International Journal of Biological Macromolecules 72 (2015) 544–552

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

Characterization and antioxidant activities of the polysaccharides from Radix Cyathulae officinalis Kuan Xingfa Han a , Shian Shen b , Tieqiu Liu a , Xiaogang Du a , Xiaohan Cao a , Haibo Feng c , Xianyin Zeng a,∗ a

Isotope Research Laboratory, Sichuan Agricultural University, Ya’an 625014, People’s Republic of China College of Life Science, Sichuan Agricultural University, Ya’an 625014, People’s Republic of China c Department of Veterinary Medicine, Southwest University, Rongchang, Chongqing 402460, People’s Republic of China b

a r t i c l e

i n f o

Article history: Received 12 July 2014 Received in revised form 6 September 2014 Accepted 6 September 2014 Available online 16 September 2014 Keywords: Polysaccharides Cyathulae officinalis Kuan Antioxidant activity

a b s t r a c t A water-soluble polysaccharide (PSRC) was extracted and purified from the roots of Radix Cyathulae officinalis Kuan, and its chemical characteristics, monosaccharide composition and antioxidant activities were characterized. The average of molecular weight (Mw ) of PSRC was 182 kDa. The majority of monosaccharide components of PSRC was glucose (relative mass 48.8%) with lower levels of mannose, rhamnose, galactose, fructose and arabinose (relative mass of 15.7, 14.3, 10.6, 6.1 and 4.5%, respectively). In vitro assays revealed that RSRC possessed potent scavenging activities against DPPH, hydroxyl and superoxide anion radicals. Oral administration of PSRC significantly enhanced antioxidant enzyme activities (including total superoxide dismutase, copper-zinc superoxide dismutase (Cu,Zn-SOD), manganese superoxide dismutase (Mn-SOD), glutathione peroxidase and catalase (CAT)) and capacities of scavenging superoxide anion and hydroxyl radicals, markedly lowered lipid peroxidation formation of malondialdehyde and significantly up-regulated mRNA expressions of Cu,Zn-SOD, Mn-SOD, CAT, glutathione peroxidase 1, thioredoxin 1 and thioredoxin 2, in a d-galactose-induced aging mouse model. Taken together, these findings demonstrate that PSRC could be used as a novel promising source of natural antioxidants and antiaging drugs. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Oxidizing reactions occur constantly in the cells as part of aerobic life, resulting in the production of oxygen-derived radicals (reactive oxygen species (ROS)). ROS, if produced in excess, may directly damage various organic substrates, including DNA, proteins, lipids and cell membranes in living cells, and/or indirectly act as primary or secondary messengers to activate signaling pathways that inflict damage on living cells [1], thus resulting in various diseases and disorders, such as cardiovascular diseases, autoimmune disorders, cancer, rheumatoid arthritis and aging [2]. Therefore, it is essential to develop and utilize effective antioxidants to protect living organisms against oxidative damage caused by ROS. Several synthesized commercial antioxidants have been widely used in resisting oxidative damages [3]. However, the presence of undesired side effects from these synthesized antioxidants is almost unavoidable, and those most commonly observed

∗ Corresponding author. Tel.: +86 835 2886138; fax: +86 835 2886138. E-mail address: [email protected] (X. Zeng). http://dx.doi.org/10.1016/j.ijbiomac.2014.09.007 0141-8130/© 2014 Elsevier B.V. All rights reserved.

have been suspected of being responsible for liver damage and carcinogenicity [3]. Therefore, it is essential to develop natural antioxidants with low or even no cytotoxicity. In recent years, amounting studies have documented that polysaccharides from plants, especially from the herbal plants, possess potent antioxidant but low cytotoxic activities, and thus could be explored as sources of novel potential antioxidants [4,5]. However, most of the previous studies evaluating the antioxidant potential of polysaccharides from plants were just carried out in various in vitro systems, while further in vivo evaluations were rarely performed. Radix Cyathulae officinalis Kuan, belonging to Amaranthaceae family, is mainly distributed in Sichuan province, China. The roots of Cyathula officinalis Kuan (“Chuan Niu Xi” in Chinese, C. officinalis Kuan) have been included in the Pharmocopeia of the People’s Republic of China due to its various pharmacological activities, including analgesic, immunostimulant, antitumor, anti-inflammatory, antiaging, removing blood stasis, restoring menstrual flow, inducing diuresis for treating stranguria [6]. Various biologically active compounds, such as phytoecdysteroids, palmitic acids and hyterocyclic compounds [7,8], have been

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

isolated from C. officinalis Kuan, and their biological properties have been characterized. However, a little attention was devoted to the isolation and identification of polysaccharides from C. officinalis Kuan. Moreover, the antioxidant properties of polysaccharides from C. officinalis Kuan have not been characterized yet. In this work, a novel polysaccharide was extracted and purified from C. officinalis Kuan. Its chemical characteristics, monosaccharide composition and structural property were identified, and its antioxidant activities both in vitro and in vivo were evaluated for the first time.

2. Materials and methods 2.1. Chemicals and reagents 2,2-Diphenyl-1-picryl-hydrazyl (DPPH), vitamin C (Vc), glucuronic acid and serial standard monosaccharides (d-glucose, d-xylose, d-fructose, d-galactose, l-rhamnose, d-mannose and darabinose) were purchased Sigma Chemical Co. (St. Louis, Mo, USA). Dextrans of different molecular weights were from Pharmacia Co. (Uppsala, Sweden). The commercial assay kits for hydroxyl and superoxide radicals and antioxidant enzymes (including total superoxide dismutase, copper-zinc superoxide dismutase, manganese superoxide dismutase, glutathione peroxidase and catalase), and malondialdedyde (MDA) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). All other chemicals and reagents were analytical grade.

2.2. Plant materials The C. officinalis Kuan roots were collected in Tian-quan County, Sichuan Province, China, and authenticated by Professor Jiaojia Fan, Department of Pharmaceutical Sciences, Sichuan Agriculture University. The samples were thoroughly washed with tap water, dried at 50 ◦ C and ground into fine powder with a mixer, and screened through an 80-mesh sieve. The resulting powder was stored at 4 ◦ C pending further polysaccharides extraction and purification use.

