Published online 8 July 2016
Nucleic Acids Research, 2016, Vol. 44, No. 20 9933–9941 doi: 10.1093/nar/gkw628
Cellular and molecular phenotypes depending upon the RNA repair system RtcAB of Escherichia coli Christoph Engl1,2,* , Jorrit Schaefer1 , Ioly Kotta-Loizou1 and Martin Buck1,* 1
Faculty of Natural Sciences, Division of Cell & Molecular Biology, Imperial College London, London SW7 2AZ, UK and 2 Institute for Global Food Security, Queen’s University Belfast, Belfast BT9 7BL, UK
Received February 17, 2016; Revised June 6, 2016; Accepted June 23, 2016
ABSTRACT RNA ligases function pervasively across the three kingdoms of life for RNA repair, splicing and can be stress induced. The RtcB protein (also HSPC117, C22orf28, FAAP and D10Wsu52e) is one such conserved ligase, involved in tRNA and mRNA splicing. However, its physiological role is poorly described, especially in bacteria. We now show in Escherichia coli bacteria that the RtcR activated rtcAB genes function for ribosome homeostasis involving rRNA stability. Expression of rtcAB is activated by agents and genetic lesions which impair the translation apparatus or may cause oxidative damage in the cell. Rtc helps the cell to survive challenges to the translation apparatus, including ribosome targeting antibiotics. Further, loss of Rtc causes profound changes in chemotaxis and motility. Together, our data suggest that the Rtc system is part of a previously unrecognized adaptive response linking ribosome homeostasis with basic cell physiology and behaviour. INTRODUCTION Many bacteria contain a small operon rtcBA encoding the RtcAB proteins whose biochemical characterizations from a range of sources show they enzymatically modify RNA ends (RtcA) and carry out ligation (RtcB) of these ends respectively (1–4). In eukaryotes and archaea a role for RtcB in tRNA splicing and HAC1/XBP1 mRNA splicing for the unfolded protein response has emerged (5–10). The absence of introns in Escherichia coli tRNAs suggest a wider role for the bacterial Rtc system than currently documented from eukaryotic and archaeal studies (11,12). Loss of RtcB creates large morphological changes along development pathways outside of the unfolded protein response and tRNA maturation (9). RtcA- and RtcBdependent morphological changes include inhibition of post traumatic axon regeneration in the central nervous system in Drosophila and Caenorhabditis elegans, respectively
(13,14). To determine the role of the RtcR activated rtcBA operon in E. coli bacteria we examined phenotypes and transcriptional profiles of cells lacking RtcA and RtcB, and determined conditions whereby RtcR was activated to drive elevated expression of rtcBA. Our findings suggest that in E. coli the Rtc system supports key cellular processes ranging from maintaining the translational apparatus to control of antibiotic sensitivity and chemotactical behaviour.
MATERIALS AND METHODS Bacterial strains and genetic manipulations Unless stated otherwise, bacteria were grown in LB or M9 medium as specified at 37◦ C with appropriate antibiotics. In frame deletions of rtcR, rtcB and rtcA in E. coli BW25113 were from the Keio collection (15) and transduced into E. coli MG1655 for study. The mRNA expression levels of rtcB and rtcA in the cells lacking rtcB and rtcA were assessed by real-time RT-qPCR (Supplementary Figure S1a). The VapCLT2 gene was synthesized by Thermo Fisher Scientific GENEART GmbH (Germany) and subcloned into pBAD18cm. The genes encoding rtcRΔNTD , rtcB and rtcA were amplified from the E. coli MG1655 chromosome and subcloned into pBAD18cm. The rtcAH308A and rtcBH337A catalytic mutants were constructed using the QuikChange Site-Directed Mutagenesis kit (Agilent) according to the instructions of the manufacturer. The rtcBA promoter including regulatory sequences (175 nt upstream of the rtcB start codon) was synthesized by Thermo Fisher Scientific GENEART GmbH (Germany) and subcloned into pBBR1MCS-4 containing gfp-mut3 or lacZ including a rbs30 ribosome binding site (rbs30: TCTAGAGATTAAAGAGGAGAAATACTAGATG; from Registry of Standard Biological Parts, http: //partsregistry.org) and a transcriptional terminator (16,17). Antibiotic concentrations: Ampicillin: 100 g/ml; Chloramphenicol: 25 g/ml.
* To
whom correspondence should be addressed. Tel: +44 28 9097 2300; Fax: +44 28 9097 5877; Email: [email protected] Correspondence may also be addressed to Martin Buck. Tel: +44 207 594 5442; Fax: +44 207 594 5419 Email: [email protected]
C The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.
