared to the control groups. The AP treatment significantly moderated (p < 0.05) the DEHP effects on serum cholesterol, proteins and total antioxidant capacity in the testis (Table 4). After six weeks of treatment, two higher doses of DEHP decreased 3b-HSD I expression in rat testis (Fig. 1). All DEHP
Table 3 – Effects of DEHP and/or AP on body and testis weights (mean W SEM). Groups Control Corn oil AP (50 mg/kg) DEHP (300 mg/kg) DEHP (500 mg/kg) DEHP (1000 mg/kg) DEHP (300 mg/kg) + AP DEHP (500 mg/kg) + AP DEHP (1000 mg/kg) + AP
Initial body weight (g)
Final body weight (g)
Testicular weight (g)
Relative testicular weight* (g %)
120.9 2.4 a 122.3 9.5 a 123.6 1.8 a 120.3 1.4 a 122.8 2.5 a 120.5 1.5 a 123.0 3.2 a 122.6 2.7 a 121.8 0.9 a
221.8 2.8 a 204.6 7.7 a 200.7 4.0 a 181.2 6.8 c 179.0 4.1 c 171.9 5.7 d 195.4 4.3 b 190.0 7.3 b 181.62 3.8 c
1.27 4.42 a 1.20 4.38 a 1.16 8.86 a 0.93 0.11 b 0.75 0.13 b 0.42 1.62 c 1.12 0.12 a 0.88 5.17 b 0.42 2.51 c
0.57 4.39 a 0.58 2.81 a 0.57 4.52 a 0.51 5.06 b 0.41 6.05 c 0.24 9.73 d 0.57 4.86 a 0.46 2.34 b 0.23 1.09 d
* Relative testicular weight: testicular weight (g)/final bodyweight (g) 100; n = 10/group; different superscripts mean significant differences (p < 0.05) among means within a column. AP: Apium graveolens; DEHP: di-(2-ethylhexyl) phthalate.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180
REPBIO 119 1–8
4
reproductive biology xxx (2014) xxx–xxx
Table 4 – Effects of DEHP and/or AP on total cholesterol and protein concentrations in plasma as well as total antioxidant capacity in the testis (mean W SEM). Groups Control Corn oil AP (50 mg/kg) DEHP (300 mg/kg) DEHP (500 mg/kg) DEHP (1000 mg/kg) DEHP (300 mg/kg) + AP DEHP (500 mg/kg) + AP DEHP (1000 mg/kg) + AP
Total cholesterol (mg/dL) a
84.20 7.47 87.16 4.96 a 85.66 10.17 a 83.33 2.02 a 73.25 10.46 a 65.62 5.03 b 86.00 1.52 a 83.25 5.36 a 79.44 3.93 a
Total protein (g/dL) a
12.50 2.00 11.25 0.25 a 10.50 0.50 a 10.28 0.52 a 10.00 0.32 a 9.53 0.51 b 10.16 0.87 a 10.33 0.42 a 10.42 0.20 a
Total antioxidant capacity (mM/L) 0.69 5.51 a 0.58 4.71 a 0.50 8.50 a 1.20 8.88 c 1.25 0.12 c 1.37 7.24 d 1.02 9.06 b 1.00 7.08 b 1.00 5.96 b
n = 10/group; different superscripts mean significant differences (p < 0.05) among means within a column. AP: Apium graveolens; DEHP: di-(2ethylhexyl) phthalate.
Fig. 1 – Effects of di-(2-ethylhexyl) phthalate (DEHP) and/or Apium graveolens (AP) on mRNA level (mean W SEM) of steroidogenic enzymes (A, 3b-HSD I; B, 17b-HSD III) in the testis of adult rats (n = 3 rats/group). Data are presented as a relative intensity of PCR products to GAPDH. Different superscripts designate significant differences (p < 0.05); low DEHP: 300 mg/kg, med DEHP: 500 mg/kg, high DEHP: 1000 mg/kg bwt. GAPDH: glyceraldehyde-3-phosphate dehydrogenase – a housekeeping gene; control groups: contr (no treatment), corn oil and AP. Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
REPBIO 119 1–8 reproductive biology xxx (2014) xxx–xxx
181 182 183 184 185 186
doses declined 17 b-HSD III mRNA expression. A. graveolens administered together with medium and high dose of DEHP significantly (p < 0.05) increased gene expression of 3b-HSD I and 17b-HSD III compared to those of DEHP alone. In addition, the AP treatment partially abolished the inhibitory effect of the lowest DEHP dose on 17b-HSD III gene expression.
5
Parenchyma of control testis was formed of rounded seminiferous tubules. Most of them attained narrow lumina and were lined by stratified germinal epithelium (Fig. 2a and b). Sertoli cells appeared as column cells in between spermatogonia (Fig. 2b). Administration of DEHP (500 mg/kg) caused congestion of the blood vessels and extensive degeneration of
Fig. 2 – Histological images of testis in di-(2-ethylhexyl) phthalate (DEHP)- and/or Apium graveolens (AP)-treated adult rats (a). (b) Control rats: seminiferous tubules (S) with complete arrangement of germinal eptithelium; (a) 40T; (b) 400T, Sertoli cells appear as column cells in between spermatogonia (arrow); (c) DEHP (500 mg/kg)-treated rats (250T): visible congestion of the blood vessel (arrow) and extensive degeneration of the germinal epithelium and Leydig cells (arrow heads); (d and e) DEHP (1000 mg/kg)-treated rats; (d) most of the seminiferous tubules were markedly distorted with very wide lumina, no spermatozoa, and reduction in the thickness of tubule's epithelial lining (250T); (e) severe atrophy, vacuolar degeneration (v) and aspermia (arrow) (100T); (f) AP and DEHP (1000 mg/kg)-treated rats: most of the seminiferous tubules nearly regained their normal architecture (250T). Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
187 188 189 190 191 192
REPBIO 119 1–8
6
reproductive biology xxx (2014) xxx–xxx
193 194 195 196 197 198 199 200
seminiferous tubules (Fig. 2c). Most of seminiferous tubules of rats receiving the highest dose of DEHP were markedly distorted, having very wide lumina and reduced thickness of their epithelial lining, with no spermatozoa (Fig. 2d). Vacuolar degeneration of the germinal epithelium in some seminiferous tubules was also observed (Fig. 2e). In contrast, AP administered concurrently with the highest DEHP dose (Fig. 2f) caused a recovery of most of the seminiferous tubules.
201
4.