2.3. Preparation of polysaccharides Dry powder of C. officinalis Kuan root material was repeatedly refluxed with petroleum ether at 60–90 ◦ C and then anhydrous ethanol for 5 h, respectively, to remove colored ingredients and lipids. The residue was obtained by centrifugation (5000 × g for 15 min) and then dried at room temperature. Subsequently, the residue was extracted with distilled water at 95 ◦ C for 2 h with constant stirring. After vacuum filtration, the residue was re-extracted three cycles under the same condition. The filtrates were combined and concentrated by rotary evaporator under reduced pressure below 50 ◦ C. The filtrates were then precipitated at 4 ◦ C for 12 h with ethanol to a 95% final concentration. The precipitate was washed three times with 70% ethanol and lyophilized in vacuum, yielding the aqueous extract of Cyathulae officinalis Kuan (AERC). The AERC was then dissolved in distilled water, deproteinized by the Sevag reagent [9] and dialyzed against distilled water for 72 h. The nondialyzable phase was reconcentrated and then precipitated with ethanol to a 95% final concentration. The resulting precipitate was collected by centrifugation (5000 × g for 15 min), thrice washed with 70% ethanol and dried to a constant weight. Finally, the aqueous polysaccharide fraction of Radix Cyathulae officinalis Kuan (APPC) was obtained. The yield of APPC was determined to be 4.25% (w/w) of the plant root raw material.

545

2.4. Purification of APPC The APPC sample (100 mg) was dissolved in deionized water, membrane-filtered (0.45 ␮m; Nuclopore). Then the solution was applied to a DEAE-Sepharose Fast-flow column equilibrated previously with deionized water with AKTA Purifier system (3 cm × 60 cm) (Amersham Pharmacia Biotech, Sweden) for further purification. The column was stepwise eluted with gradient NaCl aqueous solutions (0–1.00 mol/mL) at a flow rate of 0.6 mL/min, with collection of 5-mL fractions for each tube. The polysaccharide content in each fraction was monitored by the phenol-sulfuric acid method and UV spectroscopy. Consequently, two fractions of APPC were obtained. The main appropriate fraction, eluted out of ion-exchange column with 0.4 M NaCl solution was collected, concentrated, dialyzed and lyophilized, and designated as PSRC for the following study. 2.5. Characterization of PSRC 2.5.1. Analysis contents of carbohydrate, protein and uronic acid The carbohydrate contents were determined by the phenol–sulfuric acid method using d-glucose as standard [10]. The protein contents were assayed by the method of Bradford (1976) [11], with bovine serum albumin as standard. The uronic acid content was measured by the carbazole–sulfuric acid method using glucuronic acid as a standard [12]. 2.5.2. Infrared spectroscopy analysis of PSRC The infrared (IR) spectra of PSRC was recorded within 4000 to 400 cm−1 using an FTIR spectrophotometer (FTIR-8400S, Shimadzu Co., Japan). The purified polysaccharide was ground with spectroscopic grade potassium bromide (KBr) powder and then pressed into 1-mm pellets for FTIR measurement in the frequency range of 4000–400 cm−1 as described previously [13]. 2.5.3. Analysis of monosaccharide composition of PSRC The monosaccharide composition of PSRC was determined according to the procedures reported previously [4] with minor modifications. Briefly, PSRC (10 mg) was hydrolyzed with 2 M trifluro acetic acid (TFA) at 100 ◦ C for 6 h in a sealed tube. After complete hydrolysis, the digested solution was dried by evaporation. Subsequently, 30 mg of NaBH4 and 2 mL of distilled water were added to the dried solids, followed by acidification with acetic acid after incubation for 30 min. The solution was evaporated to dryness at 60 ◦ C, then 2 mL of 0.1% HCl–MeOH (v/v) was added, and evaporated to dryness again. The dried products were prepared for acetylation. The acetylation was carried with 1:1 pyridine–acetic anhydride in water bath at 90 ◦ C for 1 h. The monosaccharide composition was analyzed by GC-MS (QP2010, Shimadzu, Japan) with a fused silica capillary column (30 m × 0.25 mm × 0.25 ␮m) of RTX 5 ms. Alditol acetates of standard monosaccharides (dglucose, d-xylose, d-fructose, d-galactose, l-rhamnose, d-mannose, and d-arabinose) with inositol as the internal standard were prepared and subjected to GC-MS analysis separately in the same way. The operation was performed using the following conditions: the oven temperature was initially 120 ◦ C (held for 3 min), increased to 210 ◦ C at a rate of 3 ◦ C/min (held for 4 min); the rate of N2 carrier gas was 20 mL/min; inlet temperature was 250 ◦ C; detector temperature: 280 ◦ C. 2.5.4. Molecular weight determination of PSRC The molecular weight of PSRC was determined by gel permeation chromatography (GPC) on a column (60 cm × 1.6 cm) of Sephadex G-100. The column was eluted with ultrapure water at a