9934 Nucleic Acids Research, 2016, Vol. 44, No. 20 -Galactosidase assay Cells containing the pBBR1MCS-4(PrtcBA -lacZ) reporter were grown at 37◦ C in LB broth containing the appropriate antibiotic. Expression of VapCLT2 and RtcRNTD from pBAD18cm was induced for 1h with 0.02% L-arabinose. LacZ activity was measured at mid-log phase as described (18). Motility assay Motility assays were performed as described (19). About 2 l of bacterial culture were spotted onto soft agar plates supplemented with the appropriate antibiotics and 0.2% Larabinose. Motility was measured as the diameter of bacterial spread in mm after overnight incubation at room temperature. Survival assays For survival assays, optical density at 600 nm (OD600 ) of the bacterial cultures was recorded in absence and presence of stress. Stress conditions (VapCLT2 , colicin D, tetracycline) were introduced at mid-log phase of growth. Expression of VapCLT2 from pBAD18cm was induced by 0.02% Larabinose, colicin D and tetracycline were added to the bacterial cultures at concentrations of 250 nM and 1.5 g/ml, respectively. Screens for rtcBA inducing genetic lesions and abiotic compounds Genetic lesions inducing rtcBA expressions were screened by transforming a pool of Keio mutants (15) and a small peptide/ small RNA mutant library (20) with pBBR1MCS4(PrtcBA -lacZ) and subsequent blue/white screening on XGal plates. Positive clones were then subjected to Galactosidase assays in liquid culture. To screen for abiotic rtcBA inducers cells containing pBBR1MCS-4(PrtcBA -gfp) grown in M9 medium were resuspended in Phenotype MicroArray plates (Biolog Inc., USA) and transferred to black 96-well clear-bottom tissue culture plates. In a BMG FLUOstar Omega microplate reader (BMG Labtech Ltd., UK) OD600 and green fluorescence (excitation: 485 nm; emission: 520 ± 10 nm, gain: 1000) were measured and promoter activity was expressed as fluorescence emission EM520 per OD600 . Inverse PCR Inverse polymerase chain reaction (PCR) as described in (21) was used to identify selected genetic lesions which increased rtcBA expression. RNA deep sequencing RNA deep sequencing of whole cells was as described (21). For RNA deep sequencing of ribosome fractions firststrand cDNA synthesis was primed with a N6 randomized primer. After fragmentation, the Illumina TruSeq sequencing adapters were ligated in a strand specific manner to the 5’ and 3’ ends of the cDNA fragments. This way, a strand
specific PCR amplification of the cDNA was achieved using a proof reading enzyme. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics). The cDNA samples were pooled for near equimolar amounts and single-end sequenced (75 bp) on an Illumina NextSeq 500 system. The cDNA reads were analysed via the RNA-seq workflow within Partek® Genomics suite 6.6, including a QA/QC step to gauge the sequencing quality. Each sample yielded close to equivalent total reads aligned to the E. coli K-12 reference genome CP009273. The experiments were performed in duplicate. Gene ontology (GO) enrichment analysis was performed using the PANTHER Classification System (22). Ribosome profiling Profiling was conducted under ribosome-associative conditions. Cells were grown with shaking in 500 ml M9 in a 2 l flask supplemented with 0.02% L-arabinose and the appropriate antibiotic and harvested at mid-log phase (OD600 ∼ 0.5). Cell pellets were resuspended in sterile ribosome buffer (20 mM HEPES-KOH, pH 7.5, 6 mM magnesium acetate, 30 mM ammonium chloride, 4 mM 2-mercaptoethanol, 0.1 unit/l DNAse) containing 0.5 mg/ml lysozyme and complete protease inhibitor (1–2 tablets/10 ml) and frozen overnight at −80C. The volume was adjusted to normalize for OD600 . After sonication, cell debris was spun down (5000 rpm; 15 min; 4◦ C), supernatant loaded onto a 4 ml 37.6% sucrose cushion (in ribosome buffer) and ultracentrifuged (31 000 rpm; 2.5 h; 4◦ C). The pellet containing the ribosomes was resuspended in 200 l ribosome buffer and the ribosomes clarified further (5000 rpm; 15 min; 4◦ C). The supernatant was layered onto a 10–40% sucrose gradient (in ribosome buffer) and ultracentrifuged (35 000 rpm; 3 h; 4◦ C). Ribosomal fractions were collected after piercing the bottom of the tube and dripping into wells of a microtiter plate. Adsorption of the fractions at 260 nm was recorded using a spectrophotometer. RNA from the fractions was isolated via peqGOLD TriFast FL reagent (PEQLAB) and inspected by capillary electrophoresis on a Shimadzu MultiNA microchip electrophoresis system. The isolated RNA was subjected to Illumina TruSeq sequencing as described in RNA sequencing. Real-Time quantitative PCR Total bacterial RNA was extracted using the Qiagen RNeasy Protect Bacteria mini kit and treated with DNase I (Promega) and reverse transcription was performed using SuperScript III Reverse Transcriptase. The RT-qPCR assays were performed in the OneStepPlus Real-Time qPCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems). The rtcB mRNA, rtcA mRNA, 23S rRNA, 16S rRNA and 5S rRNA sequences were amplified using the target-specific primer pairs 5 -ACG TGA TAA AGG TGC CTG GG-3 and 5 CAC ACC TGG TCC GAC TCA TC-3 ; 5 -GAC CAA CTG GTG CTA CCG AT-3 and 5 -GCG TTA CGC CAT CTG TTT CT-3 ; 5 -AGA GTA ACG GAG GAG CAC GA-3 and 5 -CAC TAT GAC CTG CTT TCG CA-3 ; 5 CGG ACG GGT GAG TAA TGT CT-3 and 5 -CTC AGA