202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249
The present study demonstrated that a 6-week exposure of male adult rats to the industrial pollutant, DEHP, decreased testicular weight, inhibited spermatogenesis and serum T concentration. The reduction in testis weight, a valuable index of reproductive toxicity in male animals, is consistent with previous results [27,28]. This reduction is caused by the lowered production of testicular androgens, possibly as a result of the loss of Leydig cells [29,30]. After oral administration, DEHP is hydrolyzed in the rat small intestine and other tissues by esterases to produce mono (2-ethylhexyl) phthalate (MEHP) [31]. Because MEHP is the most toxic metabolite of DEHP, it was hypothesized that this monoester is responsible for the induction of testis atrophy [32]. DEHP was found to decrease serum T via the MEHP effects on Sertoli cells [33] and interference with T synthesis [34]. Administration of DEHP, especially at 1000 mg/kg, significantly reduced the serum level of total cholesterol. Most studies demonstrated a decrease in blood cholesterol in animals treated with DEHP [35] which might affect steroidogenesis via interfering with cholesterol transport [36]. 3b-HSD and 17b-HSD play a key regulatory role in testicular spermatogenesis [37]. In laboratory animals, DEHP was reported to exert anti-androgenic action [5] and endocrine disruptor properties [38,39]. This may be associated with the reduction of testicular mRNA levels of 3b-HSD I and 17b-HSD III. Administration of DEHP elevated total testicular antioxidant capacity as compared to the control rats. Also, Kasahara et al. [27] found an increase in the antioxidant enzymes (glutathione peroxidase and catalase) and a decrease in the antioxidant (free thiol, GSH and ascorbic acid) levels in the testis of DEHP-treated rats due to the toxic effect of MEHP which enhanced the generation of reactive oxygen species (ROS) as well as the oxidative stress in the testicular cells [40]. Because oxidative stress in the testis is one of the major factors that induce germ cell apoptosis, this organ has fairly high concentrations of antioxidants, such as glutathione (GSH), ascorbic acid and vitamin E, that protect germ cells against oxidative DNA damage [27]. In addition, a significant reduction in the serum level of total protein demonstrated in the DEHP treated groups may result in an arrest of spermatogenesis due to a lack of adequate amount of protein. This also might affect testicular function [41]. Histological examination of the testis showed that DEHP treatment caused a marked distortion of the structure of seminiferous tubules, including reduction in the thickness of tubules' epithelial lining, vacuolar degeneration and aspermia. This finding is in accordance with many previous reports [3,19]. Histological changes after DEHP administration may be
Discussion
due to the actions of MEHP which was reported to induce apoptosis in spermatogenic cells [42] and up-regulate the expression of Fas ligand in Sertoli cells [43,44]. Aspermatogenesis may also be associated with damage of the Sertoli cells [45], testicular zinc depletion [38], decreased estrogen level [46] and/or the anti-androgenic effects of DEHP [3]. The present study demonstrated that celery oil (A. graveolens) alleviated the testis damage induced by DEHP. This is consistent with previous reports concerning the celery oil effects on testicular toxicity induced by other chemical toxicants in male rats [17,47–49]. The protective effects of celery oil can be attributed to its antioxidant properties and the androgenic activities of apigenin, limonene, and phthalide glycosides-ingredients [15–17,47,48]. Celery oil can decrease the oxidative stress in the testis, protect maturation of spermatozoa and improve sperm function [50]. To summarize, DEHP exerted toxic effects on the testis and inhibited androgen production, while concurrent administration of A. graveolens protected the testis against the DEHP-induced toxicity in adult male rats.
250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271
Acknowledgments
272
The author thanks all staff members of the Medical Research Center, Ain Shams University for making all facilities available for the author's research.
273 274 275
references
276
[1] Skakkebaek NE, Rajpert-De Meyts E, Main KM. Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Hum Reprod 2001;16:972–8. [2] Borch J, Broeng S, Vinggaard AM, Brokken L, Dalgaard M. Mechanisms underlying the anti-androgenic effects of diethylhexyl phthalate in fetal rat testis. Toxicology 2006;223:144–55. [3] Erkekoglu P, Zeybek ND, Giray B, Asan E, Arnaud J, Hincal F. Reproductive toxicity of di(2-ethylhexyl) phthalate in selenium-supplemented and selenium-deficient rats. Drug Chem Toxicol 2011;34(4):379–89. [4] Benson R. Hazard to the developing male reproductive system from cumulative exposure to phthalate esters— dibutyl phthalate, diisobutyl phthalate, butylbenzyl phthalate, diethylhexyl phthalate, dipentyl phthalate, and diisononyl phthalate. Regul Toxicol Pharmacol 2009;53:90–101. [5] Moore RW, Rudy TA, Lin TM, Ko K, Peterson RE. Abnormalities of sexual development in male rats with in utero and lactational exposure to the antiandrogenic plasticizer di(2-ethylhexyl) phthalate. Environ Health Perspect 2001;109(3):229–37. [6] Lovekamp-Swan T, Davis BJ. Mechanisms of phthalate ester toxicity in the female reproductive system. Environ Health Perspect 2003;111:139–45. [7] Pan G, Hanaoka T, Yoshimura M, Zhang S, Wang P, Tsukino H, et al. Decreased serum free testosterone in workers exposed to high levels of di-n-butyl phthalate (DBP) and di2-ethylhexyl phthalate (DEHP): a cross-sectional study in China. Environ Health Perspect 2006;114:1643–8.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307
REPBIO 119 1–8 reproductive biology xxx (2014) xxx–xxx
308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376
[8] Pant N, Shukla M, Kumar Patel D, Shukla Y, Mathur N, Kumar Gupta Y, et al. Correlation of phthalate exposures with semen quality. Toxicol Appl Pharmacol 2008;231: 112–6. [9] Phillips KP, Tanphaichitr N. Human exposure to endocrine disrupters and semen quality. J Toxicol Environ Health B: Crit Rev 2008;11:188–220. [10] Jarfelt K, Dalgaard M, Hass U, Borch J, Jacobsen H, Ladefoged O. Antiandrogenic effects in male rats perinatally exposed to a mixture of di(2-ethylhexyl) phthalate and di(2ethylhexyl) adipate. Reprod Toxicol 2005;19:505–15. [11] Barnes J, Anderson AL, Phillipson JD, editors. Herbal medicines. London, Chicago: Pharmaceutical Press; 2002. [12] Lewis DA, Tharib SM, Veitch GBA. The anti-inflammatory activity of celery Apium graveolens L. (Fam. Umbelliferae). Int J Crude Drug Res 1985;23:27–32. [13] Tsi D, Tan BK. The mechanism underling the hypocholesterolemic activity of celery extracts (aqueous and butanol extracts) in hypercholesterolemic rats. Life Sci 2000;14(66):755–67. [14] Whitehouse MW, Butters DE, Clarke ML, Rainsford KD. NSAID gastropathy: prevention by celery seed extracts in of benzo (a) pyrene-induced forestomach cancer in mice by natural phthalides from celery seed oil. Nutr Cancer 2001;19:77–86. [15] Momin RA, Nair MG. Antioxidant, cyclooxygenase and topoisomerase inhibitory compounds from Apium graveolens seeds. Phytomedicine 2002;9(4):312–8. [16] Sultana S, Salahuddin A, Tamanna J, Sharma S. Inhibitory effect of celery seed extract on chemically induced hepatocarcinogenesis: modulation of cell proliferation, metabolism and altered hepatic foci development. Cancer Lett 2005;221:11–20. [17] Hamza AA, Amin A. Apium graveolens modulates sodium valproate-induced reproductive toxicity in male rats. J Exp Zool A 2007;307(4):199–206. [18] Jain GC, Pareek H, Khajja BS, Jain K, Jhalani S, Agarwal S, et al. Modulation of di-(2-ethylhexyl) phthalate induced hepatic toxicity by Apium graveolens L. seeds extract in rats. Afr J Biochem Res 2009;3:222–5. [19] Noriega NC, Howdeshell KL, Furr J, Lambright CR, Wilson VS, Earl Gray Jr L. Pubertal administration of DEHP delays puberty, suppresses testosterone production, and inhibits reproductive tract development in male Sprague-Dawley and Long-Evans rats. Toxicol Sci 2009;111(1):163–78. [20] Tietz NW. Fundamentals of clinical chemistry. 2nd ed. Philadelphia: Saunders WB: Co; 1976. p. 506. [21] Koller A. Total serum protein. St. Louis, Toronto/Princeton: The Mosby CV Co.; 1984, 1316–24, 418. [22] Koracevic D, Koracevic G, Djordjevic V, Andrejevic S, Cosic V. Method for the measurement of antioxidant activity in human fluids. J Clin Pathol 2001;54(5):356–61. [23] Paris I, Ruggieri F, Mazzeo P, Carlucci G. Simultaneous determination of di-(2-ethylhexyl)-phthalate and mono-(2ethylhexyl)-phthalate in human plasma by HPLC. Anal Lett 2003;36:2645–54. [24] Durmaz E, Ozmert EN, Erkekoglu P, Giray B, Derman O, Hincal F, et al. Plasma phthalate levels in pubertal gynecomastia. Pediatrics 2010;125(1):122–9. [25] Umar V, Kural MR, Pereira BMJ, Roy P. Spearmint induced hypothalamic oxidative stress and testicular antiandrogenicity in male rats – altered levels of gene expression, enzymes and hormones. Food Chem Toxicol 2008;46:3563–70. [26] Song L, Tang X, Kong Y, Ma H, Zou S. The expression of serum steroid sex hormones and steroidogenic enzymes following intraperitoneal administration of dehydroepiandrosterone (DHEA) in male rats. Steroids 2010;75:213–8.
