Characterization and expression analyses of five interferon regulatory factor transcripts (Irf4a, Irf4b, Irf7, Irf8, Irf10) in Atlantic cod (Gadus morhua).

Fish & Shellfish Immunology 44 (2015) 365e381

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Characterization and expression analyses of five interferon regulatory factor transcripts (Irf4a, Irf4b, Irf7, Irf8, Irf10) in Atlantic cod (Gadus morhua) Sabrina M. Inkpen, Tiago S. Hori 1, A. Kurt Gamperl, Gordon W. Nash, Matthew L. Rise* Department of Ocean Sciences, Memorial University of Newfoundland, NL, A1C 5S7, Canada

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 October 2014 Received in revised form 30 January 2015 Accepted 19 February 2015 Available online 28 February 2015

The interferon regulatory factor (IRF) family of genes encodes a group of transcription factors that have important roles not only in regulating the expression of Type I interferons (IFNs) and other genes in the IFN pathway, but also in growth, development and the regulation of oncogenesis. In this study, several IRF family members (Irf4a, Irf4b, Irf7, Irf8, Irf10) in Atlantic cod (Gadus morhua) were characterized at the cDNA and putative amino acid levels, allowing for phylogenetic analysis of these proteins in teleost fish, as well as the development of gene-specific primers used in RT-PCR and quantitative PCR (QPCR) analyses. Two Atlantic cod Irf10 splice variants were identified and their presence confirmed by sequencing of the Irf10 genomic region. RT-PCR showed that Irf7, Irf8 and both Irf10 transcripts were expressed in all 15 cod tissues tested, while Irf4a and Irf4b were absent in some tissues. QPCR analysis of spleen expression expanded upon this, and upon previous work. All IRF transcripts in the study were responsive to stimulation by the viral mimic poly(I:C), and all except Irf4a were responsive to exposure to formalinkilled Aeromonas salmonicida (ASAL). These IRF genes, thus, are likely important in the cod immune response to both viral and bacterial infections. Increased temperature (10 C to 16 C) was also observed to modulate the antibacterial responses of all IRF transcripts, and the antiviral responses of Irf4b and Irf10-v2. This research supports earlier studies which reported that elevated temperature modulates the expression of many immune genes in Atlantic cod. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Interferon regulatory factor Immune response Interferon pathway Gene expression Temperature

1. Introduction Interferons (IFNs), a group of cytokines with important roles in defense against viral pathogens, are divided into two families, Type I and Type II, based on structural properties and functions [1,2]. As part of the cellular response to viral infection, Type I IFNs (IFNa and IFNb) are secreted and bind to specific receptors on target cells, eliciting an antiviral response and leading to the transcription of many downstream genes. Transcription factors in the interferon regulatory factor (IRF) family either positively or negatively regulate the expression of IFN genes, and thus, are vital to the cellular antiviral response. Nine IRF genes (Irf1-Irf9) have been described in most vertebrates, although a tenth (Irf10) is present in several avian

* Corresponding author. Tel.: þ1 709 864 7478. E-mail addresses: [email protected] (S.M. Inkpen), [email protected] (T.S. Hori), [email protected] (A.K. Gamperl), [email protected] (G.W. Nash), [email protected] (M.L. Rise). 1 Present address: The Center for Aquaculture Technologies Canada, Souris, PEI, Canada. http://dx.doi.org/10.1016/j.fsi.2015.02.032 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

and fish species, and another potential family member (Irf11 or Irf1b) has been identified in zebrafish (Danio rerio) and other teleost fish [3,4]. All IRF proteins share a conserved amino (N) terminus DNA-binding domain (DBD) of about 115 amino acids, containing five conserved tryptophan (Trp) residues and forming a helix-loophelix motif [2]. The DBD recognizes the IFN stimulated response element (ISRE) DNA sequence, which has the consensus sequence A/GNGAAANNGAAACT [5] and is found in the promoters of Type I IFNs and many genes induced by Type I IFNs [e.g. IFN stimulated genes (ISGs)]. In addition, the carboxyl (C) terminus of all IRFs except Irf1and Irf2 contains an association module called the IRF associated domain (IAD) [6]. Outside the IAD, the C-terminus is not well conserved, and thus is the region that gives each IRF specific functions. Based on molecular phylogenetic analyses, the IRF gene family can be divided into two “supergroups” named IRF1-SG and IRF4-SG [7]. IRF1-SG contains only Irf1 and Irf2, while IRF4-SG is subdivided into IRF3-G (Irf3, Irf7), IRF4-G (Irf4, Irf8, Irf9, Irf10), and IRF5-G (Irf5, Irf6) subgroups, reflecting expansion and diversification over evolutionary history [7,8].

366

S.M. Inkpen et al. / Fish & Shellfish Immunology 44 (2015) 365e381

The roles of proteins encoded by IRF family genes have been quite well-studied in mammals, and found to include not only regulation of IFN expression, but also various aspects of immune system regulation, growth, development, and the regulation of oncogenesis [see [9e11] for reviews]. While the majority of IRF research to date has focused on mammalian species, investigation into this gene family in multiple teleost species has increased in recent years (e.g. in mandarin fish (Siniperca chuasti) [12], rainbow trout (Oncorhynchus mykiss) [13,14], Atlantic salmon (Salmo salar) [15], rock bream (Oplegnathus fasciatus) [16], and zebrafish [17e21]. Several IRF family genes in Atlantic cod (Gadus morhua) have also been partially characterized and shown to respond to immune stimulation [22e25]. For example, previous functional genomics research by our group has shown that Atlantic cod Irf1, Irf7 and Irf10 respond to stimulation with the viral mimic poly(I:C) with increased transcription [23], and this response was shown to be modulated by elevated temperature [22]. Atlantic cod Irf1, Irf4 and Irf7 have been reported by others to respond to nervous necrosis virus infection in the brain [24]. Atlantic cod Irf7 is a maternal transcript with expression that varies over 20-fold in egg batches from different females [26], and the induction of Irf1 and Irf7 in early segmentation stage cod embryos suggests that these genes may have stage-specific functions during early development [27]. To date, only Irf1 has been fully characterized at the mRNA level in Atlantic cod [25], and thus, research on other Irf genes would help to elucidate the mechanisms of anti-viral and anti-bacterial responses in this species. Therefore in the current study, Irf4, Irf7 and Irf10, along with Irf8 (as it is closely related to Irf4 and frequently studied alongside that gene [14,16,28]) were characterized at the cDNA and hypothetical amino acid levels. Genomics resources for Atlantic cod including cDNA libraries, expressed sequence tag (EST) databases, and genome sequence [29e31] have previously been developed, supporting gene characterization as in the current study. In addition, several studies indicate that the Atlantic cod immune system is unique among teleosts and among vertebrates in general, and that this species has higher serum levels of immunoglobulin M than other teleosts, as well as a relatively low antibody response to pathogens [31,32]. These unusual characteristics make further study of the genes and molecular pathways involved in cod immune responses, and the evolution of immune-related gene families in cod, of great interest to researchers in areas such as comparative immunology and evolutionary biology. The study of genes and pathways involved in fish immune (innate and adaptive) and stress responses is required to enhance our understanding of how disease resistance differs between fish populations, and how stress and immune function are influenced by changes in the environment. For example, it has been shown that the thermal niche of Atlantic cod spans temperatures from 1.5 to 19 C and that diurnal fluctuations in temperature can be as much as 10 C [33], and recent research shows that Atlantic cod stress and immune responses are affected by increasing temperature [22,34,35]. As increased temperature was observed to shift the timing of Irf1, Irf7 and Irf10 transcript expression responses to poly(I:C) stimulation [22], we predicted that similar expression profiles would be observed for the transcripts of interest (i.e. Irf 4a, Irf4b, Irf8, Irf10-v2). Thus, we also report on how transcription of these genes after bacterial (formalin-killed Aeromonas salmonicida) or viral mimic [poly(I:C)] stimulation was affected by elevated temperature. 2. Materials and methods 2.1. cDNA characterization of selected cod IRF genes EST evidence (based on tBLASTn and BLASTn searches of NCBI's dbEST using zebrafish IRF protein and cDNA sequences) for Irf4, Irf7,