Nucleic Acids Research, 2016, Vol. 44, No. 20 9935
Figure 1. The rtc locus in Escherichia coli. Expression of the rtcBA operon is positively activated at the transcription level by the bacterial enhancerbinding-protein RtcR working through the 54 -RNA polymerase. RtcR binds to the upstream-activating-sequence (UAS) upstream of the rtcBA promoter (−24/−12 sequences) and transduces an unknown signal via its CARF domain to 54 -RNA polymerase causing upregulation of rtcBA transcription. RtcBA encode a RNA repair system (RtcA: RNA cyclase; RtcB: RNA ligase) whose physiological role is explored here.
CCA GCT AGG GAT CG-3 ; 5 -GGT GGT CCC ACC TGA CCC-3 and 5 -ATG CCT GGC AGT TCC CTA CT3 , respectively. The 5S rRNA served as an endogenous control. RESULTS AND DISCUSSION The Escherichia coli Rtc system responds to challenges to the translation apparatus Expression of the rtcBA operon is activated at the transcription level by the enhancer binding protein RtcR working through the 54 RNA polymerase (1). RtcR is a CARF domain containing protein (23) and transduces an unknown signal to cause upregulation of rtcBA transcription (Figure 1 and Supplementary Figure S1b). RtcRNTD , a N-terminally truncated form of RtcR lacking the regulatory CARF domain, was previously shown to be constitutively active in inducing rtcBA expression (1). In light of Rtc’s role in eukaryotic and archaeal tRNA maturation we tested whether tRNA breaks could induce rtcBA in E. coli. The ribotoxin VapCLT2 is a tRNase from Salmonella enterica serovar Typhimurium LT2 targeting initiator tRNAfMet (24). VapCLT2 thereby inhibits translation and as a consequence causes cell growth to cease (24). Indeed, ectopic production of VapCLT2 upregulated the activity of the rtcBA promoter in an RtcR-dependent manner (Figure 2A). Moreover, the growth inhibiting effect of VapCLT2 was more pronounced in cells lacking rtcR compared to wildtype (WT) cells (Figure 2B) demonstrating that the Rtc system counteracts the toxic effect of VapCLT2. We examined whether Rtc acts as an RNA ligase to directly re-ligate the cleaved tRNAfMet . The cleavage site of VapCLT2 has been mapped to nucleotides +38/+39 in the anticodon stem loop of tRNAfMet (24). Using RNA deep sequencing
we were able to detect this tRNAfMet cleavage event in presence of VapCLT2 (Figure 2C asterisk). Rtc-dependent healing of the tRNAfMet breaks however was not apparent (Figure 2C and D), probably because the expression of RtcB is not completely abolished in the cells lacking rtcR (Supplementary Figure S1b). Any modest changes in re-ligation between the cells lacking rtcR and the WT cells, which would result in the observed differences in growth, were not detected by the methodology employed. The presence of the cleaved tRNAfMet when VapC leads to increased rtcBA promoter activity is consistent with the cleaved tRNAfMet acting as stressor for activation of the rtcBA promoter. To test whether the Rtc response was specific to broken initiator tRNAfMet we measured rtc-dependent survival in presence of colicin D, a ribotoxin targeting the anticodon loop of elongator tRNAArg (25). Again, cells lacking rtcA and rtcB were less able to withstand the stress imposed by colicin D than WT or complemented cells (Supplementary Figure S2). We conclude the Rtc system appears to (i) mount responses to tRNases and (ii) not simply repair damaged tRNAs suggesting other roles for Rtc in these cells potentially linked to effects that broken tRNAs may have on the functioning of the translation apparatus. We next performed unbiased screens for abiotic stressors and mutants which caused up-regulation of the rtcBA promoter. We found that the Rtc system is activated by agents (Supplementary Figure S3a and Supplementary Table S1) or genetic lesions (Supplementary Figure S3c and Supplementary Table S1) which impair the translation apparatus or may cause oxidative damage in the cell. Selected abiotic compounds and genetic lesions were shown not to increase the chromosomal gfp and lacZ+ expression respectively (Supplementary Figure S3b and c), confirming the specificity of the activation of the rtcBA operon. Notably,
9936 Nucleic Acids Research, 2016, Vol. 44, No. 20
Figure 2. The Escherichia coli Rtc system responds to tRNA damage. (A) Activity of the rtcBA promoter measured in Miller units in wild-type (WT) and in cells lacking the activator RtcR (rtcR). Cells contain empty pBAD18cm (−), pBAD18cm expressing VapCLT2 (vapC) or a constitutively active RtcR variant (rtcRNTD ). (B) Growth of WT and rtcR cells in absence (black) and presence (brown) of VapCLT2 . Expression of VapCLT2 from pBAD18cm was induced at exponential phase. (C) RNA deep sequencing of tRNAfMet (here: metV) of WT and rtcR cells producing VapCLT2 . The distribution of all reads for tRNAfMet is presented and cleavage of tRNAfMet at the anticodon loop is indicated by asterisks. (D) Percentage of cleaved and non-cleaved reads at the tRNAfMet anticodon loop of WT and rtcR cells producing VapCLT2 .