546

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

flow rate of 0.6 ml/min and calibrated with the Dextran standards (molecular weights: 23,800, 80,900, 147,600 and 273,000). 2.6. In vitro free radical scavenging potential assay of PSRC 2.6.1. DPPH scavenging assay DPPH scavenging activity was assayed as described previously [14] with minor modifications. Briefly, 0.1 mM DPPH in methanol solution was prepared and then 2 mL of which was mixed with PSRC in deionized water solution of various concentrations (2 mL; 0.05–1.0 mg/mL). The mixture was vigorously shaken and then left at 25 ◦ C for 30 min before the absorbance at 517 nm was measured. Vitamin C, in deionized water solution, was used as a positive control and the radical-scavenging activity was calculated as a percentage of DPPH discoloration by the following equation: DPPH scavenging activity (%) = (1−As /Ac ) × 100%, where As was the absorbance of a mixture of DPPH solution with the sample and Ac was the control reaction in which the sample was replaced by ethanol. 2.6.2. Hydroxyl radical scavenging assay Hydroxyl radical scavenging activity was determined according to the Fenton reaction. PSRC samples in deionized water solution of various concentrations (2 mL; 0.05–1.0 mg/mL) were incubated with 1.5 mL of orthophenanthroline in ethanol (5 mM), 1 mL FeSO4 (7.5 mM), 1 mL H2 O2 (1%, v/v) and 4 mL of sodium phosphate buffer (150 mM, pH 7.4) at 37 ◦ C for 60 min. Hydroxyl radical was determined by monitoring the absorbance at 510 nm. The hydroxyl radical scavenging activity (%) was calculated by the following equation: hydroxyl radical scavenging activity (%) = (1−As /Ac ) × 100%, where As was the absorbance of a mixture of sample and reaction solution and Ac was the absorbance of the control reaction in which the sample was replaced by deionized water. Vitamin C in deionized water solution was used as a positive control. 2.6.3. Superoxide radical scavenging assay The superoxide radical scavenging assay was measured according to the method reported previously [15] with a minor modification. Briefly, samples were dissolved in deionized water at 0.05, 0.1, 0.2, 0.4, 0.6, 0.8 or 1.0 mg/mL. 4.5 mL of 0.05 M Tris–HCl (pH 8.2) was incubated at 25 ◦ C for 20 min. Subsequently, a 1-mL of aliquot of each sample solution and 0.4 mL of 25 mM 1,2,3-phentriol were added to the reaction mixture and incubated at the same temperature for 5 min. Finally, the reaction system was stopped with the addition of 1 mL of HCl (8 mM). Vitamin C in deionized water solution was used as positive control, and the absorbance was measured at 299 nm. The capability to scavenge superoxide anion radical was calculated according to the formula: superoxide anion radical scavenging activity (%) = (1−As /Ac ) × 100%, where As was the absorbance of a mixture of sample and reaction solution and Ac was the absorbance of the control reaction in which the sample was replaced by deionized water. 2.7. In vivo antioxidant defense potential assay of PSRC 2.7.1. Animals and experimental design Male Kunming mice (Grade II, 8 weeks old) weighting 28–32 g were purchased from Sichuan Laboratory Animal Center (SLAC) Co. Ltd. (Sichuan, China). The mice were housed in a standard polypropylene cage, given ad libitum access to a commercial diet and tap water in a controlled environment with temperature of 21 ± 1 ◦ C, a relative humidity of 50–60% and a 12 h light/12 h dark cycle. A total of 60 mice were randomly divided into six groups, including normal, model, positive control, and three PSRC

administration groups and each group contained 10 mice. The normal control group (Normal) received normal saline (0.2 mL; 0.9%, w/v) by subcutaneous administration (s.c.), and water (0.25 mL) by intragastric administration (i.g.) daily. The aging model group (Model) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and water (0.25 mL) i.p. daily [16]. The positive control group (Vc) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and vitamin C (0.25 mL; 100 mg/kg body weight) i.g. daily. The three PSRC administration groups (PSRC) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and PSRC (0.25 mL; 50, 100, and 200 mg/kg body weight, respectively) i.g. daily. All mice were successively administrated with the above concoctions for 42 days. All procedures related to animal handling were approved by the Animal Care and Use Committee of Sichuan Agricultural University. 2.7.2. Samples collection and preparation Twenty-four hours after the last drug administrations, all mice were weighted, and then anaesthetized with ether, and blood samples were collected from each treatment group. Serum samples were obtained by centrifugation (2000 × g, 15 min, 4 ◦ C) and stored at −20 ◦ C pending analysis. After sacrifice, the brains, hearts, livers, and spleens were rapidly excised and thoroughly wash to clear off blood. The weights of these organs were recorded, and their weights relative to the final body weights (organ indices) were calculated. The brains, hearts, and livers were all dissected into two portions, one portion was frozen in liquid nitrogen and subsequently stored at −80 ◦ C for gene expression analysis. And the other one was homogenized in ice-cold PBS (0.02 mol/L, pH 7.2) (10%) using a Teflon glass homogenizer. The supernatants were collected by centrifugation (3000 × g, 15 min, 4 ◦ C). 2.7.3. Antioxidant parameters assay in the liver, heart, and brain Total superoxide dismutase (T-SOD), copper-zinc superoxide dismutase (Cu,Zn-SOD), manganese superoxide dismutase (Mn-SOD), glutathione peroxidase (GPx), and catalase (CAT) activities and malondialdehyde (MDA) concentrations in tissue supernatants, as well as superoxide anion and hydroxyl radical scavenging capacities and malondialdehyde (MDA) concentrations in serum and tissue supernatants were measured using the respective kits as previously reported by Lin et al. [17] and Ji et al. [18]. All assays were performed in triplicates, enzyme activities and MDA concentration were normalized by basing them on protein content, and expressed as units/mg protein and nmol/mg protein, respectively. Protein content was determined by the Bradford assay [11]. The superoxide anion and hydroxyl radical scavenging capacities were expressed as percentage inhibition by comparing the test and the Normal control group. 2.7.4. Quantitative real-time PCR of the liver, heart, and brain Total RNA was isolated from the liver, heart, and brain using the TRIzol reagent (Invitrogen Co., Carlsbad, CA, USA), according to the manufacturer’s instructions. Quantitative and qualitative analyses of isolated RNA were assessed from the ratio of absorbance at 260 and 280 nm and agarose gel electrophoresis. First-strand cDNA was reverse-transcribed using PrimeScript® RT reagent kit with gDNA Eraser (TaKaRa Bio, Co. LTD, Dalian, China). Quantitative real-time PCR was analyzed in triplicate on CFX96 Real Time PCR detection system (Bio Rad, Hercules, CA, USA) with SYBR® green. The PCR contained 40 ng cDNA, 500 nmol/L each of forward and reverse primers, and 2× SYBR® premix TaqTM (TaKaRa Bio Co. LTD). The primer sequences of target and reference genes are listed (Table 1). The PCR cycling conditions were: initial denaturation at 95 ◦ C (1 min), following by 40 cycles of denaturation at 95 ◦ C (5 s), annealing at 58–61 ◦ C (25 s; Supplementary Table S1) and a final melting curve analysis to monitor purity of the PCR product. The cycle threshold value was analyzed (CFX96 detection system) and

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

547

Table 1 Sequences of primers used for real-time quantitative PCR. Gene

GenBank No.