Irf8 and Irf10 was used to design gene-specific rapid amplification of cDNA ends (RACE) primers (Table 1). Since cod Irf4, Irf7 and Irf10 had previously been partially characterized and subjected to transcript expression analyses [22e24], and Irf8 is part of the same subfamily as Irf4/10 (IRF4-G) and is known to have important roles in other species [14,16,18], these four IRF family members were of particular interest. To obtain cDNA to be used in RACE, column-purified RNA was pooled using 5 mg from each of 10 spleen samples from fish injected with poly(I:C) [sampled at 24 h post-injection (HPI), 5 at 10 C and 5 at 16 C]. The experimental design, sampling procedures, and method of RNA preparation [22] are described in Section 2.3. The pooled RNA was used to prepare RACE-ready cDNA using the GeneRacer Kit (Invitrogen, Burlington ON, Canada), according to the manufacturer's instructions. PCR amplification of cDNA ends was carried out in 50 mL reactions containing 1 mL (1 U/ mL) of Dynazyme polymerase (Thermo Scientific, Ottawa, ON, Canada), Dynazyme EXT buffer (1X final concentration), and either reverse gene specific primer (GSP) and GeneRacer 50 primer or forward GSP and GeneRacer 30 primer for 50 RACE or 30 RACE, respectively. Touchdown PCR was carried out using an initial denaturation at 94 C for 2 min, followed by 40 cycles of [30 s at 94 C; 30 s at 70 C/60 C, decreasing 0.3 C per cycle; 2 min at 72 C] and a final extension of 8 min at 72 C. The approximate size of PCR products was verified by electrophoresis on 1% agarose/Tris acetate-EDTA (TAE) buffer gels stained with ethidium bromide, and DNA bands were excised under UV transillumination using a sterile scalpel blade and purified using the QIAquick Gel Extraction Kit (QIAGEN, Mississauga, ON, Canada) according to the manufacturer's instructions. RACE products were ligated into pGEM-T Easy vector (Promega, Madison, WI, USA) in 10 mL reactions containing 5 mL of ligation buffer, 50 ng of insert DNA, 1 mL of vector and 1 mL of ligase (3 U/ mL), with incubation at 4 C overnight. Two mL of the ligation reaction was added to 50 mL of Subcloning Efficiency DH5a chemically competent cells (Invitrogen), and transformations were carried out according to the manufacturer's instructions. Colonies containing inserts were obtained by blue/white selection on LB agar/carbenicillin (50 mg/mL) plates containing 40 mL of 40 mg/mL X-gal (Sigma, Oakville, ON, Canada), and then grown overnight at 37 C in liquid LB media containing 50 mg/mL carbenicillin. DNA was isolated using the QIAprep Spin Miniprep Kit (QIAGEN), following the manufacturer's instructions. For each RACE product, DNA was sequenced in both directions using M13F and M13R primers at the GaP (Genomics and Proteomics) facility, CREAIT network, Memorial University of Newfoundland. Briefly, insert DNA was amplified and purified using the BigDye Terminator v3.1 Cycle Sequencing Kit and BigDye XTerminator Purification Kit (Applied Biosystems Foster City, CA, USA), following the manufacturer's instructions. Sequencing reactions were processed by capillary electrophoresis using an Applied Biosystems 3730 DNA Analyzer. To confirm the structure of the two Atlantic cod Irf10 splice variants identified, the complete Irf10 genomic region was cloned and sequenced. Genomic DNA was extracted from one spleen and one head kidney sample (collected by Hori et al. [22]) using the DNeasy blood and tissue kit (QIAGEN) according to the manufacturer's instructions. PCR was carried out using the Advantage 2 Polymerase kit (Clontech, Mountain View, CA, USA) using approximately 100 ng of genomic DNA per reaction, following the manufacturer's instructions (see Table 1 for primer sequences). The PCR program consisted of an initial denaturation at 94 C for 1 min followed by 35 cycles of (30 s at 94 C; 4 min at 68 C) and a final extension of 4 min at 68 C. The product was electrophoretically separated on a 1% agarose/TAE gel, to confirm the presence of a


367

Table 1 Primers used for cDNA and genomic characterization of cod IRF genes. Primer name

Sequence (50 -30 )

Application

Predicted amplicon size

IRF7-gsp-fwd IRF7-gsp-rev IRF8-gsp-fwd IRF8-gsp-rev IRF10 a -gsp-fwd IRF10 a -gsp-rev IRF4a-gsp-fwd IRF4a-gsp-rev IRF4b-gsp-fwd IRF4b-gsp-rev IRF10b-gsp-fwd IRF10b-gsp-rev IRF4b-orf-fwd IRF4b-orf-rev IRF4a-orf-fwd IRF4a-orf-rev IRF7-orf-fwd IRF7-orf-rev IRF8-orf-rev IRF8-orf-fwd IRF10a-orf-fwda IRF10a-orf-reva IRF10b-orf-fwda IRF10b-orf-reva IRF10-genomic-fwd IRF10-genomic-rev IRF10_p1_fwd IRF10_p1_rev IRF10_p2_fwd IRF10_p2_rev IRF10_p3_fwd IRF10_p3_rev IRF10_p4_fwd IRF10_p4_rev IRF10_p5_fwd IRF10_p5_rev

CGGAATATGTCGTCAACATGTGCT CGTGGCCTCGTTGCCGTAGTG CATGACCTCGGCAACGCCAAGA CTGCATGGTGTCGGAGCTGTAG CCGCACACCGAGAAGCCCAATA GCACGCAGCCCTGCAGGATGA TCCATCCTACCCTGCCCTTCAC AGGAAGGCCTGCTCCGGGTAG GGCTTTCGTCATGAGAAGACACA GTATGTGTGCGTACGTGTGAGTG CGAGTCTGACCAGAGAGCAGGT CGTCTGATCAGACTCTGAGGAAG TGACGGACAGATGAACCTCGAA AGCTCAACCAATCGGGATTTCA ACTTTGCCCAATCTCGTGGTGT GTGTGTGAACGCCTTGGAAAGA GGGACGACACAACGAGGTACAC AAAACCACGTCCCCACTACCAA GAGCTTAAAGCCCGGAGCTCAT AAGATGTCGAACACGGGAGGAC CATGAGGCGGCCTATTTGAAAG CACAGAACTGTCAACTGCCAAG TGCGCTGATGTTATGGACCTTG GAGACTGTGGGAGACTGGCGTA ACCTGAACCAGCTGGACATC TCGCTGGCATGTAGAAAGTC TGCGCTGATGTTATGGACCTTG CGAGATGTCCAGCTGGTTCAG ACAAGGTGGGCAGCGACAAGGA TTTGTGGTTCGGCCTCTGTGTAT GCATCGAGATCCATTTCCTCTAC GTGTCACCTGATATGGCCAGAGT GTGCTGCTTCAGGTGCTTTGTG CTCTCCAGTTTATTGGGCTTCTC CAGCCCAGAAGGGTGCTTCATC CGTACTTGATTATTGTTCCAGTGC

30 RACE 50 RACE 30 RACE 50 RACE 30 RACE 50 RACE 30 RACE 50 RACE 30 RACE 50 RACE 30 RACE 50 RACE ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR ORF-PCR Genomic Genomic Genomic Genomic Genomic Genomic Genomic Genomic Genomic Genomic Genomic Genomic

N/A

a

N/A N/A N/A N/A N/A 1441 bp 628 bp 1577 bp 1287 bp 1423 bp 651 bp DNA DNA DNA DNA DNA DNA DNA DNA DNA DNA DNA DNA

sequencing sequencing sequencing sequencing sequencing sequencing sequencing sequencing sequencing sequencing sequencing sequencing

~4000 bp

Irf10a and Irf10b were renamed Irf10-v1 (splice variant 1) and Irf10-v2 (splice variant 2), respectively, after sequence assembly.

product approximately 4 kb in size. Additional primers were designed to amplify and sequence the complete Irf10 genomic region in 5 parts of 800e1000 bp each (Table 1). PCR was carried out for each part as above, with an extension time of 1 min instead of 4 min. The PCR products were purified using the QIAGEN MinElute PCR purification kit following the manufacturer's protocol, and sequenced as described above. 2.2. Sequence analysis Sequence data was compiled and analyzed using Lasergene SeqMan Pro software V. 7.1.0 (DNASTAR, Inc., Madison, WI, USA). The amino acid sequence for each IRF family member was predicted based on cDNA sequence using the ExPASy Translate tool (see Web References). Homologous IRF protein sequences from other teleost species (zebrafish, Atlantic salmon, Japanese flounder, grass carp, rock bream) were collected from the NCBI non redundant (nr) protein database using the BLASTx alignment search tool and Atlantic cod Irf transcripts as queries. Predicted IRF amino acid sequences were aligned with the ClustalW function of MEGA5 software [36] with all sequences trimmed to the length of the shortest orthologue [Atlantic cod IRF4a (144 AA)] to remove technical bias. Based on the multiple sequence alignment, a phylogenetic tree was constructed using the neighbour-joining method in MEGA5, where the bootstrap consensus tree was constructed from 2000 replicates. A second alignment and tree were constructed in the same way, using un-trimmed sequences (excluding cod IRF4a) for comparison (Supplemental Fig. 1).