Nucleic Acids Research, 2016, Vol. 44, No. 20 9937
Figure 3. The Escherichia coli Rtc system is operational without exogenous stress. RNA deep sequencing of conventionally grown E. coli WT and cells lacking RtcA (rtcA) or RtcB (rtcB). Depicted are (A) area-proportioned Venn diagrams of genes differentially expressed in rtcA and rtcB compared to WT at least 4-fold (P-value < 0.01) and (B) pie charts illustrating the general functional roles of these genes. (C) Depicted is also the functional distribution of genes at least 4-fold differentially expressed in rtcA and/or rtcB compared to WT.
9938 Nucleic Acids Research, 2016, Vol. 44, No. 20
several studies suggest that ribosomal RNA is a major target for oxidative damage (26,27). Further, the stress signalling to RtcR is rather specific since numerous other challenges to cells did not cause up-regulation of the rtcBA genes (Supplementary Figure S3a). As with VapCLT2 and colicin D, survival of a tetracycline challenge, a ribosometargeting antibiotic which induced Rtc, was impaired in absence of a functional Rtc system (Supplementary Figure S4). Taken together, our data suggest that the Rtc system is a helpful adaptive response to challenges to the translation apparatus. A distinct single molecular target for Rtc induction however is not so evident; instead, Rtc inducing challenges act on multiple levels within the translation apparatus: (i) tRNA stability and editing, (ii) interaction of aminoacyl-tRNA with the 30S ribosomal subunit and (iii) peptidyl transferase activity of the 50S ribosomal subunit. Significantly, our findings suggest a novel response of bacteria to antibiotics exposure.
Figure 4. The Escherichia coli Rtc system affects motility and ribosome homeostasis. (A) Motility was assessed on soft agar plates and measured as the diameter of bacterial spread. Shown are fold changes with respect to WT. Cells contained empty pBAD18cm (−), pBAD18cm expressing RtcA (rtcA) or RtcB (rtcB). (B) Ribosome profiles were extracted under ribosome-associative conditions at exponential phase from conventionally grown WT/pBAD18cm, rtcB/pBAD18cm together with complemented rtcB/pBAD18cm(rtcB) cells. Ribosomal RNAs in fractions were measured at A260 .