Primer sequence (5 –3 )

Amplification length (bp)

Annealing temperature (◦ C)

Cu,Zn-SOD

NM011434

172

59.5

Mn-SOD

NM013671

281

58.0

GPx1

NM 008160

199

61.0

CAT

NM 009804

181

60.0

Trx1

BC094415

190

60.5

Trx2

NM 013711

129

61.0

␤-Actin

NM 007393

F:TGAAGAGAGGCATGTTGGAGAC R: TCCTTCATTTCCACCTTTGCC F: CCGAGGAGAAGTACCACGAG R: GAAGGTAGTAAGCGTGCTCC F: GGTTCGAGCCCAATTTTACA R: CCCACCAGGAACTTCTCAAA F: AGCGACCAGATGAAGCAGTG R: TCCGCTCTCTGTCAAAGTGTG F:TGCTACGTGGTGTGGACCTTGC R: ACCGGAGAACTCCCCCACCT F: GGATCAAGTGTGGGGCTTCA R: AGCAACCAGTCACAGTAGGC F:GAAATCGTGCGTGACATCAAAG R: TGTAGTTTCATGGATGCCACAG

216

60.0

Cu,Zn-SOD, copper- and zinc-containing superoxide dismutase; Mn-SOD, manganese-containing superoxide dismutase; GPx1, glutathione peroxidase 1; CAT, catalase; Trx1, thioredoxin-1; Trx2, thioredoxin-2; ␤-actin, beta-actin.

100

3600

3200

2800

2400

2000

1600

1200

800

615.2 538.1

896.8 848.6

1151.4 1622.0

20

1078.1 1026.0

40

1421.4

2933.5

60

0 4000

1743.5

80

3409.9

Transmittance %

transformed to a relative quantity using a standard curve method. Relative gene expression levels were normalized to those of the eukaryotic house-keeping gene, ˇ-actin. Outcomes were expressed as fold changes relative to average mRNA levels of genes in Normal group. Supplementary Table S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijbiomac. 2014.09.007.

400

Wavenumbers (cm-1 ) 2.8. Statistical analysis All data were analyzed by one-way ANOVA using the general linear models (GLM) procedure of the Statistical Analysis System, Version 9.2 (SAS institute, Cary, NC, USA). When applicable, multiple comparisons were performed by Duncan’s method. Results were reported as means together with their standard deviations (SD). P < 0.05 was considered statistically significant. The halfmaximal inhibitory concentration value (IC50 ) was calculated by linear regression.

3. Results 3.1. Isolation, purification, and chemical properties of polysaccharide The crude polysaccharide (APPC) extracted from C. officinalis Kuan was obtained and presented negative iodine-potassium iodide reaction, indicating the absence of starch-type polysaccharide. APPC was purified by DEAE-Sepharose Fast-flow column chromatography. Three fractions were isolated (data were not shown), and the main fraction, which eluted with 0.4 M NaCl solution, was collected and designed as PSRC. PSRC appeared as white-colored power. The chemical characteristics and monosaccharide composition of PSRC were shown in Table 2. Briefly, the average molecular weight of PSRC was 182 kDa, according to the calibration curve with standard dextrans. The total sugar content of PSRC was determined to be 98.2%, using the phenol–sulfuric acid method. The uronic acid content was determined to be 6.8%, and there existed no protein in the polysaccharide. According to the analysis of monosaccharide using GC-MS, PSRC was a heteropolysaccharide and mainly consisted of glucose (relative mass 48.8%) with lower levels of rhamnose, mannose, galactose, fructose, and arabinose, with a relative mass of 15.7, 14.3, 10.6, 6.1, and 4.5%, respectively.

Fig. 1. FTIR spectra of the polysaccharide of PSRC.

3.2. FRIR spectroscopy The FT-IR spectrum of the PSRC revealed obvious characteristic absorption peaks of polysaccharide (Fig. 1). The broadly stretched intense peak at around 3409 cm−1 was the characteristic absorption of hydroxyl groups, and a weak band at around 2933 cm−1 was attributed to the C H stretching vibrations. The absorption peak at around 1622 cm−1 was due to the C O asymmetric stretching vibration. The polysaccharide had a specific absorption band at 1000–1200 cm−1 , and this region is dominated by ring vibrations overlapped with stretching vibrations of (C OH) side groups and the (C O C) glycosidic band vibrations. The absorption peaks at 1026, 1078, and 1051 cm−1 indicated a pyranose form of sugars [19]. The characteristic absorptions at around 848 and 896 cm−1 indicated that PSRC contained both ␣- and ␤-type glycosidic bond in their structure [20]. 3.3. In vitro free radical scavenging activities of PSRC The in vitro antioxidant ability of purified polysaccharide (PSRC) was evaluated by testing the scavenging activities against DPPH, hydroxyl, and superoxide anion free radicals. As show in Fig. 2A–C, the scavenging activities of PSRC against the three different free radicals increased significantly with increased dose from 0.05 to 1.0 mg/mL, in an obvious dose-dependent manner. At high dose of 1.0 mg/mL, the scavenging activities of PSRC against DPPH, hydroxyl, and superoxide anion radicals reached 73.6, 78.6, and 76.2%, respectively, which were relatively lower than the activities of vitamin C of the same dose (90.5, 91.8, and 95.2%, respectively). The IC50 values of PSRC on scavenging DPPH, hydroxyl, and superoxide anion radicals were 0.30, 0.32, and 0.28 mg/mL, respectively, and the corresponding IC50 values of vitamin C were 0.05, 0.24, and 0.19 mg/mL, respectively.

548

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

Table 2 Chemical characteristics and monosaccharide composition of PSRC.a Sample

Sugar content (%)

98.2 ± 1.42

PSRC a b c

Protein (%)

Uronic acid content (%)

6.8 ± 0.53

ndc

Mw (Da)

182,000

Monosaccharide composition (relative mass %) Glub

Manb

Rhab

Galb

Frub

Arab

48.8

15.7

14.3

10.6

6.1

4.5

Data were shown as mean ± stand deviation (n = 3). Glu, glucose; Man, mannose; Rha, rhamnose; Gal, galactose; Fru, fructose; Ara, arabinose. nd, not detected.