2.3. RT-PCR expression analysis in juvenile cod tissues All procedures involving sampling of juvenile cod were conducted with approval of Memorial University of Newfoundland's Institutional Animal Care Committee, following the guidelines of the Canadian Council on Animal Care. In this experiment, two juvenile Atlantic cod were individually removed from a 10 C tank and quickly euthanized by a lethal dose of tricaine methanesulphonate (TMS; 400 mg/L; Syndel Laboratories, Qualicum Beach, BC, Canada). Tissues (blood, brain, eye, gill, head kidney, heart, hindgut, liver, midgut, posterior kidney, pyloric caecum, skeletal muscle, skin, spleen, stomach) were collected by team dissection, placed in nuclease-free 1.5 mL microcentrifuge tubes and immediately flash-frozen in liquid nitrogen before storage at 80 C. Separate instruments were used to collect each tissue, and all instruments were cleaned with RNAse Away (Sigma) between dissections. To extract total RNA, approximately 100 mg of each tissue was homogenized by high speed agitation (TissueLyser II, QIAGEN) in 1 mL of TRIzol (Invitrogen). Further homogenization using QIAshredder (QIAGEN) columns and TRIzol extraction of RNA were performed following manufacturers' methods. The RNA was treated with DNaseI (RNase Free DNase Set, QIAGEN) and column-purified using the RNeasy MinElute Cleanup Kit (Invitrogen) following the manufacturers' instructions. RNA quality (A260/280 and A260/230) and concentration were assessed by Nanodrop (Thermo Scientific) spectrophotometry. One mg of each clean RNA sample was used for cDNA synthesis in a 20 mL reaction containing M-MLV (Moloney

368


Murine Leukemia Virus) reverse transcriptase (200 U, Invitrogen), random primers (250 ng, Invitrogen) with the manufacturer's first strand buffer and DTT (10 mM final concentration), carried out at 37 C for 50 min. cDNA was diluted 1:10 in nuclease-free water before use. PCR was carried out using TopTaq DNA polymerase (QIAGEN) in 25 mL reactions containing 2 mL of cDNA (corresponding to 10 ng of input RNA). The same gene-specific primers designed for QPCR (Table 1) were used for RT-PCR, at a final concentration of 2.5 mM. For each primer set, a no-template control containing all reaction components except cDNA was also run. Cycling conditions were a 3 min denaturation step at 94 C followed by 30 cycles of [30 s at 94 C; 30 s at 60 C; 1 min at 72 C] and 10 min at 72 C. PCR products were electrophoretically separated on 1.7% agarose/TAE gels (stained with ethidium bromide) alongside a 1 Kb Plus DNA Ladder (Invitrogen). EF1-a (elongation factor 1 a) was used as a reference gene, as it showed similar transcript expression in all tissues studied. 2.4. QPCR expression analysis: response of spleen transcripts to immune stimulation and increased temperature Atlantic cod spleen samples used in this experiment were collected as part of a previous study, as described by Hori et al. [22,35]. Briefly, Atlantic cod (~60 g) from 10 different families belonging to the Atlantic Cod Genomics and Broodstock Development Project (CGP) year class 3 were kept in 500 L tanks, four of which were held at 10 C and four of which were gradually increased over 1 month to 16 C. After acclimation for 1 week, fish were intraperitoneally (IP) injected with one of the following: poly(I:C) (Sigma) in sterile phosphate-buffered saline (PBS); formalin-killed, typical A. salmonicida (ASAL) in PBS; or PBS alone (see Refs. [22,35] for further details). Sampling was carried out at 6 and 24 h post-injection (HPI) using aseptic techniques as described above, and samples were stored at 80 C. For the current research, previously extracted total RNA samples representing six individuals per treatment group were treated with DNaseI (RNase Free DNase Set, QIAGEN) and column-purified using the RNeasy MinElute Cleanup Kit (Invitrogen) following the manufacturers' instructions. RNA quality was determined by agarose gel electrophoresis and Nanodrop spectrophotometry, and cDNA was prepared using MMLV reverse transcriptase as above. Gene-specific primers (Table 2) were designed using Primer3 software (see Web References). All primer pairs were quality tested Table 2 Primers used in RT-PCR and QPCR experiments. Primer name

Sequence (50 -30 )

Amplicona size % Efficiencyb

cod-ef1a-fwd cod-ef1a-rev IRF4a-qpcr-fwd IRF4a-qpcr-rev IRF4b-qpcr-fwd IRF4b-qpcr-rev IRF10a-qpcr-fwd IRF10a-qpcr-rev IRF10b-qpcr-fwd IRF10b-qpcr-rev IRF7-qpcr-fwd IRF7-qpcr-rev IRF8-qpcr-fwd IRF8-qpcr-rev

CCCTCCAGGACGTCTACAAG GAGACTCGTGGTGCATCTCA TGTACCGTATCATCCCAGAGG AGTGGGGTATCTGGCTGTGA TGGACATCACCGAACCCTAC CATGACGAAAGCCATCTGAA CCGAGAAGCCCAATAAACTG ATACTCCTCGCCAAAGCAGA GGTCCAACGCAGTAACGATT ACTGTGGGAGACTGGCGTAT CATGTGCTTTGGGGAGAAGT TCTGTAGGCTGACGTTGGTG TCGGGGAGGAACTACATGAC GGCCATCTCGTCTGACATCT

150 bp

89.9

111 bp

100.6

106 bp

92.3

143 bp

97.7

134 bp

98.6

152 bp

93.5

158 bp

91.8

a Forward and reverse primers were placed in adjacent predicted exons so that the amplicon would span an intron, allowing for detection of genomic DNA contamination. b Percent amplification efficiency (as in Ref. [37]) calculated as the average of two standard curves. (See Section 2.4 for detailed primer quality testing methods).

using pooled cDNA from both the poly(I:C) and PBS (10 C 24 HPI) sampling groups. Where possible, a 5-point, 5-fold dilution standard curve (starting with cDNA corresponding to 10 ng of input RNA) was used to calculate amplification efficiency as described in Pfaffl [37] in both poly(I:C) and PBS pools, with final amplification efficiency reported as the average of the two. However, due to low expression of several transcripts, 4-fold (Irf4a, Irf8) or 3-fold (Irf4b, Irf10-v2) 5-point dilution series were used for those standard curves. Triplicate reactions were carried out for all standard curves, controls and experimental samples. EF1a was confirmed as a suitable normalizer gene by testing in approximately one third of the experimental samples, including all time points and treatments. The range of threshold cycle (CT) values for EF1a was 1.7 cycles, indicating a similar level of expression in the included samples. All QPCR analyses were performed using SYBR Green chemistry and the ViiA7 Real Time PCR System (Applied Biosystems). PCR amplification was carried out in 13 mL reactions containing 6.5 mL of Power SYBR Green master mix (Applied Biosystems), 0.52 mL each of forward and reverse primers (50 nM final concentration), 3.46 mL of nuclease-free water and 2 mL of cDNA (corresponding to 10 ng of input RNA). The QPCR program consisted of 1 cycle of 50 C for 2 min, 1 cycle of 95 C for 10 min, followed by 40 cycles of (95 C for 15 s and 60 C for 1 min), with data collection after each 60 C step. All samples were run as triplicate technical replicates, and notemplate controls were included for each primer set in each plate. A linker sample of cDNA made from pooled PBS-injected (10 C, 24 HPI) samples was run on each plate; all linker CT values were within 1 cycle. To confirm the absence of any genomic DNA, a no-reverse-transcription (no-RT) control was also included in which a cDNA synthesis reaction using the linker RNA pool was carried out with all components except reverse transcriptase. The reaction product was run in triplicate (2 mL as with cDNA samples), and no amplification was observed in the no-RT control. The expression of each gene of interest was normalized to EF1a expression, and the relative quantity (RQ) of each QPCR target transcript for each individual was calculated using the ViiA™ 7 Software v1.2 (Applied Biosystems) for Comparative CT (DDCT) analysis, incorporating the calculated amplification efficiencies for each primer pair (Table 2). The lowest expressing sample for each gene of interest was set as the calibrator (RQ set as 1.0) for analysis of that gene. RQ values were analyzed statistically and plotted using Prism v5.0 (GraphPad Software Inc., La Jolla, CA, USA). A two-way ANOVA, with treatment and temperature as factors, was carried out for each time point. If the effect of one factor was statistically significant (p < 0.05), t-tests were performed to compare groups, as described by Hori et al. [22]. 3. Results 3.1. Characterization of Irf4a, Irf4b, Irf7, Irf8, Irf10-v1 and Irf10-v2 cDNA sequences Assembly of Irf4a sequencing reads [RACE sequences as well as additional open reading frame (ORF) sequencing reads to confirm overlapping region] produced a 796 bp cDNA sequence (excluding poly-A tail) (Fig. 1). The sequence consisted of a 435 bp (144 AA) ORF, a 159 bp 50 untranslated region (UTR), and a 202 bp 30 -UTR. The most common polyadenylation signal (AAUAAA) was not present in the 30 -UTR; instead the sequence GUUAAA may act as the polyadenylation signal for this transcript. This hexamer has previously been identified as a potential polyadenylation signal in mouse germ cells [38]. Assembly of sequencing reads for the longer Irf4 paralogue (Irf4b) produced a 1688 bp cDNA sequence (excluding poly-A tail) (Fig. 2). The cDNA consisted of a 1347 bp (448 AA) ORF, a 171 bp 50 -UTR, and a 170 bp 30 -UTR. A possible polyadenylation