The Escherichia coli Rtc system functions in ribosome homeostasis and chemotaxis We sought evidence for Rtc activity in the absence of genetic lesions or any applied abiotic stress. Indeed, RNA deep sequencing of cells growing in conventional growth media but lacking rtcA or rtcB revealed Rtc-dependent changes in the transcriptome demonstrating that the Rtc system was operating in conventionally cultured WT cells without any exogenous stress (Figure 3 and supplementary MS Excel spreadsheet). A total of 708 genes were at least 4-fold differently expressed in an Rtc-dependent manner (cut-off: log2 (Δrtc [RPKM]/WT [RPKM]) > +2 or < −2; P-value < 0.01). In total, 524 and 576 genes are differentially expressed in cells lacking rtcA and rtcB compared to the WT and 392 of these genes are common for both mutants (Figure 3A). The majority of genes are downregulated in cells lacking rtcA and rtcB in comparison to the WT. Approximately 15% of the downregulated genes are non-protein encoding genes, i.e. rRNA, tRNA and sRNA encoding genes together with pseudogenes, while the respective percentage for the upregulated genes is
Nucleic Acids Research, 2016, Vol. 44, No. 20 9933–9941 doi: 10.1093/nar/gkw628
Cellular and molecular phenotypes depending upon the RNA repair system RtcAB of Escherichia coli Christoph Engl1,2,* , Jorrit Schaefer1 , Ioly Kotta-Loizou1 and Martin Buck1,* 1
Faculty of Natural Sciences, Division of Cell & Molecular Biology, Imperial College London, London SW7 2AZ, UK and 2 Institute for Global Food Security, Queen’s University Belfast, Belfast BT9 7BL, UK
Received February 17, 2016; Revised June 6, 2016; Accepted June 23, 2016
ABSTRACT RNA ligases function pervasively across the three kingdoms of life for RNA repair, splicing and can be stress induced. The RtcB protein (also HSPC117, C22orf28, FAAP and D10Wsu52e) is one such conserved ligase, involved in tRNA and mRNA splicing. However, its physiological role is poorly described, especially in bacteria. We now show in Escherichia coli bacteria that the RtcR activated rtcAB genes function for ribosome homeostasis involving rRNA stability. Expression of rtcAB is activated by agents and genetic lesions which impair the translation apparatus or may cause oxidative damage in the cell. Rtc helps the cell to survive challenges to the translation apparatus, including ribosome targeting antibiotics. Further, loss of Rtc causes profound changes in chemotaxis and motility. Together, our data suggest that the Rtc system is part of a previously unrecognized adaptive response linking ribosome homeostasis with basic cell physiology and behaviour. INTRODUCTION Many bacteria contain a small operon rtcBA encoding the RtcAB proteins whose biochemical characterizations from a range of sources show they enzymatically modify RNA ends (RtcA) and carry out ligation (RtcB) of these ends respectively (1–4). In eukaryotes and archaea a role for RtcB in tRNA splicing and HAC1/XBP1 mRNA splicing for the unfolded protein response has emerged (5–10). The absence of introns in Escherichia coli tRNAs suggest a wider role for the bacterial Rtc system than currently documented from eukaryotic and archaeal studies (11,12). Loss of RtcB creates large morphological changes along development pathways outside of the unfolded protein response and tRNA maturation (9). RtcA- and RtcBdependent morphological changes include inhibition of post traumatic axon regeneration in the central nervous system in Drosophila and Caenorhabditis elegans, respectively
(13,14). To determine the role of the RtcR activated rtcBA operon in E. coli bacteria we examined phenotypes and transcriptional profiles of cells lacking RtcA and RtcB, and determined conditions whereby RtcR was activated to drive elevated expression of rtcBA. Our findings suggest that in E. coli the Rtc system supports key cellular processes ranging from maintaining the translational apparatus to control of antibiotic sensitivity and chemotactical behaviour.
MATERIALS AND METHODS Bacterial strains and genetic manipulations Unless stated otherwise, bacteria were grown in LB or M9 medium as specified at 37◦ C with appropriate antibiotics. In frame deletions of rtcR, rtcB and rtcA in E. coli BW25113 were from the Keio collection (15) and transduced into E. coli MG1655 for study. The mRNA expression levels of rtcB and rtcA in the cells lacking rtcB and rtcA were assessed by real-time RT-qPCR (Supplementary Figure S1a). The VapCLT2 gene was synthesized by Thermo Fisher Scientific GENEART GmbH (Germany) and subcloned into pBAD18cm. The genes encoding rtcRΔNTD , rtcB and rtcA were amplified from the E. coli MG1655 chromosome and subcloned into pBAD18cm. The rtcAH308A and rtcBH337A catalytic mutants were constructed using the QuikChange Site-Directed Mutagenesis kit (Agilent) according to the instructions of the manufacturer. The rtcBA promoter including regulatory sequences (175 nt upstream of the rtcB start codon) was synthesized by Thermo Fisher Scientific GENEART GmbH (Germany) and subcloned into pBBR1MCS-4 containing gfp-mut3 or lacZ including a rbs30 ribosome binding site (rbs30: TCTAGAGATTAAAGAGGAGAAATACTAGATG; from Registry of Standard Biological Parts, http: //partsregistry.org) and a transcriptional terminator (16,17). Antibiotic concentrations: Ampicillin: 100 g/ml; Chloramphenicol: 25 g/ml.
* To
whom correspondence should be addressed. Tel: +44 28 9097 2300; Fax: +44 28 9097 5877; Email: [email protected] Correspondence may also be addressed to Martin Buck. Tel: +44 207 594 5442; Fax: +44 207 594 5419 Email: [email protected]
C The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.