Scavenging activity (%)

100 80 60

Vc 40

100

Scavenging activity (%)

PSRC

20 0

0.0

0.2

0.4

0.6

0.8

1.0

(B)

80 60 Vc 40

PSRC

20 0

100

Scavenging activity (%)

(A)

0.0

0.2

0.4

0.6

0.8

1.0

(C)

80 60 Vc 40

PSRC

20 0

0.0

0.2

0.4

0.6

0.8

1.0

Fig. 2. Antioxidant activities of PSRC in vitro with various methods: (A) scavenging activity to DPPH radicals; (B) scavenging activity to hydroxyl radicals; (C) scavenging activity to superoxide anion radicals. The values shown are the means ± SD of triplicate measurements.

3.4. Antioxidant defense potential of PSRC in d-galactose-induced aging mice 3.4.1. Effects of PSRC on body weights and organ indices The organ indices were expressed as the liver, heart, brain, and spleen weights in relative to body weights (in mg/kg) and shown

in Table 3. Chronic administration of d-galactose significantly decreased body weights and spleen indices of mice compared with those of the normal control group (P < 0.05). While administration of either PSRC or vitamin C both significantly increased the body weights and spleen indices back to levels of the normal control group (P < 0.05). And there was no significant difference in body weights and spleen indices between mice administrated of PSRC at dose of 200 mg/kg and of vitamin C at dose of 100 mg/kg (P > 0.05). Experimental treatments did not affect the liver, heart, and brain indices of mice (P > 0.05). 3.4.2. Effects of PSRC on antioxidant enzyme activities The effects of PSRC on the activities of endogenous antioxidant enzymes in liver, heart, and brain were investigated in d-galactoseinduced-aging mouse model and presented in Table 3. In the model group, T-SOD, Cu,Zn-SOD, Mn-SOD, GPx, and CAT enzyme activities in the three tested tissues were markedly decreased compared with those of the normal group (P < 0.05). However, after the administration of PSRC in mice, all these antioxidant enzyme activities in the liver, heart, and brain were significantly increased, in an obvious dose-dependent manner (P < 0.05). In particular, activities of all the tested enzymes in heart and brain at 200 mg/kg day of PSRC except for the GPx in the heart were completely restored back to those of the normal control group (P < 0.05). However, administration of PSRC at 200 mg/kg day could not completely restore these enzyme activities in the liver back to levels of the normal group. All these tested enzyme activities in the liver, heart, and brain at 200 mg/kg day of PSRC were very close to those of vitamin C at 100 mg/kg day (P > 0.05), except for GPx and CAT in the liver. 3.4.3. Superoxide anion and hydroxyl radical scavenging capacities The superoxide anion and hydroxyl radical scavenging capacities in serum, liver, heart, and brain of the d-galactose-induced aging mice were present in Fig. 3A and B. In the model group, superoxide anion and hydroxyl radical scavenging capacities in the four tested tissues were significantly decreased compared with the normal control group (P < 0.05). As expected, after the administration of PSRC in mice, both the superoxide anion and hydroxyl radical scavenging capacities in the four tested tissues were substantially increased in a dose-dependent manner (P < 0.05). Especially, the superoxide anion and hydroxyl radical scavenging capacities in the four tested tissues in PSRC at dose of 200 mg/kg day were completely restored back to the levels of the normal group. The superoxide anion and hydroxyl radical scavenging capacities of PSRC at dose of 200 mg/kg day were comparable to that of vitamin C at dose of 100 mg/kg day in all the tested tissues (P > 0.05). 3.4.4. Level of lipid peroxidation The beneficial effects of PSRC on alleviation of the lipid peroxidation in the serum, liver, heart, and brain of the d-galactose-induced aging mice were determined and presented in Table 3. The results indicated that MDA concentrations in the four tested tissues in the model group were significantly increased compared with that of the normal group (P < 0.05). However, administration of PSRC dose dependently abrogated d-galactose-induced increases in lipid

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

549

Table 3 Body weights, organ indices, antioxidant enzyme activities, and MDA concentrations in liver, heart, and brain, and MDA concentrations in serum. Parameters

Body weight (g) LI (mg/kg) HI (mg/kg) BI (mg/kg) SI (mg/kg) Liver T-SOD1 Cu,Zn-SOD1 Mn-SOD1 GPx1 CAT1 MDA2 Heart T-SOD1 Cu,Zn-SOD1 Mn-SOD1 GPx1 CAT1 MDA2 Brain T-SOD1 Cu,Zn-SOD1 Mn-SOD1 GPx1 CAT1 MDA2 Serum MDA2

Normal

Model

VC

PSRC 50

100

200

34.93 ± 1.75b 41.46 ± 1.20 5.62 ± 0.56 10.51 ± 0.32 0.46 ± 0.10b

31.86 ± 2.12a 42.12 ± 1.98 5.30 ± 0.95 10.47 ± 0.85 0.37 ± 0.06a

34.67 ± 1.67b 41.81 ± 1.52 6.03 ± 0.53 11.03 ± 0.89 0.51 ± 0.15b

32.26 ± 1.90a 42.41 ± 1.74 5.30 ± 0.95 9.54 ± 0.23 0.39 ± 0.08a

33.96 ± 1.74ab 42.21 ± 1.86 5.43 ± 0.58 10.43 ± 0.28 0.44 ± 0.12ab

34.30 ± 1.76b 41.66 ± 1.83 5.60 ± 0.57 10.17 ± 0.22 0.45 ± 0.14b

35.36 ± 4.03d 24.40 ± 2.53d 10.96 ± 1.13e 65.94 ± 8.59d 112.38 ± 18.9c 4.96 ± 0.69e

20.91 ± 2.57a 14.85 ± 1.82a 6.06 ± 0.74a 40.25 ± 4.98a 79.86 ± 7.30a 10.19 ± 0.94a

28.99 ± 3.86bc 19.42 ± 2.59bc 9.57 ± 1.27d 63.12 ± 7.19d 110.06 ± 9.54c 4.27 ± 0.67f

21.67 ± 2.45a 14.51 ± 1.64a 7.15 ± 0.81b 43.70 ± 3.92a 79.12 ± 7.06a 8.33 ± 0.74b

26.62 ± 2.97b 18.37 ± 2.05b 8.25 ± 0.92c 51.34 ± 5.63b 83.58 ± 6.27a 6.36 ± 0.55c

30.45 ± 4.03c 20.71 ± 2.74c 9.74 ± 1.29d 57.56 ± 5.63c 97.37 ± 9.67b 5.23 ± 0.55d