[27] Kasahara E, Sato EF, Miyoshi M, Konaka R, Hiramoto K, Sasaki J, et al. Role of oxidative stress in germ cell apoptosis induced by di(2-ethylhexyl) phthalate. Biochem J 2002;365:849–56. [28] Vo TT, Jung EM, Dang VH, Yoo YM, Choi KC, Yu FH, et al. Di(2 ethylhexyl) phthalate and flutamide alter gene expression in the testis of immature male rats. Reprod Biol Endocrinol 2009;26(7):104. [29] Ng TB, Liu WK. Toxic effect of heavy metals on cells isolated from the rat adrenal end testis. In Vitro Cell Dev Biol 1990;26(1):24–8. [30] Ray A, Chatterjee S, Bagchi P, Deb C. Effect of quinolphos on testicular steroidogenesis in rats. Andrologia 1988;20:163–8. [31] Pollack GM, Li RC, Ermer JC, Shen DD. Effects of route of administration and repetitive dosing on the disposition kinetics of di(2-ethylhexyl)phthalate and its mono-deesterified metabolite in rats. Toxicol Appl Pharmacol 1985;79:246–56. [32] Gray TJ, Gangolli SD. Aspects of the testicular toxicity of phthalate esters. Environ Health Perspect 1986;65:229–35. [33] Li LH, Jester Jr WF, Laslett AL, Orth JM. A single dose of di-(2ethylhexyl) phthalate in neonatal rats alters gonocytes, reduces Sertoli cell proliferation, and decreases cyclin D2 expression. Toxicol Appl Pharmacol 2000;16:222–9. [34] Akingbemi BT, Youker RT, Scottas CM, Ge R, Katz E, Klinefelter GR, et al. Modulation of rat Leydig cell steroidogenesis function by di(2-ethylhexyl) phthalate. Biol Reprod 2001;65:1252–9. [35] Mocchiutti NO, Bernal CA. Effects of chronic di(2ethylhexyl) phthalate intake on the secretion and removal rate of triglyceride-rich lipoproteins in rats. Food Chem Toxicol 1997;35:1017–21. [36] Liu K, Lehmann KP, Sar M, Young SS, Gaido KW. Gene expression profiling following in utero exposure to phthalate esters reveals new gene targets in the etiology of testicular dysgenesis. Biol Reprod 2005;73: 180–92. [37] Sadik NA. Effects of diallyl sulfide and zinc on testicular steroidogenesis in cadmium-treated male rats. J Biochem Mol Toxicol 2008;22(5):345–53. [38] Park JD, Habeebu SS, Klaassen CD. Testicular toxicity of di(2-ethylhexyl)phthalate in young Sprague-Dawley rats. Toxicology 2002;171:105–15. [39] Wong J, Gill S. Gene expression changes induced in mouse liver by di(2-ethylhexyl) phthalate. Toxicol Appl Pharmacol 2002;185:180–96. [40] Ablake M, Itoh M, Terayama H, Hayashi S, Shoji S, Naito M, et al. Di-(2-ethylhexyl) phthalate induces severe aspermatogenesis in mice, however, subsequent antioxidant vitamins supplementation accelerates regeneration of the seminiferous epithelium. Int J Androl 2004;27(5):274–81. [41] Chinoy NJ, Tewari K, Jhala D. Fluoride and/or arsenic toxicity in mice testis with formation of giant cells and subsequent recovery by some antidotes. Fluoride 2004;37 (3):172–84. [42] Richburg JH, Boekelheide K. Mono-(2-ethylhexyl) phthalate rapidly alters both Sertoli cell vimentin filaments and germ cell apoptosis in young rat testes. Toxicol Appl Pharmacol 1996;137:42–50. [43] Lee J, Richburg JH, Shipp EB, Meistrich ML, Boekelheide K. The Fas system, a regulator of testicular germ cell apoptosis, is differentially up-regulated in Sertoli cell versus germ cell injury of the testis. Endocrinology 1999;140:852–8. [44] Lee J, Richburg JH, Younkin SC, Boekelheide K. The Fas system is a key regulator of germ cell apoptosis in the testis. Endocrinology 1997;138:2081–8.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
7 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445
REPBIO 119 1–8
8 446 447 448 449 450 451 452 453 454 455 456
reproductive biology xxx (2014) xxx–xxx
[45] David RM, Moore MR, Finney DC, Guest D. Chronic toxicity of di(2-ethylhexyl) phthalate in rats. Toxicol Sci 2000;55:433–43. [46] Kim HS, Saito K, Kazusaka MI, Fujita S. Short period exposure to di-(2-ethylhexyl) phthalate regulates testosterone metabolism in testis of prepubertal rats. Arch Toxicol 2003;77:446–51. [47] Popovic M, Kaurinovi B, Trivi S, Mimica-Duki N, Bursa M. Effect of celery (Apium graveolens) extracts on some biochemical parameters of oxidative stress in mice treated with carbon tetrachloride. Phytother Res 2006;20:531–7.
[48] Shalaby MA, El Zorba HY. Protective effect of celery oil, vitamin E and their combination against testicular toxicity in male rats. Glob Vet 2010;5(2):122–8. [49] Wahba HMA. Protective effect of Nigella sativa, linseed and celery oils against testicular toxicity induced by sodium valproate in male rats. J Am Sci 2011;7(5):687–93. [50] Piomboni P, Gambera L, Serafini F, Campanella G, Morgante G, Leo V. Sperm quality improvement after natural anti-oxidant treatment of asthenoteratospermic men with leukocytospermia. Asian J Androl 2008;10(2): 201–6.