9934 Nucleic Acids Research, 2016, Vol. 44, No. 20 -Galactosidase assay Cells containing the pBBR1MCS-4(PrtcBA -lacZ) reporter were grown at 37◦ C in LB broth containing the appropriate antibiotic. Expression of VapCLT2 and RtcRNTD from pBAD18cm was induced for 1h with 0.02% L-arabinose. LacZ activity was measured at mid-log phase as described (18). Motility assay Motility assays were performed as described (19). About 2 l of bacterial culture were spotted onto soft agar plates supplemented with the appropriate antibiotics and 0.2% Larabinose. Motility was measured as the diameter of bacterial spread in mm after overnight incubation at room temperature. Survival assays For survival assays, optical density at 600 nm (OD600 ) of the bacterial cultures was recorded in absence and presence of stress. Stress conditions (VapCLT2 , colicin D, tetracycline) were introduced at mid-log phase of growth. Expression of VapCLT2 from pBAD18cm was induced by 0.02% Larabinose, colicin D and tetracycline were added to the bacterial cultures at concentrations of 250 nM and 1.5 g/ml, respectively. Screens for rtcBA inducing genetic lesions and abiotic compounds Genetic lesions inducing rtcBA expressions were screened by transforming a pool of Keio mutants (15) and a small peptide/ small RNA mutant library (20) with pBBR1MCS4(PrtcBA -lacZ) and subsequent blue/white screening on XGal plates. Positive clones were then subjected to Galactosidase assays in liquid culture. To screen for abiotic rtcBA inducers cells containing pBBR1MCS-4(PrtcBA -gfp) grown in M9 medium were resuspended in Phenotype MicroArray plates (Biolog Inc., USA) and transferred to black 96-well clear-bottom tissue culture plates. In a BMG FLUOstar Omega microplate reader (BMG Labtech Ltd., UK) OD600 and green fluorescence (excitation: 485 nm; emission: 520 ± 10 nm, gain: 1000) were measured and promoter activity was expressed as fluorescence emission EM520 per OD600 . Inverse PCR Inverse polymerase chain reaction (PCR) as described in (21) was used to identify selected genetic lesions which increased rtcBA expression. RNA deep sequencing RNA deep sequencing of whole cells was as described (21). For RNA deep sequencing of ribosome fractions firststrand cDNA synthesis was primed with a N6 randomized primer. After fragmentation, the Illumina TruSeq sequencing adapters were ligated in a strand specific manner to the 5’ and 3’ ends of the cDNA fragments. This way, a strand
specific PCR amplification of the cDNA was achieved using a proof reading enzyme. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics). The cDNA samples were pooled for near equimolar amounts and single-end sequenced (75 bp) on an Illumina NextSeq 500 system. The cDNA reads were analysed via the RNA-seq workflow within Partek® Genomics suite 6.6, including a QA/QC step to gauge the sequencing quality. Each sample yielded close to equivalent total reads aligned to the E. coli K-12 reference genome CP009273. The experiments were performed in duplicate. Gene ontology (GO) enrichment analysis was performed using the PANTHER Classification System (22). Ribosome profiling Profiling was conducted under ribosome-associative conditions. Cells were grown with shaking in 500 ml M9 in a 2 l flask supplemented with 0.02% L-arabinose and the appropriate antibiotic and harvested at mid-log phase (OD600 ∼ 0.5). Cell pellets were resuspended in sterile ribosome buffer (20 mM HEPES-KOH, pH 7.5, 6 mM magnesium acetate, 30 mM ammonium chloride, 4 mM 2-mercaptoethanol, 0.1 unit/l DNAse) containing 0.5 mg/ml lysozyme and complete protease inhibitor (1–2 tablets/10 ml) and frozen overnight at −80C. The volume was adjusted to normalize for OD600 . After sonication, cell debris was spun down (5000 rpm; 15 min; 4◦ C), supernatant loaded onto a 4 ml 37.6% sucrose cushion (in ribosome buffer) and ultracentrifuged (31 000 rpm; 2.5 h; 4◦ C). The pellet containing the ribosomes was resuspended in 200 l ribosome buffer and the ribosomes clarified further (5000 rpm; 15 min; 4◦ C). The supernatant was layered onto a 10–40% sucrose gradient (in ribosome buffer) and ultracentrifuged (35 000 rpm; 3 h; 4◦ C). Ribosomal fractions were collected after piercing the bottom of the tube and dripping into wells of a microtiter plate. Adsorption of the fractions at 260 nm was recorded using a spectrophotometer. RNA from the fractions was isolated via peqGOLD TriFast FL reagent (PEQLAB) and inspected by capillary electrophoresis on a Shimadzu MultiNA microchip electrophoresis system. The isolated RNA was subjected to Illumina TruSeq sequencing as described in RNA sequencing. Real-Time quantitative PCR Total bacterial RNA was extracted using the Qiagen RNeasy Protect Bacteria mini kit and treated with DNase I (Promega) and reverse transcription was performed using SuperScript III Reverse Transcriptase. The RT-qPCR assays were performed in the OneStepPlus Real-Time qPCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems). The rtcB mRNA, rtcA mRNA, 23S rRNA, 16S rRNA and 5S rRNA sequences were amplified using the target-specific primer pairs 5 -ACG TGA TAA AGG TGC CTG GG-3 and 5 CAC ACC TGG TCC GAC TCA TC-3 ; 5 -GAC CAA CTG GTG CTA CCG AT-3 and 5 -GCG TTA CGC CAT CTG TTT CT-3 ; 5 -AGA GTA ACG GAG GAG CAC GA-3 and 5 -CAC TAT GAC CTG CTT TCG CA-3 ; 5 CGG ACG GGT GAG TAA TGT CT-3 and 5 -CTC AGA