369

Fig. 1. Sequence and predicted structure of Atlantic cod Irf4a. A. Nucleotide sequence of Irf4a cDNA (GenBank accession KM268811) and inferred amino acid translation. Nucleotide sequence is numbered on the left, while the predicted amino acid sequence is numbered on the right. The open reading frame is shown in upper case letters while 50 and 30 untranslated regions are in lower case letters. Nucleotide sequence of the DNA binding domain is shaded in grey. Locations of predicted introns are indicated based on Ensembl predicted transcript ENSGMOT00000005509. The stop codon is marked with an asterisk (*). Arrows indicate position of gene-specific primers used in QPCR. A possible polyadenylation signal (GTTAAA [38]) is bolded. B. Schematic of predicted genomic structure. Exons are shown as boxes, with coding portions in black and non-coding portions in grey, while introns are shown as horizontal lines. Exon lengths are above and intron lengths below (in bp). Known lengths are drawn to scale. As the position of intron 2 does not match the Ensembl predicted genome sequence its length could not be estimated and is marked by “?”. An exon that differs from the Ensembl predicted sequence is marked by an asterisk.

signal (ACUAAA, [38]) was identified 25 bp upstream of the poly-A tail. Irf7 sequencing reads were assembled to produce a 2037 bp cDNA sequence that consisted of a 1326 bp (441 AA) ORF, a 36 bp 50 UTR and a 675 bp 30 -UTR containing an AUUAAA putative polyadenylation signal (Fig. 3). Assembly of Irf8 sequencing reads produced a 1826 bp cDNA sequence that consisted of a 1266 bp (421 AA) ORF, a 99 bp 50 -UTR, and a 461 bp 30 -UTR containing the polyadenylation signal AAUAAA (Fig. 4). Irf10-v1 (splice variant 1) RACE and ORF PCR sequencing reads were assembled to produce a 1714 bp cDNA sequence that consisted of a 1191 bp (396 AA) ORF, a 106 bp 50 -UTR and a 417 bp 30 -UTR containing a possible polyadenylation signal (AGUAAA, [38]) (Fig. 5). The Irf10-v2 cDNA was much shorter (1171 bp), with an ORF of only 381 bp (126 AA), a 128 bp 50 -UTR, and a 662 bp 30 -UTR containing a AAUAAA polyadenylation signal (Fig. 6). Sequencing and assembly of the cod Irf10 genomic region produced a 3828 bp consensus sequence, which was aligned with Irf10-v1 and Irf10-v2 transcripts to determine intron positions. The positions of 7 introns, ranging from 91 bp to 970 bp in length, were determined for Irf10-v1 (Fig. 5), dividing the transcript into 8 exons. Irf10-v2, while identical to Irf10v1 up to the end of exon 2, appears to retain intron 2 producing a premature stop codon (Fig. 6). The 30 -UTR of the Irf10-v2 transcript appears to contain exon 3, intron 3, exon 4 and part of intron 4. All newly characterized cod Irf cDNA sequences are available in GenBank [accession number KM268810 (Irf4b); KM268811 (Irf4a); KM268812 (Irf7); KM268813 (Irf8); KM268814 (Irf10-v1); KM268815 (Irf10-v2)]. Phylogenetic analysis of IRF proteins from several teleost species (including the Atlantic cod IRF amino acid sequences shown in Figs. 1e6 and the previously sequenced cod IRF1 [25]) indicates that the cod IRF cDNAs and predicted proteins in this study are

orthologous to IRFs from other fish species. Multiple sequence alignment showed that the DBDs (first 110-120 AA) of all sequences included were quite similar, with several conserved amino acids including the multiple Trp residues found in all IRFs (Supplemental Fig. 2). In a phylogenetic tree based on the multiple sequence alignment (Fig. 7), all sequences group into the four sub-groups described above (IRF1-SG, IRF3-G, IRF4-G, IRF5-G), as expected.

3.2. RT-PCR expression analysis in juvenile Atlantic cod tissues RT-PCR and agarose gel electrophoresis analysis were used to investigate constitutive transcript expression of cod IRF family members in 15 different tissues of juvenile Atlantic cod. While Irf7, Irf8 and Irf10-v1 appeared to be expressed at a moderate level in all tissues, Irf4a, Irf4b and Irf10-v2 were absent or expressed at very low levels in some tissues (Fig. 8). Interestingly, splice variants Irf10-v1 and Irf10-v2 appeared to have different patterns of expression: the expression of the shorter variant (v2) was apparently vastly reduced or absent in some digestive tissues (e.g. stomach, midgut, and hindgut) and in the eye, while the longer transcript was more evenly expressed in all 15 tissues. Irf10-v2 was also unique among the transcripts studied in that the highest transcript expression appeared to be in heart and skeletal muscle. As a goal of this study was to better understand the roles of IRFencoding transcripts in cod immune responses, expression in immune-relevant tissues [i.e. spleen, hematopoietic (head) kidney, blood] was of particular interest. All six transcripts were expressed in spleen and head kidney, and all except Irf4a were expressed in blood (Irf4a was faintly detected in only one replicate blood sample). The constitutive expression of all IRF transcripts in spleen

370


Fig. 2. Sequence and predicted structure of Atlantic cod Irf4b.A. Nucleotide sequence of Irf4b cDNA (GenBank accession KM268810) and inferred amino acid translation. Nucleotide sequence is numbered on the left, while the predicted amino acid sequence is numbered on the right. The open reading frame is shown in upper case letters while 50 and 30 untranslated regions are in lower case letters. Nucleotide sequence of the DNA binding domain is shaded in grey. Locations of predicted introns are indicated based on Ensembl predicted transcript ENSGMOT00000018695. The stop codon is indicated by an asterisk (*). Arrows indicate position of gene-specific primers used in QPCR. A possible polyadenylation signal (ACTAAA [38]) is indicated in bold. B. Schematic of predicted genomic structure. Exons are shown as boxes, with coding portions in black and non-coding portions in grey, while introns are shown as horizontal lines. (Legend as in Fig. 1). Exon lengths are above and intron lengths below (in bp). Known lengths are drawn to scale. As the position of intron 3 does not match the Ensembl predicted genome sequence its length could not be estimated and is marked by “?”. An exon that differs from the Ensembl predicted sequence is marked by an asterisk.

supported the use of this organ for subsequent QPCR expression analyses. 3.3. Spleen Irf transcript expression responses to viral and bacterial antigens and increased temperature Expression of cod IRF transcripts in response to injection with viral [poly(I:C)] and bacterial (ASAL) antigens at 10 C and 16 C was analyzed by QPCR. Interestingly, spleen transcript expression of

Irf4a, the shorter Irf4 paralogue, was approximately 2-fold lower in poly(I:C) injected fish than in PBS control fish at 10 C when sampled 24 h post-injection (HPI) (Fig. 9A). While there was no significant response to poly(I:C) for this paralogue at either temperature at the 6 HPI time-point, there was significantly higher Irf4a transcript expression in the control (PBS) injected fish at 16 C compared with PBS fish at 10 C at that time point. This temperature dependent response of Irf4a (i.e. higher expressed at the elevated temperature at 6HPI) was also seen in ASAL-injected fish


371

Fig. 3. Sequence and predicted structure of Atlantic cod Irf7.A. Nucleotide sequence of Irf7 cDNA (GenBank accession KM268812) and inferred amino acid translation. Nucleotide sequence is numbered on the left, while the predicted amino acid sequence is numbered on the right. The open reading frame is shown in upper case letters while 50 and 30 untranslated regions are in lower case letters. Nucleotide sequence of the DNA binding domain is shaded in grey. Locations of predicted introns are indicated based on Ensembl predicted transcript ENSGMOT00000010511. The stop codon is indicated by an asterisk (*). Arrows indicate position of gene-specific primers used in QPCR. The polyadenylation signal is indicated in bold. B. Schematic of predicted genomic structure. Exons are shown as boxes, with coding portions in black and non-coding portions in grey, while introns are shown as horizontal lines. (Legend as in Fig. 1). Exon lengths are above and intron lengths below (in bp). Drawings are to scale, except where long introns are depicted as bent lines. Introns whose positions do not match Ensembl predicted genome sequences and whose length could therefore not be estimated are marked by “?”. An exon that differs from the Ensembl predicted sequence is marked by an asterisk.