457 458 459 460 461 462 463 464 465 466 467 468
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/repbio 1 2 3
Original Research Article
Celery oil modulates DEHP-induced reproductive toxicity in male rats
4 5
6 7
Q1
Mona A.M. Helal * Department of Zoology, Women's College for Arts, Science and Education, Ain Shams University, Cairo, Egypt
article info
abstract
Article history:
The objective of the study was to investigate the protective effect of Apium graveolens (AP)
Received 28 September 2013
against di-(2-ethylhexyl) phthalate (DEHP)-induced testes injury in rats. Adult rats were
Received in revised form
divided into nine groups: (1) control group (no treatment); (2) corn oil (60 mg/kg body weight –
6 April 2014
bwt); (3) AP (50 mg/kg bwt); (4) 300 mg DEHP/kg bwt; (5) 500 mg DEHP/kg bwt; (6) 1000 mg
Accepted 8 April 2014
DEHP/kg bwt; (7) 300 mg DEHP/kg bwt + AP; (8) 500 mg DEHP/kg bwt + AP; and (9) 1000 mg
Keywords:
decreased (p < 0.01) body weight, testis weight and serum concentrations of testosterone,
DEHP/kg bwt + AP. Oral administration of treatments was performed daily for 6 weeks. DEHP cholesterol and total proteins. Moreover, DEHP increased (p < 0.001) total antioxidant
Q2 DEHP
capacity in the testis and plasma DEHP level. In addition, DEHP decreased mRNA expression
Testes Cholesterol
of two testicular steroidogenic enzymes: 3b-hydroxysteroid dehydrogenase and 17b-hydro-
Testosterone
xysteroid dehydrogenase. DEHP also caused atrophy, vacuolar degeneration and aspermia of
3b-HSD
the seminiferous tubules. AP administered concurrently with DEHP effectively alleviated
17b-HSD
most of the DEHP-induced effects. In conclusion, in male rats, DEHP had adverse effects on
Histopathology
the testis including inhibition of androgen production. A concurrent administration of A. graveolens (celery oil) protected the testis against DEHP-induced toxicity. # 2014 Published by Elsevier Urban & Partner Sp. z o.o. on behalf of Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn.
10 8 119 12 13
1. 14 15 16 17 18 19
Introduction
Increased incidences of testicular cancer and reproductive abnormalities have been reported in association with exposure to chemicals in the environment in recent years [1]. Among the chemicals that cause these effects in humans are the abundantly used phthalates [2]. Phthalates are widely used in plastics technology to impart flexibility to rigid polymers [3].
In particular, di-(2-ethylhexyl) phthalate (DEHP) is used in polyvinyl chloride and other plastics. Flexible polyvinyl chloride is normally used for the production of storage containers, bags, waterproof clothing and flexible tubing [4]. Humans are daily exposed to this chemical through ingestion, inhalation and by dermal contact [5]. DEHP is not covalently bound to the vinyl polymer matrix and can be fairly easily released from these products into foods, beverages or directly into body fluids [6].
* Correspondence to: 12 Asmaa Fahmey St., Flat 16, Heliopolis, Cairo, Egypt. Tel.: +20 0224147745. E-mail address: [email protected] http://dx.doi.org/10.1016/j.repbio.2014.04.002 1642-431X/# 2014 Published by Elsevier Urban & Partner Sp. z o.o. on behalf of Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
20 21 22 23 24 25 26 27 28
REPBIO 119 1–8
2 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84
reproductive biology xxx (2014) xxx–xxx
Studies on animals showed that DEHP and various other phthalates cause developmental toxicity in rats [3]. DEHP acts through its main metabolite mono-2-ethylhexyl phthalate which has a significant effect on the male reproductive system [7]. Phthalates are negatively correlated to testosterone (T) level, decreased sperm count and poor sperm quality [8], and together with other endocrine disruptors can contribute to decreased fertility [9]. Prenatal phthalate exposure leads to anti-androgenic effects such as undescended testes and epididymal agenesis in male rats [10]. Celery oil is obtained from an old herb (Apium graveolens) that has been planted for over 3000 years, especially in Egypt. It was also known in China since the fifth century B.C., and was used throughout the history of mankind as a medicament or spice. Essential oils, including celery oil, are present in all parts of the plant, their content in the roots and leaves may be up to 1%, while in the seeds it may reach 7% [11]. The extract of celery seeds has been reported to possess a broad spectrum of pharmacological applications. Celery extract is known for its anti-inflammatory [12], hypocholesterolemic [13], anti-ulcer [14], antioxidant [15] and anticancer [16] effects. Celery was reported to have protective effects against reproductive toxicity in male rats [17]. The aim of the present study was to evaluate the effects of a six week exposure to different concentrations (300, 500 1000 mg/kg/day) of DEHP on testicular morphology and gene expression of steroidogenic enzymes, total antioxidant capacity of the testes, serum T concentration, as well as serum cholesterol and total protein content in Wistar rats. In addition, the protective effect of A. graveolens against DEHP was evaluated in the study.
2.
Materials and methods
2.1.
Experimental design and treatments
Transparent oily liquid DEHP was obtained from Sigma Chemical Co. (St. Louis, MO, USA). Freshly prepared raw A . graveolens (AP, celery oil) was obtained from Agricultural Herbs and Medicinal Plants Company, Cairo, Egypt; the oil was packed in dark brown bottles of 100 mL capacity each. The present study was carried out on male albino Wistar rats (120–130 g; 30–40 days old) obtained from the Animal House of El Salam Farm, Giza , Cairo, Egypt. The animals were housed under standard laboratory conditions (27 2 8C and 12-h light/dark cycle) and were fed on standard pellet diet and water ad libitum. After 7-day acclimatization period to laboratory conditions, the rats were divided into nine groups ( n = 10/group) receiving: (1) control group (no treatment); (2) corn oil (60 mg/kg body weight – bwt); (3) AP (50 mg/kg bwt); (4) 300 mg DEHP/kg bwt; (5) 500 mg DEHP/kg bwt; (6) 1000 mg DEHP/kg bwt; (7) 300 mg DEHP/kg bwt + AP; (8) 500 mg DEHP/kg bwt + AP; and (9) 1000 mg DEHP/kg bwt + AP. Phthalate, dissolved in corn oil, was administered daily to rats by oral intubation for six weeks [18,19]. The experimental procedures complied with the guidelines of the Committee on Care and Use of Experimental Animal Resources, Medical Research Center, Ain Shams University, Cairo, Egypt.
2.2.
Tissue preparation
85
During the experiment, the animals were monitored daily and weighed weekly. After six weeks of the treatment, male rats from each group (n = 10) were anesthetized by ether inhalation, and blood samples were collected from heart ventricles. The plasma was stored ( 70 8C) until determination of phthalate concentration and the serum was stored ( 70 8C) for measurement of T, total cholesterol and protein content. Both testes were dissected, freed of connective tissue, and weighed. Testicular samples were: (1) stored ( 70 8C) for semiquantitative RT-PCR of steroidogenic enzyme transcripts, (2) fixed in 10% formalin for histological examination, or (3) homogenized in cold potassium phosphate buffer (100 mM potassium phosphate, 2 mM EDTA, pH 7.0). The homogenate (20%) was centrifuged (1500 g, 30 min) and the supernatant was stored ( 70 8C) for determination of total antioxidant capacity. Testes immersed in 10% formalin were dehydrated and embedded in paraffin. Sections were cut (6 mm) and stained with hematoxylin and eosin (H&E).