5.49 ± 0.76c 3.79 ± 0.53c 1.70 ± 0.24cd 39.62 ± 4.71c 5.78 ± 0.69b 3.46 ± 0.43c

4.62 ± 0.54a 3.28 ± 0.39a 1.34 ± 0.16a 28.80 ± 3.30a 5.06 ± 0.53a 5.92 ± 0.73a

5.38 ± 0.56bc 3.60 ± 0.37bc 1.78 ± 0.18c 33.19 ± 3.68b 5.68 ± 1.50b 3.24 ± 0.43c

4.70 ± 0.48a 3.15 ± 0.32a 1.56 ± 0.16bc 29.53 ± 3.20ab 5.18 ± 0.59a 5.84 ± 0.70a

4.82 ± 0.60ab 3.32 ± 0.41ab 1.50 ± 0.19ab 31.93 ± 3.82ab 5.62 ± 0.60b 4.82 ± 0.59b

5.32 ± 0.62bc 3.62 ± 0.42bc 1.70 ± 0.20cd 32.25 ± 3.71ab 5.71 ± 0.60b 3.68 ± 0.48c

3.21 ± 0.40c 2.25 ± 0.27c 0.96 ± 0.12c 54.50 ± 8.48b 5.78 ± 0.69b 1.10 ± 0.46b

2.00 ± 0.25a 1.36 ± 0.17a 0.64 ± 0.08a 40.62 ± 4.53a 4.62 ± 0.48a 2.36 ± 0.74a

2.91 ± 0.32c 2.01 ± 0.22bc 0.90 ± 0.10bc 53.04 ± 6.60b 5.68 ± 1.50b 1.28 ± 0.38b

2.28 ± 0.24ab 1.56 ± 0.16a 0.73 ± 0.08ab 40.62 ± 4.71a 4.71 ± 0.53a 2.36 ± 0.51a

2.39 ± 0.28b 1.67 ± 0.20ab 0.72 ± 0.08ab 43.92 ± 4.69ab 5.62 ± 0.60b 1.97 ± 0.49a

2.92 ± 0.31c 2.01 ± 0.22bc 0.91 ± 0.10bc 53.04 ± 5.57b 5.71 ± 0.60b 1.16 ± 0.48b

6.80 ± 0.82c

11.26 ± 1.64a

7.12 ± 1.08c

10.86 ± 1.21a

8.84 ± 1.32b

7.50 ± 0.97c

LI, HI, BI, and SI represent the liver, heart, brain, and spleen indices, respectively. The normal control group (Normal) received normal saline (0.2 mL; 0.9%, w/v) by subcutaneous administration (s.c.), and water (0.25 mL) by intragastric administration (i.g.) daily. The aging model group (Model) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and water (0.25 mL) i.p. daily. The positive control group (Vc) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and vitamin C (0.25 mL; 100 mg/kg body weight) i.g. daily. The three PSRC administration groups (PSRC) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and PSRC (0.25 mL; 50, 100, and 200 mg/kg body weight, respectively) i.g. daily. All mice were successively administrated with the above concoctions for 42 days. The values shown are the means ± SD of 10 mice. T-SOD, total superoxide dismutase; Cu,Zn-SOD, copper- and zinc-containing superoxide dismutase; Mn-SOD, manganese-containing superoxide dismutase; GPx, glutathione peroxidase; CAT, catalase; MDA, malondialdehyde. a,b,c Within a row, means without a common superscript differed (P < 0.05). 1 U/mg protein. 2 nmol/mg protein.

peroxidation in the four tested tissues with increased concentrations from 50 to 200 mg/kg day. In particular, PSRC at high dose of 200 mg/kg day completely reduced levels of MDA in the four tested tissues back to that of the normal group (P < 0.05). The MDA levels in serum, heart, and brain in PSRC at 200 mg/kg day were very close to that in vitamin C at 100 mg/kg day (P > 0.05).

3.4.5. mRNA expression levels of antioxidant-related genes To further investigate the mechanisms underlying the antioxidant effects of PSRC in d-galactose-induced aging mice, we performed quantitative PCR analysis on key antioxidant defense gene expressions in liver, heart, and brain (Fig. 4). In the model group, mRNA expression levels of all the tested genes in liver, heart, and brain were significantly down-regulated (P < 0.05). After the administration of PSRC, however, the mRNA expression levels of all these expression-decreased genes in the model group were dose-dependently upregulated, with increased dose from 50 to 200 mg/kg day. At high dose of 200 mg/kg day, administration of PSRC significantly upregulated the mRNA expressions levels of all tested genes in the three tested tissues compared with those in the model group (P < 0.05). In particular, the mRNA expression levels of Cu,Zn-SOD, GPx1, and Trx1 in the heart, and Trx2 in the brain of PSRC were even higher than those in the normal group (P < 0.05). The mRNA expression levels of all tested genes in liver, heart, and brain in PSRC at 200 mg/kg day were almost similar to those in vitamin C at 100 mg/kg day (P > 0.05).

4. Discussion In present study, a soluble polysaccharide (PSRC) from Radix Cyathulae officinalis Kuan was extracted and purified, and its chemical characteristics and monosaccharide composition, as well as in vitro and in vivo antioxidant activities were investigated. The FT-IR spectrum revealed obvious characteristic absorption peaks of polysaccharide, and the presence of both ␣- and ␤-type glycosidic bond in their structure. GC-MS analysis shown that PSRC was consisted of glucose, rhamnose, mannose, galactose, fructose, and arabinose. Both in vitro and in vivo investigations indicated that PSRC possessed a variety of free radical scavenging and antioxidant activities. To the best of our knowledge, this was the first investigation on the chemical characteristics, monosaccharide composition, and antioxidant activities of polysaccharides from Radix Cyathulae officinalis Kuan. In vitro testing indicated that PSRC possessed potent antioxidant activities against DPPH, hydroxyl, and superoxide anion radicals, and its scavenging effects reached 73.6, 78.6, and 76.2% at a dose of 1 mg/mL, respectively. Similar results have been revealed in other plant polysaccharides [4,21]. It was proposed that the possible antioxidant mechanism of polysaccharides may involve hydrogen donation to break chain reactions, and free radical scavenging ability resulting from the abstraction of anomeric hydrogen from the internal monosaccharide units of polysaccharides [22]. Therefore, PSRC was possibly good hydrogen donors that could effectively combine with radicals and terminate the radical chain reaction.