372


Fig. 4. Sequence and predicted structure of Atlantic cod Irf8. A. Nucleotide sequence of Irf8 cDNA (GenBank accession KM268813) and inferred amino acid translation. Nucleotide sequence is numbered on the left, while the predicted amino acid sequence is numbered on the right. The open reading frame is shown in upper case letters while 50 and 30 untranslated regions are in lower case letters. Nucleotide sequence of the DNA binding domain is shaded in grey. Locations of predicted introns are indicated based on Ensembl predicted transcript ENSGMOT00000004315. The stop codon is indicated by an asterisk (*). Arrows indicate position of gene-specific primers used in QPCR. The polyadenylation signal is indicated in bold. B. Schematic of predicted genomic structure. Exons are shown as boxes, with coding portions in black and non-coding portions in grey, while introns are shown as horizontal lines. (Legend as in Fig. 1). Exon lengths are above and intron lengths below (in bp). Drawings are to scale, except where long introns are depicted as bent lines. Introns whose positions do not match Ensembl predicted genome sequences and whose length could therefore not be estimated are marked by “?”. Exons that differ from Ensembl predicted sequences are marked by asterisks.

(Fig. 10A), although ASAL injection itself did not have a significant effect (compared to time- and temperature-matched PBS controls) on Irf4a expression at the time points/temperatures studied. Transcript expression of Irf4b, the longer IRF4 paralogue, was significantly upregulated in response to both poly(I:C) and ASAL

injection at 6HPI compared with PBS controls (Figs. 9B and 10B). For poly(I:C) the change was only seen for fish held at 16 C (2.23-fold upregulated), while for ASAL it was observed at both 10 C and 16 C (1.98-fold and 3.41-fold upregulated, respectively). For both treatments, the response was no longer observed at the 24HPI


373

Fig. 5. Sequence and predicted structure of Atlantic cod Irf10 (Irf10-v1). A. Nucleotide sequence of Irf10-v1 cDNA (GenBank accession KM268814) and inferred amino acid translation. Nucleotide sequence is numbered on the left, while the predicted amino acid sequence is numbered on the right. The open reading frame is shown in upper case letters while 50 and 30 untranslated regions are in lower case letters. Nucleotide sequence of the DNA binding domain is shaded in grey. The stop codon is indicated by an asterisk (*). Arrows indicate position of gene-specific primers used in QPCR. A possible polyadenylation signal [38] is indicated in bold. Positions of introns are indicated based on mapping to genomic sequence. B. Schematic of predicted Irf10 genomic structure. Exons are shown as boxes, with coding portions in black and non-coding portions in grey, while introns are shown as horizontal lines. (Legend as in Fig. 1). Exon lengths are above and intron lengths below (in bp). Drawings are to scale, except where a long intron is depicted as a bent line.

374


Fig. 6. Sequence of Atlantic cod Irf10-v2 transcript. Nucleotide sequence of Irf10-v2 cDNA (GenBank accession KM268815) and inferred amino acid translation. Nucleotide sequence is numbered on the left, while the predicted amino acid sequence is numbered on the right. The open reading frame is shown in upper case letters while 50 and 30 untranslated regions are in lower case letters. Nucleotide sequence of the DNA binding domain is shaded in grey. The stop codon is indicated by an asterisk (*). Arrows indicate position of gene-specific primers used in QPCR. A possible polyadenylation signal is indicated in bold. Positions of introns are indicated based on mapping to Irf10-v1 transcript and genomic sequence. Note: the structure of the complete Atlantic cod Irf10 gene is depicted in Fig. 5B.

time-point. Changes in Irf4b transcript expression were also seen in response to increased temperature at the later time point, as expression was lower at 16 C than 10 C at 24HPI for all three [PBS, ASAL, poly(I:C)] treatment groups (Figs. 9B and 10B). As noted above, the responses of Atlantic cod Irf7 transcript expression to poly(I:C) and/or elevated temperatures have previously been investigated [22]; therefore only the response to ASAL at the two different temperatures was investigated (Fig. 10C). Spleen Irf7 transcript expression increased in response to ASAL injection (compared with time- and temperature-matched PBS controls) in fish held at both temperatures, although the increase was only at 6HPI for 16 C fish (2.28-fold upregulated), and only at 24HPI for 10 C fish (1.60-fold upregulated) (Fig. 10C). Differences were also seen in ASAL injected fish at the same time point held at different temperatures, with transcript expression being higher at 16 C than 10 C at 6HPI and lower at 16 C than 10 C at 24HPI. Irf8 transcript expression increased in response to poly(I:C) only at 24HPI in fish held at 10 C (1.29-fold upregulated compared with time- and temperature-matched PBS controls) (Fig. 9C). Response to ASAL injection, however, was similar to that of Irf7, as Irf8 expression increased at 6HPI for fish held at 16 C (2.17-fold) and at 24HPI for fish held at 10 C (1.45-fold) (Fig. 10D). Interestingly, there was a small (1.25-fold) but statistically significant decrease in Irf8 transcript expression in ASAL compared to PBS fish at 6HPI and 10 C. A response to temperature change was also seen in both ASAL

and PBS injected fish, as Irf8 expression was higher at 16 C than 10 C (at 6HPI for ASAL and at both time points for PBS) (Fig. 10D). As with Irf7, the spleen transcript expression responses of cod Irf10-v1 (the longer Irf10 splice variant) to poly(I:C) and/or elevated temperature have previously been investigated [22]. Therefore, the response to ASAL only for this transcript was investigated in the current study (Fig. 10E). Upregulation (2.40-fold) of Irf10-v1 was observed only at 24HPI in fish held at 10 C compared to time- and temperature-matched PBS controls; no significant response was observed at 6HPI at either temperature. ASAL injected fish at 24HPI also had higher expression of Irf10-v1 at 10 C than at 16 C, similar to the response observed for Irf7 (Fig. 10C). Notably, Irf10-v2 (the shorter Irf10 splice variant) showed a significant increase in transcript expression in response to ASAL at 6HPI at both temperatures (Fig. 10F), unlike the longer Irf10 splice variant which was nonresponsive to ASAL at 6HPI. Significant upregulation of Irf10-v2 was also seen in response to poly(I:C) injection compared with time- and temperature-matched PBS controls. Expression was elevated at 6HPI for fish held at both temperatures (7.80-fold at 10 C and 10.76-fold at 16 C), and at 24HPI for fish held at 10 C (4.08-fold) (Fig. 9D). Importantly, these fold change values were the highest measured in this QPCR study. An effect of temperature on Irf10-v2 transcript expression was observed in both ASAL and poly(I:C) injected fish, where expression at 6HPI was higher in 16 C fish and expression at 24HPI was higher in 10 C fish (Figs. 9D and


Fig. 7. Phylogenetic analysis of teleost IRF family members. Putative Atlantic cod amino acid sequences were aligned with IRF proteins from other teleost fish species (see Supplemental Table 1 for GenBank accession numbers) using MEGA5 software [36]. All sequences were truncated to match the shortest protein (cod IRF4a, 144 AA) to remove technical bias. Based on the multiple sequence alignment, the evolutionary history was inferred using the neighbour-joining method. The bootstrap consensus tree was constructed from 2000 replicates, where numbers at the branch points represent percentage of replicates in which the associated taxa grouped together. Branch lengths are proportional to calculated evolutionary distances. Sequences determined from this study are indicated with an asterisk (*).