86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103
2.3.
104
Biochemical analyses
Testosterone serum level was measured by Enzyme Immunoassay (EIA) test (kit, BioCheck Inc., Foster City, CA, USA). Total cholesterol and protein contents were determined by BioMed kit (BioMed Diagnostics, Cairo, Egypt) [20,21]. Measurement of total antioxidant capacity was described previously [22]. Determination of plasma DEHP concentration was conducted by high performance liquid chromatography (HPLC) equipped with an auto sampler (Beckman Instruments Inc., Fullerton, CA, USA) and UV detector (251658240 l= 230 nm). A Spherisorb C18 ODS2 column was used (inside diameter: 4.6 mm, length: 25 cm, 5-mm particle size; Beckman Ultrasphere Inc.). The mobile phase was carried out with orthophosphoric acid 0.1% (acetonitrile [90:10, vol/vol]), and the flow rate was 1 mL/min [23]. Two hundred microliters of plasma were extracted with 400 mL of NaOH (1 N), 100 mL of H3PO4 (50%), and 600 mL of acetonitrile. The extraction was repeated with 600 mL of acetonitrile. The supernatants collected after extraction were evaporated under nitrogen. The samples were dissolved in 400 mL of mobile phase and injected to the HPLC (injection volume: 100 mL). The retention times for DEHP were 9.8 min and 3.1 min, respectively [24]. DEHP concentration was expressed as an under-peak area and compared to DEHP standards of a calibration curve. The detection limit was 2 mg/ mL DEHP.
105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
2.4.
RNA isolation and semi-quantitative RT-PCR
129
Expression of mRNA encoding steroidogenic enzymes was determined by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). Total RNA was extracted from testes of control and treated rats with the use of RNeasy mini kit (Qiagen, Valencia, CA, USA). cDNA synthesis kit (Sigma Aldrich) was used to generate cDNA from 20 mg of total RNA. The primer sequences, annealing temperature and number of cycles for PCR (Table 1) for 17b-hydroxysteroid dehydrogenase III (17b-HSD III) were established according to the earlier reports [25], while those for 3b-hydroxysteroid dehydrogenase
130 131 132 133 134 135 136 137 138 139
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
REPBIO 119 1–8
3
reproductive biology xxx (2014) xxx–xxx
Table 1 – Primers and PCR conditions used in the experiment. Genes
Primers
3b-HSD
F: ATCCAGTGTATGTAGGCAATGTGGCCT R: AAGTGGCACATAGCCCAGATCTC F: TTCTGCAAGGCTTTACCAGG R: ACAAACTCATCGGCGGTCAA
95 8C, 72 8C, 95 8C, 72 8C,
5 min, 27 cycles (95 8C, 50 s, 55 8C, 30 s, 100 s), 72 8C, 10 min, 4 8C 5 min, 31 cycles (94 8C, 50 s, 50 8C, 30 s, 100 s), 72 8C, 10 min, 4 8C
365
F: AGACAGCCGCATCTTCTTGT R: CTTGCCGTGGGTAGAGTCAT
95 8C, 5 min, 27 cycles (95 8C, 50 s, 55 8C, 30 s, 72 8C, 100 s), 72 8C, 10 min, 4 8C
207
17b-HSDIII
GAPDH
PCR conditions
Product size (bp)
653
The primer sequences, annealing temperature and number of cycles as well as product size (base pairs, bp) of PCR.
Table 2 – Plasma DEHP and serum testosterone concentrations (mean W SEM) in rats treated with DEHP and/or AP.
significant differences among the experimental groups (software package version 10, SPSS Inc., Chicago, IL, USA).
152 153
Groups
3.
154
Control Corn oil AP (50 mg/kg) DEHP (300 mg/kg) DEHP (500 mg/kg) DEHP (1000 mg/kg) DEHP (300 mg/kg) + AP DEHP (500 mg/kg) + AP DEHP (1000 mg/kg) + AP
DEHP (mg/mL) Testosterone (ng/mL) a
1.96 0.24 1.54 0.31 a 1.27 0.18 a 12.51 3.21 c 13.57 5.43 c 14.11 2.65 c 10.72 1.11 b 11.06 2.75 b 13.35 1.15 c
Results
a
3.34 1.38 2.80 0.20 b 3.00 0.75 b 2.95 0.66 b 2.48 0.46 b 1.31 0.30 d 2.82 0.86 b 2.90 0.62 b 1.62 0.19 c
n = 10/group; different superscripts mean significant differences (p < 0.05) among means within a column; AP: Apium graveolens; DEHP: di-(2-ethylhexyl) phthalate.
140 141 142 143 144 145 146 147 148
I (3b-HSD I) were adapted from Song et al. [26]. PCR-amplified fragments were run alongside molecular weight markers on 2% agarose gels (Sigma Aldrich) and stained with ethidium bromide (Agagel Mini Horizontal Gel Electrophoresis Apparatus, Göttingen, Germany). Gels were visualized with UVP photo Doc-ItTM Imaging system (UVP, Upland, CA, USA). The relative intensities of the bands were normalized to the corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) band intensities.
149
2.5.