550

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

Fig. 3. Effects of administration of PSRC on superoxide anion (A) and hydroxyl radical (B) scavenging capacities in serum, liver, heart, and brain of mice aged by d-galactose. The normal control group (Normal) received normal saline (0.2 mL; 0.9%, w/v) by subcutaneous administration (s.c.), and water (0.25 mL) by intragastric administration (i.g.) daily. The aging model group (Model) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and water (0.25 mL) i.p. daily. The positive control group (Vc) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and vitamin C (0.25 mL; 100 mg/kg body weight) i.g. daily. The three PSRC administration groups (PSRC) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and PSRC (0.25 mL; 50, 100, and 200 mg/kg body weight, respectively) i.g. daily. All mice were successively administrated with the above concoctions for 42 days. The data represent the percentage radical scavenging capacity remaining compared with the normal control group and were reported as the means ± SD of 10 mice. a, b, c Means without a common superscript differed (P < 0.05).

To further explore it’s in vivo antioxidant activities and the underlying antioxidant mechanisms, a typical mouse model suffering oxidative stress induced by d-galactose was used [16,23]. In the present study, administration of PSRC significantly abrogated d-galactose-induced decreases in superoxide anion and hydroxyl radical scavenging capacities in serum and organs (liver, heart, and brain), and thus decreased end products of lipid peroxidation (MDA) levels in these tested tissues. Especially, at high dose of PSRC (200 mg/kg day), these antioxidant parameters were all completely restored to the normal levels. Superoxide anion and hydroxyl radicals are clearly involved in the damage of living cell components [1,2]. The effects of PSRC on scavenging superoxide anion and hydroxyl radicals and suppressing lipid peroxidation at dose of 200 mg/kg day were comparable to that of vitamin C at dose of 100 mg/kg day. These results demonstrated that this purified polysaccharide was a strong in vivo antioxidant agent, which could effectively prevent organisms from oxidative damage caused by reactive free radicals, as in agreement with previous reports on other plant polysaccharides [16,24]. The detrimental effects of oxidative stress in vivo are generally counteracted by a wide spectrum of antioxidant defense mechanisms. In these mechanisms, the endogenous antioxidant enzymes including T-SOD, Cu, Zn-SOD, Mn-SOD, GPx, and CAT limit the levels of reactive oxidants and damages they inflict on organisms [2,25]. Among them, SOD is the only enzyme that disrupts superoxide radicals, and it can convert superoxide to hydrogen peroxide and maintain low superoxide concentrations [26]. Subsequently,

GPx and CAT are able to react with hydrogen peroxide and convert it to O2 , thus preventing intracellular damages [25]. In parallel with the changes of superoxide anion and hydroxyl radical scavenging capacities, administration of PSRC significantly abrogated d-galactose-induced decreases in the activities of these endogenous enzymes in organs (liver, heart, and brain) of the model mice. Especially, administration of PSRC at dose of 200 mg/kg day could completely restore these enzyme activities in the hearts and brains back to levels of the normal group. The antioxidant effects of PSRC on enhancing antioxidant enzyme activities at dose of 200 mg/kg day were comparable to that of vitamin C at a dose of 100 mg/kg day. In liver, however, administration of PSRC at a dose of 200 mg/kg day could significantly increase but not completely restore these enzyme activities, suggesting that d-galactose appeared to be apt to induce much more free radical production in the liver compared with other tissues. Taken together, these results clearly indicated that the administration of PSRC to mice (especially at relative high dose) resulted in an effectively preventive effect against d-galactose-induced oxidative stress, through enhancing the activities of endogenous antioxidant enzymes. Similar findings about herbal polysaccharides were also reported elsewhere [24,26]. In accordance with the changes of antioxidant enzyme activities and free radical scavenging capacities, the mRNA expressions of antioxidant defense genes including antioxidant enzymatic genes (Cu,Zn-SOD, Mn-SOD, GPx1, and CAT) and antioxidant non-enzymatic genes (thioredoxin-1 and thioredoxin-2) were significantly up-regulated in liver, heart, and brain of the model mice by the administration of PSRC. It was reported that oxidative stress caused damage to DNA molecules and lead to lower mRNA expression levels of antioxidant defense genes [27]. In the present study, we also found that the mRNA expression levels of some genes, e.g. the mRNA expression levels of Cu,Zn-SOD and GPx1 in the liver of PSRC at dose of 200 mg/kg day were significantly higher than those in the normal group, but their enzymatic activities were significantly lower than those in the normal group, suggesting that oxidative stress also caused damage to mRNA molecules and reduced their expressions at translation levels. Taken together, administration of PSRC effectively scavenged ROS and thus reduced their damage to DNA and mRNA molecules of antioxidant defense genes, thereby up-regulating their expressions. Apart from these, whether PSRC could up-regulate the expressions of antioxidant defense genes through other mechanisms needs further investigation. Anyway, the upregulated expressions of antioxidant defense genes resulted in enhanced antioxidant enzyme activities and free radical scavenging capacities of the organisms. Bioactivity of polysaccharides mainly depends on several structural parameters including sugar composition, molecular weight, type of glycosidic bond of the main chain, and type and degree of the branched-chain modification [28]. Accordingly, the specific monosaccharide composition of PSRC possibly exerted an important effect on its potent antioxidant activities, as evidenced by the parallel potent antioxidant capacities in vitro and in vivo. Moreover, it was reported that polysaccharides with relatively lower molecular weight and/or rich in uronic acids exhibited high antioxidant capacities [29,30]. Therefore, the potent antioxidant activity of PSRC was (at least) possibly associated with its relatively lower molecular weight and relatively high uronic acid content. In conclusion, antioxidant activities of the purified polysaccharide (PSRC) isolated from Radix Cyathulae officinalis Kuan were demonstrated by using both in vitro and in vivo methods. The in vitro results indicated that PSRC had potent DPPH, hydroxyl, and superoxide anion radical scavenging activities. The in vivo results indicated that administration of PSRC significantly improved the antioxidant status of the d-galactose-induced oxidatively stressed