10F); this was similar to the effect of temperature on both Irf4b and Irf7 transcript expression. 4. Discussion 4.1. mRNA characterization and phylogenetic analysis The identification of complete cDNA and predicted amino acid sequences of several cod IRFs allowed for molecular phylogenetic analysis to be conducted and for the evolutionary relationships between these sequences and IRFs from other fish species to be determined. Two paralogous cod Irf4 cDNA sequences were identified in the current study. The presence of additional IRF paralogues was not unexpected, as phylogenetic analysis of this gene family shows it has undergone expansion and diversification several times

375

throughout vertebrate evolution [7,8]. Nehyba et al. [8] traced all IRF genes in humans to 4 of the 17 ancestral chordate linkage groups described by Putnam et al. (2008) [39], and noted that the 4 groups correspond to the 4 IRF subfamilies in vertebrates. They concluded that the expansion from 4 to 10 IRF family members in most vertebrates likely resulted from the two rounds of whole genome duplication that are believed to have occurred in early vertebrate evolution. Interestingly, Irf10, which is present in chicken (Gallus gallus) and teleost fish, appears to have been lost in humans and other mammals sometime after the second whole genome duplication event in the early vertebrate lineage [8]. Evidence suggests a third whole genome duplication occurred in the teleost fish lineage shortly after their divergence from lobe-finned fishes [40], which could explain why some fish species show further expansion of the IRF family. For example, the zebrafish has two Irf1-like genes (named Irf1a and Irf1b in some databases or Irf1 and Irf11 in others [3,4]), and also has two Irf4 paralogues, named Irf4a and Irf4b [3]. Atlantic salmon have two Irf7 paralogues [15], although these likely arose after another putative whole genome duplication in the salmonid lineage [41] which led to further expansion of many gene families. As seen in Fig. 7, phylogenetic analysis indicates that the salmon IRF7 paralogues are more closely related to each other than to IRF7 protein sequences from other teleosts. However, zebrafish IRF4b, for example, is more similar to salmon IRF4 than to zebrafish IRF4a. Based on alignment with putative zebrafish orthologues, the shorter cod Irf4 sequence identified in this study was named Irf4a, and the longer cod paralogue was named Irf4b. Two different cod Irf10 splice variants were identified in this study. It is therefore possible that alternate splicing may occur in other cod IRF family members as well. In humans, multiple splice variants of Irf1 [42], Irf3 [43], Irf5 [44] and Irf7 [45] have been identified, and several of these variants were found to have different functions. For example, Lee et al. (2006) [42] showed that alternative splicing of human Irf1 negatively regulated wild type Irf1 in cervical cancer tissue. They suggested that the more stable variant protein competes with the wild type IRF1 and decreases its functionality. Interestingly, although there are currently no studies of IRF splice variants in Atlantic cod, recent studies on piscidins (a group of antimicrobial peptides) suggested that a splice variant of cod pis2 is produced by intron retention [46], similar to IRF10-v2 in the current study. The authors of that study suggested that such a splice variant may regulate wild type expression through nonsense-mediated decay. Phylogenetic analysis of predicted IRF amino acid sequences in cod and other teleost species supports the division of IRFs into four subgroups (IRF1-G, IRF3-G, IRF4-G, IRF5-G) [7]. All cod IRFs studied herein contain the amino terminal DBD and associated conserved Trp residues found in all IRFs (Supplemental Fig. 2). While most mammalian IRFs contain five conserved Trp residues [5], fish IRFs appear to show more variation, with IRF1s having six Trps and IRF7s having only four. The importance of the DBD is highlighted by its high level of conservation among all IRFs in all species, even as evolution of the carboxyl terminal region has allowed this group of transcription factors to take on diverse roles in biological processes such as development and oncogenesis (reviewed in Refs. [9e11]). The IAD, found in the middle to carboxyl region of the protein, is important for interaction with other IRF family members and other transcription factors [47]. Phylogenetic analysis in the current study (Fig. 7) represents sequences trimmed to 144 AA (to match the short cod IRF4a protein), and therefore does not include the IAD. Analysis based on alignment of the complete sequences (excluding cod IRF4a; Supplemental Fig. 1) supports the presence of IRF1-SG and IRF4SG supergroups [7], which can be distinguished by the presence of IAD1 in IRF4-SG (i.e. all IRFs except IRF1 and IRF2).

376


Fig. 8. Composite agarose gel image of IRF family member transcript expression in 15 tissues of juvenile Atlantic cod. All gels are 1.7% agarose in TAE buffer, using 1 kb plus ladder (Invitrogen) as a size marker (100 bp and 200 bp bands are shown). PCR was carried out using samples from two fish. Br ¼ brain, Ey ¼ eye, Gi ¼ gill, Hr ¼ heart, HK ¼ hematopoietic (head) kidney, PK ¼ posterior (trunk) kidney, Sp ¼ spleen, Li ¼ liver, PC ¼ pyloric caecum, St ¼ stomach, MG ¼ midgut, HG ¼ hindgut, Sk ¼ skin, Mu ¼ skeletal muscle, Bl ¼ blood, C ¼ no-template control.

4.2. Expression analysis in juvenile cod tissues As expected, the expression of all IRF transcripts was observed in spleen and hematopoietic (head or anterior) kidney, two important tissues of the teleost immune system. The spleen is a major site for the trapping and presentation of antigens for recognition by lymphocytes, and like the head kidney, is a site of hematopoiesis and the removal of aged or damaged blood cells [48]. Both tissues are, therefore, of particular interest in immunological studies in teleosts. In the current study, all transcripts except Irf4a and Irf4b appeared to be expressed at some level in all of the included tissues (Fig. 8). Studies of selected IRFs in rainbow trout [13], yellow croaker [49], turbot [50], Japanese flounder [51] and rock bream [16] using QPCR have shown similar patterns of constitutive expression in most tissues, with higher expression in spleen, head kidney and often gill and/or blood. The ubiquitous expression of cod Irf7 and Irf8 transcripts agrees with studies of those genes in other fish species (e.g. mandarin fish [12], and Japanese flounder [52,53]), where constitutive expression was seen in various tissues.

Irf4a appeared to have the lowest expression of all the transcripts included in the juvenile tissue panel RT-PCR study, and was only observed to be expressed in gill, head kidney and spleen, with low expression in posterior kidney and blood in one biological replicate each (Fig. 8B). IRF4 is important for blood cell differentiation in human and mouse, and particularly for dendritic cell development [54]. Therefore, it is not surprising that Irf4a appears to have higher transcript expression in hematopoietic tissues (i.e. spleen and kidney) than in most other tissues. Cod Irf4b appeared to be more widely expressed, although expression was low in several tissues (e.g. eye, posterior kidney, and stomach). Some discrepancy for this transcript was observed, however, between the two biological replicates, particularly the replicate blood samples (Fig. 8C). Constitutive transcript expression of cod Irf4-like genes agreed in general with previous studies in rainbow trout [14] and rock bream [16] in which Irf4 expression was relatively high in spleen and head kidney. Importantly, different transcript expression profiles were observed for the two Irf10 transcript variants in each of the expression studies. The longer splice variant (named Irf10-v1) was


377

Fig. 9. Spleen transcript expression responses of Atlantic cod IRF family members to the viral mimic poly(I:C) measured by QPCR. Data are presented as mean ± SEM, normalized to ef1a expression, with the lowest expressing sample as calibrator [i.e. set to relative quantity (RQ) ¼ 1]. Different letters represent significant differences between fish injected with PBS (lower case) or poly(I:C) (upper case) at different temperatures within the same time-point. Asterisks (*) represent a significant difference between a poly(I:C) injected group and the time- and temperature-matched PBS injected group (*p < 0.05, **p < 0.01, ***p < 0.001). Fold change is calculated as [mean poly(I:C) RQ]/(mean PBS RQ) or (mean 16 C RQ)/(mean 10 C RQ). Black boxes show 1/fold-change for comparisons which yielded fold-change values less than 1. A e Irf4a, B e Irf4b, C e Irf8, D e Irf10-v2. Note that poly(I:C) is abbreviated as pIC in the figure to conserve space.

observed to be constitutively expressed in all 15 tissues at a similar level. The shorter splice variant (Irf10-v2), however, appeared to have very low expression in eye and in most digestive tissues (stomach, midgut, and hindgut) and highest expression in the heart and skeletal muscle. It is therefore possible that the two splice variants have different functions (e.g., as suggested above based on cod piscidin splice variants [46], the shorter variant may be involved in the regulation of the longer). While Irf10 has not been as widely studied as other IRF family members, its transcript expression has been investigated in a few other species. In chicken, this gene was observed to be most highly expressed in white blood cells, with relatively high transcript expression in spleen and thymus, but little expression in other tissues based on Northern blot analysis [7]. In contrast, while both cod Irf10 splice variants were expressed in hematopoietic tissues (spleen, head kidney) and blood, that expression was not noticeably higher than in other tissues. In Japanese flounder, Irf10 mRNA was expressed in various tissues (e.g. in gill, heart, head and trunk kidney, intestine and stomach) [55], which is comparable to the ubiquitous expression of Irf10-v1 observed in the current study. Zebrafish Irf10 was also widely expressed, interestingly with relatively high transcript expression in testis, heart and trunk kidney [21]. Further studies using techniques such as in situ hybridization and immunohistochemistry should be carried out in the future to confirm differential constitutive expression of the two cod Irf10 splice variants and their encoded proteins, and to suggest where (i.e. in which tissues) and when (i.e. during different stages of development) each variant could function.