150 151
Data were expressed as mean SEM. One-way analysis of variance followed by the LSD test was used to assess
Statistical analysis
DEHP was found in all plasma samples from all examined groups (Table 2). Mean plasma DEHP concentrations were higher (p < 0.01) in DEHP-treated groups compared with control, corn oil and AP groups. The combined treatment of AP and DEHP (300 or 500 mg/kg) caused significant (p < 0.05) decrease in plasma DEHP level as compared to the rats treated with DEHP only. However, AP had no effect on DEHP level when the phthalate was administered together with 1000 mg/kg DEHP. Mean final body weight as well as mean testis and relative testis weights were lower (p < 0.001) in all DEHP groups than in controls (Table 3). A. graveolens treatment alleviated (p < 0.05) the adverse effects of the two lower DEHP doses, but not that of the highest DEHP dose. The latter dose of DEHP (1000 mg/kg) decreased (p < 0.01) serum T level, and the AP treatment partially mitigated (p < 0.05) the DEHP effect on T level (Table 2). Serum T was not affected by the lower doses of DEHP (300 and 500 mg/kg). The highest dose of DEHP reduced serum levels of total cholesterol and protein, whereas the two lower doses of DEHP were not effective. In contrast, total antioxidant capacity of testicular tissue was higher in all DEHP-treated groups as compared to the control groups. The AP treatment significantly moderated (p < 0.05) the DEHP effects on serum cholesterol, proteins and total antioxidant capacity in the testis (Table 4). After six weeks of treatment, two higher doses of DEHP decreased 3b-HSD I expression in rat testis (Fig. 1). All DEHP
Table 3 – Effects of DEHP and/or AP on body and testis weights (mean W SEM). Groups Control Corn oil AP (50 mg/kg) DEHP (300 mg/kg) DEHP (500 mg/kg) DEHP (1000 mg/kg) DEHP (300 mg/kg) + AP DEHP (500 mg/kg) + AP DEHP (1000 mg/kg) + AP
Initial body weight (g)
Final body weight (g)
Testicular weight (g)
Relative testicular weight* (g %)
120.9 2.4 a 122.3 9.5 a 123.6 1.8 a 120.3 1.4 a 122.8 2.5 a 120.5 1.5 a 123.0 3.2 a 122.6 2.7 a 121.8 0.9 a
221.8 2.8 a 204.6 7.7 a 200.7 4.0 a 181.2 6.8 c 179.0 4.1 c 171.9 5.7 d 195.4 4.3 b 190.0 7.3 b 181.62 3.8 c
1.27 4.42 a 1.20 4.38 a 1.16 8.86 a 0.93 0.11 b 0.75 0.13 b 0.42 1.62 c 1.12 0.12 a 0.88 5.17 b 0.42 2.51 c
0.57 4.39 a 0.58 2.81 a 0.57 4.52 a 0.51 5.06 b 0.41 6.05 c 0.24 9.73 d 0.57 4.86 a 0.46 2.34 b 0.23 1.09 d
* Relative testicular weight: testicular weight (g)/final bodyweight (g) 100; n = 10/group; different superscripts mean significant differences (p < 0.05) among means within a column. AP: Apium graveolens; DEHP: di-(2-ethylhexyl) phthalate.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180
REPBIO 119 1–8
4
reproductive biology xxx (2014) xxx–xxx
Table 4 – Effects of DEHP and/or AP on total cholesterol and protein concentrations in plasma as well as total antioxidant capacity in the testis (mean W SEM). Groups Control Corn oil AP (50 mg/kg) DEHP (300 mg/kg) DEHP (500 mg/kg) DEHP (1000 mg/kg) DEHP (300 mg/kg) + AP DEHP (500 mg/kg) + AP DEHP (1000 mg/kg) + AP
Total cholesterol (mg/dL) a
84.20 7.47 87.16 4.96 a 85.66 10.17 a 83.33 2.02 a 73.25 10.46 a 65.62 5.03 b 86.00 1.52 a 83.25 5.36 a 79.44 3.93 a
Total protein (g/dL) a
12.50 2.00 11.25 0.25 a 10.50 0.50 a 10.28 0.52 a 10.00 0.32 a 9.53 0.51 b 10.16 0.87 a 10.33 0.42 a 10.42 0.20 a
Total antioxidant capacity (mM/L) 0.69 5.51 a 0.58 4.71 a 0.50 8.50 a 1.20 8.88 c 1.25 0.12 c 1.37 7.24 d 1.02 9.06 b 1.00 7.08 b 1.00 5.96 b
n = 10/group; different superscripts mean significant differences (p < 0.05) among means within a column. AP: Apium graveolens; DEHP: di-(2ethylhexyl) phthalate.
Fig. 1 – Effects of di-(2-ethylhexyl) phthalate (DEHP) and/or Apium graveolens (AP) on mRNA level (mean W SEM) of steroidogenic enzymes (A, 3b-HSD I; B, 17b-HSD III) in the testis of adult rats (n = 3 rats/group). Data are presented as a relative intensity of PCR products to GAPDH. Different superscripts designate significant differences (p < 0.05); low DEHP: 300 mg/kg, med DEHP: 500 mg/kg, high DEHP: 1000 mg/kg bwt. GAPDH: glyceraldehyde-3-phosphate dehydrogenase – a housekeeping gene; control groups: contr (no treatment), corn oil and AP. Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
REPBIO 119 1–8 reproductive biology xxx (2014) xxx–xxx
181 182 183 184 185 186
doses declined 17 b-HSD III mRNA expression. A. graveolens administered together with medium and high dose of DEHP significantly (p < 0.05) increased gene expression of 3b-HSD I and 17b-HSD III compared to those of DEHP alone. In addition, the AP treatment partially abolished the inhibitory effect of the lowest DEHP dose on 17b-HSD III gene expression.
5
Parenchyma of control testis was formed of rounded seminiferous tubules. Most of them attained narrow lumina and were lined by stratified germinal epithelium (Fig. 2a and b). Sertoli cells appeared as column cells in between spermatogonia (Fig. 2b). Administration of DEHP (500 mg/kg) caused congestion of the blood vessels and extensive degeneration of
Fig. 2 – Histological images of testis in di-(2-ethylhexyl) phthalate (DEHP)- and/or Apium graveolens (AP)-treated adult rats (a). (b) Control rats: seminiferous tubules (S) with complete arrangement of germinal eptithelium; (a) 40T; (b) 400T, Sertoli cells appear as column cells in between spermatogonia (arrow); (c) DEHP (500 mg/kg)-treated rats (250T): visible congestion of the blood vessel (arrow) and extensive degeneration of the germinal epithelium and Leydig cells (arrow heads); (d and e) DEHP (1000 mg/kg)-treated rats; (d) most of the seminiferous tubules were markedly distorted with very wide lumina, no spermatozoa, and reduction in the thickness of tubule's epithelial lining (250T); (e) severe atrophy, vacuolar degeneration (v) and aspermia (arrow) (100T); (f) AP and DEHP (1000 mg/kg)-treated rats: most of the seminiferous tubules nearly regained their normal architecture (250T). Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
187 188 189 190 191 192
REPBIO 119 1–8
6
reproductive biology xxx (2014) xxx–xxx
193 194 195 196 197 198 199 200
seminiferous tubules (Fig. 2c). Most of seminiferous tubules of rats receiving the highest dose of DEHP were markedly distorted, having very wide lumina and reduced thickness of their epithelial lining, with no spermatozoa (Fig. 2d). Vacuolar degeneration of the germinal epithelium in some seminiferous tubules was also observed (Fig. 2e). In contrast, AP administered concurrently with the highest DEHP dose (Fig. 2f) caused a recovery of most of the seminiferous tubules.
201
4.