Nucleic Acids Research, 2016, Vol. 44, No. 20 9935
Figure 1. The rtc locus in Escherichia coli. Expression of the rtcBA operon is positively activated at the transcription level by the bacterial enhancerbinding-protein RtcR working through the 54 -RNA polymerase. RtcR binds to the upstream-activating-sequence (UAS) upstream of the rtcBA promoter (−24/−12 sequences) and transduces an unknown signal via its CARF domain to 54 -RNA polymerase causing upregulation of rtcBA transcription. RtcBA encode a RNA repair system (RtcA: RNA cyclase; RtcB: RNA ligase) whose physiological role is explored here.
CCA GCT AGG GAT CG-3 ; 5 -GGT GGT CCC ACC TGA CCC-3 and 5 -ATG CCT GGC AGT TCC CTA CT3 , respectively. The 5S rRNA served as an endogenous control. RESULTS AND DISCUSSION The Escherichia coli Rtc system responds to challenges to the translation apparatus Expression of the rtcBA operon is activated at the transcription level by the enhancer binding protein RtcR working through the 54 RNA polymerase (1). RtcR is a CARF domain containing protein (23) and transduces an unknown signal to cause upregulation of rtcBA transcription (Figure 1 and Supplementary Figure S1b). RtcRNTD , a N-terminally truncated form of RtcR lacking the regulatory CARF domain, was previously shown to be constitutively active in inducing rtcBA expression (1). In light of Rtc’s role in eukaryotic and archaeal tRNA maturation we tested whether tRNA breaks could induce rtcBA in E. coli. The ribotoxin VapCLT2 is a tRNase from Salmonella enterica serovar Typhimurium LT2 targeting initiator tRNAfMet (24). VapCLT2 thereby inhibits translation and as a consequence causes cell growth to cease (24). Indeed, ectopic production of VapCLT2 upregulated the activity of the rtcBA promoter in an RtcR-dependent manner (Figure 2A). Moreover, the growth inhibiting effect of VapCLT2 was more pronounced in cells lacking rtcR compared to wildtype (WT) cells (Figure 2B) demonstrating that the Rtc system counteracts the toxic effect of VapCLT2. We examined whether Rtc acts as an RNA ligase to directly re-ligate the cleaved tRNAfMet . The cleavage site of VapCLT2 has been mapped to nucleotides +38/+39 in the anticodon stem loop of tRNAfMet (24). Using RNA deep sequencing
we were able to detect this tRNAfMet cleavage event in presence of VapCLT2 (Figure 2C asterisk). Rtc-dependent healing of the tRNAfMet breaks however was not apparent (Figure 2C and D), probably because the expression of RtcB is not completely abolished in the cells lacking rtcR (Supplementary Figure S1b). Any modest changes in re-ligation between the cells lacking rtcR and the WT cells, which would result in the observed differences in growth, were not detected by the methodology employed. The presence of the cleaved tRNAfMet when VapC leads to increased rtcBA promoter activity is consistent with the cleaved tRNAfMet acting as stressor for activation of the rtcBA promoter. To test whether the Rtc response was specific to broken initiator tRNAfMet we measured rtc-dependent survival in presence of colicin D, a ribotoxin targeting the anticodon loop of elongator tRNAArg (25). Again, cells lacking rtcA and rtcB were less able to withstand the stress imposed by colicin D than WT or complemented cells (Supplementary Figure S2). We conclude the Rtc system appears to (i) mount responses to tRNases and (ii) not simply repair damaged tRNAs suggesting other roles for Rtc in these cells potentially linked to effects that broken tRNAs may have on the functioning of the translation apparatus. We next performed unbiased screens for abiotic stressors and mutants which caused up-regulation of the rtcBA promoter. We found that the Rtc system is activated by agents (Supplementary Figure S3a and Supplementary Table S1) or genetic lesions (Supplementary Figure S3c and Supplementary Table S1) which impair the translation apparatus or may cause oxidative damage in the cell. Selected abiotic compounds and genetic lesions were shown not to increase the chromosomal gfp and lacZ+ expression respectively (Supplementary Figure S3b and c), confirming the specificity of the activation of the rtcBA operon. Notably,
9936 Nucleic Acids Research, 2016, Vol. 44, No. 20
Figure 2. The Escherichia coli Rtc system responds to tRNA damage. (A) Activity of the rtcBA promoter measured in Miller units in wild-type (WT) and in cells lacking the activator RtcR (rtcR). Cells contain empty pBAD18cm (−), pBAD18cm expressing VapCLT2 (vapC) or a constitutively active RtcR variant (rtcRNTD ). (B) Growth of WT and rtcR cells in absence (black) and presence (brown) of VapCLT2 . Expression of VapCLT2 from pBAD18cm was induced at exponential phase. (C) RNA deep sequencing of tRNAfMet (here: metV) of WT and rtcR cells producing VapCLT2 . The distribution of all reads for tRNAfMet is presented and cleavage of tRNAfMet at the anticodon loop is indicated by asterisks. (D) Percentage of cleaved and non-cleaved reads at the tRNAfMet anticodon loop of WT and rtcR cells producing VapCLT2 .