4.3. Spleen transcript expression response to immune stimulation Previous to this study, it was shown that: 1) transcript expression of cod Irf7 and Irf10 (Irf10-v1) increased in spleen following intraperitoneal (IP) injection of the viral mimic poly(I:C) [22,23]; and 2) both transcripts, along with Irf1, had a significantly higher poly(I:C) induced transcript expression at 16 C than at 10 C at 6HPI, but a higher poly(I:C) induced transcript expression at 10 C than at 16 C at 24HPI [22]. Cod Irf1 transcript expression also increases in response to ASAL stimulation in both the spleen and head kidney [25]. However, the response of Atlantic cod Irf4 or Irf8 (or Irf10-v2, which had not been identified prior to the current study) to poly(I:C) was not investigated by Hori et al. [22] or in any other study. In addition, the transcript expression response to bacterial antigens of the genes characterized herein had not been previously investigated. Differences were observed in the spleen transcript expression profiles of cod Irf4a and Irf4b, in response to both poly(I:C) and ASAL injection (Fig. 9A,B and 10A,B). For example, while Irf4b transcript expression increased in response to poly(I:C) (at 6HPI and 16 C; compared to time- and temperature-matched PBS controls), Irf4a expression had no response to poly(I:C) at 6HPI at either temperature or at 24HPI at 16 C, and was lower in poly(I:C) than PBS injected fish at 24HPI at 10 C. Interestingly, a similar transcript expression profile to cod Irf4a was observed for Irf4 in rock bream injected with poly(I:C) [16]. In that study, which included time points from 0HPI to 48HPI, the only significant response to poly(I:C) stimulation in spleen was a decrease at 12HPI.

378


Fig. 10. Spleen transcript expression responses of Atlantic cod IRF family members to bacterial antigens measured by QPCR. Data is presented as mean ± SEM, normalized to ef1a expression, with the lowest expressing sample as calibrator [i.e. set to relative quantity (RQ) ¼ 1]. Different letters represent significant differences between fish injected with PBS (lower case) or ASAL (upper case) at different temperatures within the same time point. Asterisks (*) represent significant differences between an ASAL injected group and the time- and temperature-matched PBS injected group (*p < 0.05, **p < 0.01, ***p < 0.001). Fold change is calculated as (mean ASAL RQ)/(mean PBS RQ) or (mean 16 C RQ)/(mean 10 C RQ). Black boxes show 1/fold-change for comparisons which yielded fold-change values less than 1.

Based on the phylogenetic analysis (Fig. 7), rock bream Irf4 appears to be more closely related to cod Irf4a than to zebrafish or cod Irf4b, supporting its similar expression profile to cod Irf4a in response to poly(I:C). While ASAL stimulation was not included for the rock bream study, the effects of two other bacterial pathogens, Edwardsiella tarda and Streptococcus iniae were investigated. Both pathogens caused a decrease in Irf4 spleen and head kidney expression at 3HPI, followed by an increase at 12HPI and then another decrease at the final (48HPI) time point [16]. In cod, Irf4b was responsive to stimulation with ASAL while Irf4a was not, suggesting that cod Irf4b may share some similarity in function with the rock bream putative orthologue. The very different transcript expression profiles of cod Irf4a and Irf4b (i.e. up-regulation of Irf4b, but not Irf4a, in response to both

viral and bacterial antigens) provide evidence of regulatory divergence of these paralogues (i.e. gene duplication and divergence), even though they are quite similar over the length of the shorter Irf4a (74% identical overall and 81% identical over the DBD at the amino acid level, see Supplemental Fig. 3). These results also suggest that the two genes may have different roles in the immune response to pathogens and/or pathogen-associated molecular patterns (PAMPs) such as poly(I:C). No data on Irf4 transcript expression response to immune stimuli could be found for zebrafish or any other species with multiple Irf4 paralogues, and therefore it is unknown whether the differing profiles observed in this study are unique to Atlantic cod. The cod Irf8 response to ASAL at 10 C included an initial decrease in transcript expression (6HPI) and then an increase


(24HPI) compared to PBS controls, following a similar pattern to the rock bream Irf8 (and Irf4) response to bacterial pathogens [16]. However, the transcript expression profile at 16 C for cod Irf8 was quite different, showing an increase at 6HPI and no significant difference at 24HPI in response to ASAL compared to PBS controls (Fig. 10D). Unfortunately no other studies of Irf8 transcript expression include multiple temperatures for comparison. Bathige et al. [16] suggested that the initial decrease observed in their study may have been caused by the immune suppressive capability of live pathogens. However, this explanation would not apply to killed pathogens (i.e. ASAL) as used in the current study. Interestingly, while Hori et al. [35] found a temperature increase (10 Ce16 C) to have a much greater overall effect on poly(I:C) stimulated vs. ASAL stimulated transcript expression in cod, the greatest response of Irf8 expression in the current study was to ASAL stimulation at 6HPI at the elevated temperature (a 2.17 fold increase; Fig. 10D). No significant response of cod Irf8 transcript expression was observed at the elevated temperature in poly(I:C) injected fish. In the current study, as well as in previous studies of rainbow trout [14] and rock bream [16], up-regulation of Irf8 transcript expression after poly(I:C) stimulation was observed. However, the response in cod was at 24HPI (at 10 C; compared to time- and temperature-matched PBS controls), whereas in rock bream [16] the increase occurred at 3HPI, 12HPI and 24HPI, and in trout it occurred at 4HPI (the only post-stimulation time point in that study). It should also be noted that in both the current study and the rock bream study, the increased Irf8 transcript expression was quite subtle, i.e., fold changes of 2 or less as compared to timematched PBS controls (Fig. 9C, [16]). In contrast, a 5-fold increase in Irf8 expression was observed in response to poly(I:C) in trout, although that study used cultured splenocytes rather than whole spleen tissue [14]. Responsiveness of Irf8 to poly(I:C) has also been observed in the spleen of turbot [56] and Japanese flounder [53]. In turbot, Irf8 transcript expression was increased at 12HPI but not at 24HPI or 48HPI, while in flounder Irf8 transcript expression peaked at 3HPI. Thus, the timing of Irf8 induction may be species-specific, although differences in poly(I:C) dosage, fish age and/or size, and other factors must be considered. Atlantic cod Irf7 transcript expression has been shown to increase in response to poly(I:C) exposure at 6HPI and 24HPI [23], with a greater response at 16 C at the earlier time point and a greater response at 10 C at the later time point [22]. Irf7 has also been observed to be poly(I:C) responsive in the head kidney and gill of Japanese flounder [52], in rainbow trout cell lines [13], and in liver and head kidney of Atlantic salmon [57], although spleen expression was not studied in these species. The response to ASAL was not investigated in any of these species, although a different study in the orange-spotted grouper showed that Irf7 expression in spleen increased in response to injection with the bacterium Vibrio vulnificus [58]. In Atlantic cod, Irf7 transcript expression in the brain (based on microarray data) increases in response to injection with nervous necrosis virus, and QPCR analysis showed a similar response to poly(I:C) in cod cell lines [24]. In the current study, an increase in Irf7 transcript expression in response to ASAL injection (at 16 C for the 6HPI time point and at 10 C for the 24HPI time point) was observed, indicating that this gene (along with all other genes in this study except Irf4a) likely plays a role in the immune response to both viral and bacterial infections in this species. The temperature-dependent expression profile of Irf7 observed in response to ASAL injection is similar to that observed in response to poly(I:C) by Hori et al. [22] for Irf7 and several other immunerelevant cod transcripts (i.e. an earlier response at elevated temperature). Thus, the results of the current study build on those of Hori et al. [22,35] by showing that a moderate temperature increase also modulates the cod spleen transcript expression response of