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

551

Fig. 4. Effects of administration of PSRC on the mRNA levels of antioxidant-related genes in heart (A), liver (B), and brain (C) of mice. The normal control group (Normal) received normal saline (0.2 mL; 0.9%, w/v) by subcutaneous administration (s.c.), and water (0.25 mL) by intragastric administration (i.g.) daily. The aging model group (Model) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and water (0.25 mL) i.p. daily. The positive control group (Vc) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and vitamin C (0.25 mL; 100 mg/kg body weight) i.g. daily. The three PSRC administration groups (PSRC) received d-galactose (0.2 mL; 120 mg/kg body weight) s.c., and PSRC (0.25 mL; 50, 100, and 200 mg/kg body weight, respectively) i.g. daily. All mice were successively administrated with the above concoctions for 42 days. The data were reported as the means ± SD of 10 mice. a,b,c,d Means without a common superscript differed (P < 0.05). Cu,Zn-SOD, copper- and zinc-containing superoxide dismutase; Mn-SOD, manganese-containing superoxide dismutase; GPx1, glutathione peroxidase 1; CAT, catalase; Trx1, thioredoxin-1; Trx2, thioredoxin-2.

mice through obvious improvement in MDA levels, free-radical scavenging activities, endogenous antioxidant enzyme activities and antioxidant defense gene expressions. Our results extensively provide a scientific basis for the potential application of PSRC as a novel promising source of natural antioxidants and antiaging drugs. Acknowledgements This work was supported in part by Sichuan Agricultural University Excellent Doctoral Dissertation program (YB2014004), Two Sides Supporting plan in Sichuan Agricultural University (00770107), and Sichuan Science and Technology Commission (Project No. 2012HH0013).

References [1] H. Chen, H. Yoshioka, G.S. Kim, J.E. Jung, N. Okami, H. Sakata, C.M. Maier, P. Narasimhan, C.E. Goeders, P.H. Chan, Antioxid. Redox. Signal. 14 (2011) 1505–1517. [2] L.A. Pham-Huy, H.C. He, Int. J. Biomed. Sci. 4 (2008) 89–96. [3] S. Vinita, G. Vartika, S. Kameshwar, B. Sonal, K. Reeta, D. Neeti, J. Pharm. Res. 7 (2013) 828–835. [4] X. Yang, R. Wang, S. Zhang, W. Zhu, J. Tang, J. Liu, P. Chen, D. Zhang, W. Ye, Y. Zheng, Carbohydr. Polym. 101 (2014) 386–391. [5] H. Li, F. Ma, M. Hu, C.W. Ma, L. Xiao, J. Zhang, Y. Xiang, Z. Huang, Rejuvenation Res. 17 (2014) 201–204. [6] China Pharmacopoeia Committee, Pharmacopoeia of People’s Republic of China, 2005 ed, Chemical Industry Press, Beijing, 2005. [7] H.Y. Park, H. Lim, H.P. Kim, Y.S. Kwon, Planta Med. 77 (2011) 1528–1530. [8] J. Liu, J. Xu, X.J. Zhao, W.Y. Gao, S.Z. Zhang, Y.Q. Guo, Chin. Chem. Lett. 21 (2010) 70–72. [9] L. Navarini, R. Gilli, V. Gombac, Carbohydr. Polym. 40 (1999) 71–81.

552

X. Han et al. / International Journal of Biological Macromolecules 72 (2015) 544–552

[10] M. Dubois, K.A. Gilles, J.K. Hamilton, P.A. Rebers, F. Smith, Anal. Chem. 28 (1956) 350–356. [11] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254. [12] Y. Lin, L.J. Huang, G.Y. Tian, Chin. Herbal Med. 30 (1999) 817–819. [13] C.G. Kumar, H.S. Joo, J.W. Choi, Y.M. Koo, C.S. Chang, Enzyme Micro. Tech. 34 (2004) 673–681. [14] S. Shen, D. Chen, X. Li, T. Li, M. Yuan, Y. Zhou, C. Ding, Carbohydr. Polym. 104 (2014) 80–86. [15] S. Marklund, G. Marklund, Eur. J. Biochem. 47 (1974) 469–474. [16] J.H. Xiao, D.M. Xiao, D.X. Chen, Y. Xiao, Z.Q. Liang, J.J. Zhong, Evid. Based Complement. Alternat. Med. 2012 (2012) 273435. [17] Y. Lin, X.F. Han, Z.F. Fang, L.Q. Che, J. Nelson, T.H. Yan, D. Wu, Br. J. Nutr. 106 (2011) 510–518. [18] D.B. Ji, J. Ye, C.L. Li, Y.H. Wang, J. Zhao, S.Q. Cai, Phytother. Res. 23 (2009) 116–122.

[19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30]

G.H. Zhao, J.Q. Kan, Z.H.X. Li, Z.D. Chen, Carbohydr. Polym. 61 (2005) 125–131. S.A. Barker, E.J. Bourne, M. Stacey, D.H. Whiffen, J. Chem. Soc. (1954) 171–176. B. Yang, B. Xiao, T. Sun, Int. J. Biol. Macromol. 62 (2013) 287–290. Y. Yamaguchi, S. Kagota, K. Nakamura, K. Shinozuka, M. Kunitomo, Phytother. Res. 14 (2000) 647–649. S. Li, Y. Zhao, L. Zhang, X. Zhang, L. Huang, D. Li, C. Niu, Z. Yang, Q. Wang, Food Chem. 135 (2012) 1914–1919. L.S. Lv, X.H. Gu, J. Tang, C.T. Ho, Food Chem. 104 (2007) 1678–1681. S.S. Gill, N. Tuteja, Plant Physiol. Biochem. 48 (2010) 909–930. Y.H. Jiang, X.L. Jiang, P. Wang, H.J. Mou, X.K. Hu, S.Q. Liu, Microbiol. Res. 163 (2008) 424–430. G. Slupphaug, B. Kavli, H.E. Krokan, Mutat. Res. 531 (2003) 231–251. S.P. Nie, M.Y. Xie, Food Hydrocolloid. 25 (2011) 144–149. L. Sun, L. Wang, J. Li, H. Liu, Food Chem. 160 (2014) 1–7. X. Yang, S. Yang, Y. Guo, Y. Jiao, Y. Zhao, Food Chem. 138 (2013) 1256–1264.