202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249
The present study demonstrated that a 6-week exposure of male adult rats to the industrial pollutant, DEHP, decreased testicular weight, inhibited spermatogenesis and serum T concentration. The reduction in testis weight, a valuable index of reproductive toxicity in male animals, is consistent with previous results [27,28]. This reduction is caused by the lowered production of testicular androgens, possibly as a result of the loss of Leydig cells [29,30]. After oral administration, DEHP is hydrolyzed in the rat small intestine and other tissues by esterases to produce mono (2-ethylhexyl) phthalate (MEHP) [31]. Because MEHP is the most toxic metabolite of DEHP, it was hypothesized that this monoester is responsible for the induction of testis atrophy [32]. DEHP was found to decrease serum T via the MEHP effects on Sertoli cells [33] and interference with T synthesis [34]. Administration of DEHP, especially at 1000 mg/kg, significantly reduced the serum level of total cholesterol. Most studies demonstrated a decrease in blood cholesterol in animals treated with DEHP [35] which might affect steroidogenesis via interfering with cholesterol transport [36]. 3b-HSD and 17b-HSD play a key regulatory role in testicular spermatogenesis [37]. In laboratory animals, DEHP was reported to exert anti-androgenic action [5] and endocrine disruptor properties [38,39]. This may be associated with the reduction of testicular mRNA levels of 3b-HSD I and 17b-HSD III. Administration of DEHP elevated total testicular antioxidant capacity as compared to the control rats. Also, Kasahara et al. [27] found an increase in the antioxidant enzymes (glutathione peroxidase and catalase) and a decrease in the antioxidant (free thiol, GSH and ascorbic acid) levels in the testis of DEHP-treated rats due to the toxic effect of MEHP which enhanced the generation of reactive oxygen species (ROS) as well as the oxidative stress in the testicular cells [40]. Because oxidative stress in the testis is one of the major factors that induce germ cell apoptosis, this organ has fairly high concentrations of antioxidants, such as glutathione (GSH), ascorbic acid and vitamin E, that protect germ cells against oxidative DNA damage [27]. In addition, a significant reduction in the serum level of total protein demonstrated in the DEHP treated groups may result in an arrest of spermatogenesis due to a lack of adequate amount of protein. This also might affect testicular function [41]. Histological examination of the testis showed that DEHP treatment caused a marked distortion of the structure of seminiferous tubules, including reduction in the thickness of tubules' epithelial lining, vacuolar degeneration and aspermia. This finding is in accordance with many previous reports [3,19]. Histological changes after DEHP administration may be
Discussion
due to the actions of MEHP which was reported to induce apoptosis in spermatogenic cells [42] and up-regulate the expression of Fas ligand in Sertoli cells [43,44]. Aspermatogenesis may also be associated with damage of the Sertoli cells [45], testicular zinc depletion [38], decreased estrogen level [46] and/or the anti-androgenic effects of DEHP [3]. The present study demonstrated that celery oil (A. graveolens) alleviated the testis damage induced by DEHP. This is consistent with previous reports concerning the celery oil effects on testicular toxicity induced by other chemical toxicants in male rats [17,47–49]. The protective effects of celery oil can be attributed to its antioxidant properties and the androgenic activities of apigenin, limonene, and phthalide glycosides-ingredients [15–17,47,48]. Celery oil can decrease the oxidative stress in the testis, protect maturation of spermatozoa and improve sperm function [50]. To summarize, DEHP exerted toxic effects on the testis and inhibited androgen production, while concurrent administration of A. graveolens protected the testis against the DEHP-induced toxicity in adult male rats.
250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271
Acknowledgments
272
The author thanks all staff members of the Medical Research Center, Ain Shams University for making all facilities available for the author's research.
273 274 275
references
276
[1] Skakkebaek NE, Rajpert-De Meyts E, Main KM. Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Hum Reprod 2001;16:972–8. [2] Borch J, Broeng S, Vinggaard AM, Brokken L, Dalgaard M. Mechanisms underlying the anti-androgenic effects of diethylhexyl phthalate in fetal rat testis. Toxicology 2006;223:144–55. [3] Erkekoglu P, Zeybek ND, Giray B, Asan E, Arnaud J, Hincal F. Reproductive toxicity of di(2-ethylhexyl) phthalate in selenium-supplemented and selenium-deficient rats. Drug Chem Toxicol 2011;34(4):379–89. [4] Benson R. Hazard to the developing male reproductive system from cumulative exposure to phthalate esters— dibutyl phthalate, diisobutyl phthalate, butylbenzyl phthalate, diethylhexyl phthalate, dipentyl phthalate, and diisononyl phthalate. Regul Toxicol Pharmacol 2009;53:90–101. [5] Moore RW, Rudy TA, Lin TM, Ko K, Peterson RE. Abnormalities of sexual development in male rats with in utero and lactational exposure to the antiandrogenic plasticizer di(2-ethylhexyl) phthalate. Environ Health Perspect 2001;109(3):229–37. [6] Lovekamp-Swan T, Davis BJ. Mechanisms of phthalate ester toxicity in the female reproductive system. Environ Health Perspect 2003;111:139–45. [7] Pan G, Hanaoka T, Yoshimura M, Zhang S, Wang P, Tsukino H, et al. Decreased serum free testosterone in workers exposed to high levels of di-n-butyl phthalate (DBP) and di2-ethylhexyl phthalate (DEHP): a cross-sectional study in China. Environ Health Perspect 2006;114:1643–8.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307
REPBIO 119 1–8 reproductive biology xxx (2014) xxx–xxx
308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376
[8] Pant N, Shukla M, Kumar Patel D, Shukla Y, Mathur N, Kumar Gupta Y, et al. Correlation of phthalate exposures with semen quality. Toxicol Appl Pharmacol 2008;231: 112–6. [9] Phillips KP, Tanphaichitr N. Human exposure to endocrine disrupters and semen quality. J Toxicol Environ Health B: Crit Rev 2008;11:188–220. [10] Jarfelt K, Dalgaard M, Hass U, Borch J, Jacobsen H, Ladefoged O. Antiandrogenic effects in male rats perinatally exposed to a mixture of di(2-ethylhexyl) phthalate and di(2ethylhexyl) adipate. Reprod Toxicol 2005;19:505–15. [11] Barnes J, Anderson AL, Phillipson JD, editors. Herbal medicines. London, Chicago: Pharmaceutical Press; 2002. [12] Lewis DA, Tharib SM, Veitch GBA. The anti-inflammatory activity of celery Apium graveolens L. (Fam. Umbelliferae). Int J Crude Drug Res 1985;23:27–32. [13] Tsi D, Tan BK. The mechanism underling the hypocholesterolemic activity of celery extracts (aqueous and butanol extracts) in hypercholesterolemic rats. Life Sci 2000;14(66):755–67. [14] Whitehouse MW, Butters DE, Clarke ML, Rainsford KD. NSAID gastropathy: prevention by celery seed extracts in of benzo (a) pyrene-induced forestomach cancer in mice by natural phthalides from celery seed oil. Nutr Cancer 2001;19:77–86. [15] Momin RA, Nair MG. Antioxidant, cyclooxygenase and topoisomerase inhibitory compounds from Apium graveolens seeds. Phytomedicine 2002;9(4):312–8. [16] Sultana S, Salahuddin A, Tamanna J, Sharma S. Inhibitory effect of celery seed extract on chemically induced hepatocarcinogenesis: modulation of cell proliferation, metabolism and altered hepatic foci development. Cancer Lett 2005;221:11–20. [17] Hamza AA, Amin A. Apium graveolens modulates sodium valproate-induced reproductive toxicity in male rats. J Exp Zool A 2007;307(4):199–206. [18] Jain GC, Pareek H, Khajja BS, Jain K, Jhalani S, Agarwal S, et al. Modulation of di-(2-ethylhexyl) phthalate induced hepatic toxicity by Apium graveolens L. seeds extract in rats. Afr J Biochem Res 2009;3:222–5. [19] Noriega NC, Howdeshell KL, Furr J, Lambright CR, Wilson VS, Earl Gray Jr L. Pubertal administration of DEHP delays puberty, suppresses testosterone production, and inhibits reproductive tract development in male Sprague-Dawley and Long-Evans rats. Toxicol Sci 2009;111(1):163–78. [20] Tietz NW. Fundamentals of clinical chemistry. 2nd ed. Philadelphia: Saunders WB: Co; 1976. p. 506. [21] Koller A. Total serum protein. St. Louis, Toronto/Princeton: The Mosby CV Co.; 1984, 1316–24, 418. [22] Koracevic D, Koracevic G, Djordjevic V, Andrejevic S, Cosic V. Method for the measurement of antioxidant activity in human fluids. J Clin Pathol 2001;54(5):356–61. [23] Paris I, Ruggieri F, Mazzeo P, Carlucci G. Simultaneous determination of di-(2-ethylhexyl)-phthalate and mono-(2ethylhexyl)-phthalate in human plasma by HPLC. Anal Lett 2003;36:2645–54. [24] Durmaz E, Ozmert EN, Erkekoglu P, Giray B, Derman O, Hincal F, et al. Plasma phthalate levels in pubertal gynecomastia. Pediatrics 2010;125(1):122–9. [25] Umar V, Kural MR, Pereira BMJ, Roy P. Spearmint induced hypothalamic oxidative stress and testicular antiandrogenicity in male rats – altered levels of gene expression, enzymes and hormones. Food Chem Toxicol 2008;46:3563–70. [26] Song L, Tang X, Kong Y, Ma H, Zou S. The expression of serum steroid sex hormones and steroidogenic enzymes following intraperitoneal administration of dehydroepiandrosterone (DHEA) in male rats. Steroids 2010;75:213–8.