Nucleic Acids Research, 2016, Vol. 44, No. 20 9937
Figure 3. The Escherichia coli Rtc system is operational without exogenous stress. RNA deep sequencing of conventionally grown E. coli WT and cells lacking RtcA (rtcA) or RtcB (rtcB). Depicted are (A) area-proportioned Venn diagrams of genes differentially expressed in rtcA and rtcB compared to WT at least 4-fold (P-value < 0.01) and (B) pie charts illustrating the general functional roles of these genes. (C) Depicted is also the functional distribution of genes at least 4-fold differentially expressed in rtcA and/or rtcB compared to WT.
9938 Nucleic Acids Research, 2016, Vol. 44, No. 20
several studies suggest that ribosomal RNA is a major target for oxidative damage (26,27). Further, the stress signalling to RtcR is rather specific since numerous other challenges to cells did not cause up-regulation of the rtcBA genes (Supplementary Figure S3a). As with VapCLT2 and colicin D, survival of a tetracycline challenge, a ribosometargeting antibiotic which induced Rtc, was impaired in absence of a functional Rtc system (Supplementary Figure S4). Taken together, our data suggest that the Rtc system is a helpful adaptive response to challenges to the translation apparatus. A distinct single molecular target for Rtc induction however is not so evident; instead, Rtc inducing challenges act on multiple levels within the translation apparatus: (i) tRNA stability and editing, (ii) interaction of aminoacyl-tRNA with the 30S ribosomal subunit and (iii) peptidyl transferase activity of the 50S ribosomal subunit. Significantly, our findings suggest a novel response of bacteria to antibiotics exposure.
Figure 4. The Escherichia coli Rtc system affects motility and ribosome homeostasis. (A) Motility was assessed on soft agar plates and measured as the diameter of bacterial spread. Shown are fold changes with respect to WT. Cells contained empty pBAD18cm (−), pBAD18cm expressing RtcA (rtcA) or RtcB (rtcB). (B) Ribosome profiles were extracted under ribosome-associative conditions at exponential phase from conventionally grown WT/pBAD18cm, rtcB/pBAD18cm together with complemented rtcB/pBAD18cm(rtcB) cells. Ribosomal RNAs in fractions were measured at A260 .
The Escherichia coli Rtc system functions in ribosome homeostasis and chemotaxis We sought evidence for Rtc activity in the absence of genetic lesions or any applied abiotic stress. Indeed, RNA deep sequencing of cells growing in conventional growth media but lacking rtcA or rtcB revealed Rtc-dependent changes in the transcriptome demonstrating that the Rtc system was operating in conventionally cultured WT cells without any exogenous stress (Figure 3 and supplementary MS Excel spreadsheet). A total of 708 genes were at least 4-fold differently expressed in an Rtc-dependent manner (cut-off: log2 (Δrtc [RPKM]/WT [RPKM]) > +2 or < −2; P-value < 0.01). In total, 524 and 576 genes are differentially expressed in cells lacking rtcA and rtcB compared to the WT and 392 of these genes are common for both mutants (Figure 3A). The majority of genes are downregulated in cells lacking rtcA and rtcB in comparison to the WT. Approximately 15% of the downregulated genes are non-protein encoding genes, i.e. rRNA, tRNA and sRNA encoding genes together with pseudogenes, while the respective percentage for the upregulated genes is