[27] Kasahara E, Sato EF, Miyoshi M, Konaka R, Hiramoto K, Sasaki J, et al. Role of oxidative stress in germ cell apoptosis induced by di(2-ethylhexyl) phthalate. Biochem J 2002;365:849–56. [28] Vo TT, Jung EM, Dang VH, Yoo YM, Choi KC, Yu FH, et al. Di(2 ethylhexyl) phthalate and flutamide alter gene expression in the testis of immature male rats. Reprod Biol Endocrinol 2009;26(7):104. [29] Ng TB, Liu WK. Toxic effect of heavy metals on cells isolated from the rat adrenal end testis. In Vitro Cell Dev Biol 1990;26(1):24–8. [30] Ray A, Chatterjee S, Bagchi P, Deb C. Effect of quinolphos on testicular steroidogenesis in rats. Andrologia 1988;20:163–8. [31] Pollack GM, Li RC, Ermer JC, Shen DD. Effects of route of administration and repetitive dosing on the disposition kinetics of di(2-ethylhexyl)phthalate and its mono-deesterified metabolite in rats. Toxicol Appl Pharmacol 1985;79:246–56. [32] Gray TJ, Gangolli SD. Aspects of the testicular toxicity of phthalate esters. Environ Health Perspect 1986;65:229–35. [33] Li LH, Jester Jr WF, Laslett AL, Orth JM. A single dose of di-(2ethylhexyl) phthalate in neonatal rats alters gonocytes, reduces Sertoli cell proliferation, and decreases cyclin D2 expression. Toxicol Appl Pharmacol 2000;16:222–9. [34] Akingbemi BT, Youker RT, Scottas CM, Ge R, Katz E, Klinefelter GR, et al. Modulation of rat Leydig cell steroidogenesis function by di(2-ethylhexyl) phthalate. Biol Reprod 2001;65:1252–9. [35] Mocchiutti NO, Bernal CA. Effects of chronic di(2ethylhexyl) phthalate intake on the secretion and removal rate of triglyceride-rich lipoproteins in rats. Food Chem Toxicol 1997;35:1017–21. [36] Liu K, Lehmann KP, Sar M, Young SS, Gaido KW. Gene expression profiling following in utero exposure to phthalate esters reveals new gene targets in the etiology of testicular dysgenesis. Biol Reprod 2005;73: 180–92. [37] Sadik NA. Effects of diallyl sulfide and zinc on testicular steroidogenesis in cadmium-treated male rats. J Biochem Mol Toxicol 2008;22(5):345–53. [38] Park JD, Habeebu SS, Klaassen CD. Testicular toxicity of di(2-ethylhexyl)phthalate in young Sprague-Dawley rats. Toxicology 2002;171:105–15. [39] Wong J, Gill S. Gene expression changes induced in mouse liver by di(2-ethylhexyl) phthalate. Toxicol Appl Pharmacol 2002;185:180–96. [40] Ablake M, Itoh M, Terayama H, Hayashi S, Shoji S, Naito M, et al. Di-(2-ethylhexyl) phthalate induces severe aspermatogenesis in mice, however, subsequent antioxidant vitamins supplementation accelerates regeneration of the seminiferous epithelium. Int J Androl 2004;27(5):274–81. [41] Chinoy NJ, Tewari K, Jhala D. Fluoride and/or arsenic toxicity in mice testis with formation of giant cells and subsequent recovery by some antidotes. Fluoride 2004;37 (3):172–84. [42] Richburg JH, Boekelheide K. Mono-(2-ethylhexyl) phthalate rapidly alters both Sertoli cell vimentin filaments and germ cell apoptosis in young rat testes. Toxicol Appl Pharmacol 1996;137:42–50. [43] Lee J, Richburg JH, Shipp EB, Meistrich ML, Boekelheide K. The Fas system, a regulator of testicular germ cell apoptosis, is differentially up-regulated in Sertoli cell versus germ cell injury of the testis. Endocrinology 1999;140:852–8. [44] Lee J, Richburg JH, Younkin SC, Boekelheide K. The Fas system is a key regulator of germ cell apoptosis in the testis. Endocrinology 1997;138:2081–8.
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
7 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445
REPBIO 119 1–8
8 446 447 448 449 450 451 452 453 454 455 456
reproductive biology xxx (2014) xxx–xxx
[45] David RM, Moore MR, Finney DC, Guest D. Chronic toxicity of di(2-ethylhexyl) phthalate in rats. Toxicol Sci 2000;55:433–43. [46] Kim HS, Saito K, Kazusaka MI, Fujita S. Short period exposure to di-(2-ethylhexyl) phthalate regulates testosterone metabolism in testis of prepubertal rats. Arch Toxicol 2003;77:446–51. [47] Popovic M, Kaurinovi B, Trivi S, Mimica-Duki N, Bursa M. Effect of celery (Apium graveolens) extracts on some biochemical parameters of oxidative stress in mice treated with carbon tetrachloride. Phytother Res 2006;20:531–7.
[48] Shalaby MA, El Zorba HY. Protective effect of celery oil, vitamin E and their combination against testicular toxicity in male rats. Glob Vet 2010;5(2):122–8. [49] Wahba HMA. Protective effect of Nigella sativa, linseed and celery oils against testicular toxicity induced by sodium valproate in male rats. J Am Sci 2011;7(5):687–93. [50] Piomboni P, Gambera L, Serafini F, Campanella G, Morgante G, Leo V. Sperm quality improvement after natural anti-oxidant treatment of asthenoteratospermic men with leukocytospermia. Asian J Androl 2008;10(2): 201–6.
457 458 459 460 461 462 463 464 465 466 467 468
Please cite this article in press as: Helal M.A.M. Celery oil modulates DEHP-induced reproductive toxicity in male rats. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2014.04.002