379

multiple IRF genes (Irf7, Irf8 and both Irf10 splice variants) to bacterial antigens. Cod Irf10-v1 transcript was shown to be responsive to ASAL injection in the current study, although expression only increased (compared to the time- and temperature-matched PBS control) at 10 C, and only at the 24HPI time point (Fig. 10E). The response of Atlantic cod Irf10-v1 to poly(I:C) was investigated previously [22], where increases in transcript expression were observed at both time points and both temperatures. Interestingly, the second Atlantic cod Irf10 splice variant (Irf10-v2) showed different expression profiles as compared to Irf10-v1 in response to both poly(I:C) and ASAL. While the greatest response to poly(I:C) was observed at 24HPI and 10 C for Irf10-v1 (9-fold increase; [22]), the responses of Irf10-v2 at 6HPI were both greater (~8-fold increase at 10 C and ~11-fold at 16 C) than the response at 24HPI (4-fold increase at 10 C, with no response at 16 C, compared with timeand temperature-matched PBS controls; Fig. 9D). Increases in Irf10v2 expression were also observed in ASAL injected fish at both 6HPI and 24HPI at 10 C, and at 6HPI at 16 C. These results indicate that, while the two splice variants of this gene in Atlantic cod are responsive to both poly(I:C) and ASAL stimulation, there are notable differences in the timing and intensity of those responses. Along with the tissue distribution data above, this suggests that the two splice variants may have distinct roles in the immune response. Limited information on Irf10 in other species (i.e. only chicken [7], zebrafish [21] flounder [55]) is currently available, and therefore, it is unknown whether the presence of such splice variants is unique to Atlantic cod. The response of IRF transcript expression to immune stimulation has been investigated in several other teleost species as described above, although to our knowledge the effect of temperature on the teleost immune-relevant transcript expression response has been investigated very little outside our research group [22,35]. In rainbow trout, water temperature was seen to affect the expression of several cytokine transcripts in spleen tissue following injection with Yersinia ruckeri bacterin [59]. Although no IRFs were included in that study, IFN-g transcript expression response to bacterin was more rapid and pronounced in fish held at elevated temperature (25 C) compared with fish held at lower temperatures (5 and 15 C) [59]. A study involving the sevenband grouper Epinephelus septemfasciatus showed that expression of the interferon stimulated gene Mx in head kidney of poly(I:C) injected fish was highly upregulated earlier in fish held at higher temperatures (25 and 30 C compared to 15 and 20 C) [60]. Also, in a zebrafish study which looked at the effect of temperature on the larval response to poly(I:C) stimulation, transcript expression of several antiviral genes including Irf3 was higher in larvae raised at 28 C than at 15 C [61]. While these, along with the current study indicate that the transcriptional response to infection is modulated by temperature, and several studies have shown temperature to affect other measures of immune responsiveness in fish [34,35], further study in this area is required to fully understand how changing temperatures affect the health of wild and farmed fish populations. For future studies involving Atlantic cod, which exists over a wide temperature range (1.5 C to ~20 C) in nature, and can be exposed to significant daily temperature fluctuations in the wild [33] and in aquaculture sea cages [34], this knowledge will be of particular importance. 4.4. Conclusions The objectives of this research were to characterize multiple Atlantic cod IRF family members at the cDNA and putative amino acid levels, to determine the constitutive expression of those transcripts in several tissues, and to investigate the effects of viral

380


and bacterial antigen stimulation and temperature on transcript expression. Six Atlantic cod IRF transcripts were characterized, including a novel Irf10 splice variant, and the Irf10 genomic region was sequenced. RT-PCR analysis showed that all of these transcripts were expressed in the spleen and head kidney, and most were ubiquitously expressed in the tissues studied. QPCR analysis of spleen expression showed that all cod Irf transcripts were responsive to poly(I:C), and all except Irf4a were responsive to ASAL stimulation. The effect of increased temperature on cod immune gene expression that was previously observed (i.e. an earlier transcriptional response to immune stimulation [22,35]) was also seen in several cases. Together, the data suggest that these IRF family members play important roles in the response to viral and bacterial infections in Atlantic cod, as they have been shown to do in other species. Acknowledgements This study was supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and a Canada Research Chair to MLR. Cod spleen samples used in this study were obtained as part of the Atlantic Cod Genomics and Broodstock Development Project (CGP), which was funded by Genome Canada, Genome Atlantic, and the Atlantic Canada Opportunities Agency. In addition, the authors would like to thank Jennifer Hall for assistance with sequencing, and the Dr. Joe Brown Aquatic Research Building (JBARB) staff (Ocean Sciences Centre, Memorial University, NL), for assistance with fish husbandry.

[15] [16]

[17]

[18] [19]

[20]

[21]

[22]

[23]

[24]

[25]

Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.02.032. References [1] Barnes B, Lubyova B, Pitha PM. On the role of IRF in host defense. J Interferon Cytokine Res 2002;22:59e71. [2] Taniguchi T, Ogasawara K, Takaoka A, Tanaka N. IRF family of transcription factors as regulators of host defense. Annu Rev Immunol 2001;19:623e55. [3] Stein C, Caccamo M, Laird G, Leptin M. Conservation and divergence of gene families encoding components of innate immune response systems in zebrafish. Genome Biol 2007;8:R251. [4] Huang B, Qi Z, Xu Z, Nie P. Global characterization of interferon regulatory factor (IRF) genes in vertebrates: Glimpse of the diversification in evolution. BMC Immunol 2010;11:22. [5] Darnell JE, Kerr IM, Stark GR. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994;264:1415e21. [6] Mamane Y, Heylbroeck C, Genin P, Algarte M, Servant MJ, LePage C, et al. Interferon regulatory factors: the next generation. Gene 1999;237:1e14. [7] Nehyba J, Hrdlickova R, Burnside J, Bose HR. A novel interferon regulatory factor (IRF), IRF-10, has a unique role in immune defense and is induced by the v-Rel oncoprotein. Mol Cell Biol 2002;22:3942e57. [8] Nehyba J, Hrdlickova R, Bose HR. Dynamic evolution of immune system regulators: the history of the interferon regulatory factor family. Mol Biol Evol 2009;26:2539e50. [9] Honda K, Taniguchi T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol 2006;6: 644e58. [10] Ozato K, Tailor P, Kubota T. The interferon regulatory factor family in host defense: mechanism of action. J Biol Chem 2007;282:20065e9. [11] Savitsky D, Yanai H, Taniguchi T. Regulation of immunity and oncogenesis by the IRF transcription factor family. Cancer Immunol Immunother 2010;59: 489e510. [12] Sun BJ, Chang MX, Song Y, Yao WJ, Nie P. Gene structure and transcription of IRF-1 and IRF-7 in the mandarin fish Siniperca chuatsi. Vet Immunol Immunopathol 2007;116:26e36. [13] Holland JW, Bird S, Williamson B, Woudstra C, Mustafa A, Wang T, et al. Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus mykiss: functional analysis and transcriptional modulation. Mol Immunol 2008;46:269e85. [14] Holland JW, Karim A, Wang T, Alnabulsi A, Scott J, Collet B, et al. Molecular cloning and characterization of interferon regulatory factors 4 and 8 (IRF-4

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37] [38] [39]

and IRF-8) in rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol 2010;29:157e66. Bergan V, Kileng Ø, Sun B, Robertsen B. Regulation and function of interferon regulatory factors of Atlantic salmon. Mol Immunol 2010;47:2005e14. Bathige SDNK, Whang I, Umasuthan N, Lim BS, Park MA, Kim E, et al. Interferon regulatory factors 4 and 8 in rock bream, Oplegnathus fasciatus: structural and expressional evidence for their antimicrobial role in teleosts. Fish Shellfish Immunol 2012;33:857e71. Sabel JL, d'Alençon C, O'Brien EK, Otterloo EV, Lutz K, Cuykendall TN, et al. Maternal interferon regulatory factor 6 is required for the differentiation of primary superficial epithelia in Danio and Xenopus embryos. Dev Biol 2009;325:249e62. Li L, Jin H, Xu J, Shi Y, Wen Z. Irf8 regulates macrophage versus neutrophil fate during zebrafish primitive myelopoiesis. Blood 2011;117:1359e69. Ben J, Wang Jabs E, Chong SS. Genomic, cDNA and embryonic expression analysis of zebrafish IRF6, the gene mutated in the human oral clefting disorders Van der Woude and popliteal pterygium syndromes. Gene Expr Patterns 2005;5:629e38. Xiang Z, Dong C, Qi L, Chen W, Huang L, Li Z, et al. Characteristics of the interferon regulatory factor pairs zfIRF5/7 and their stimulation expression by ISKNV infection in zebrafish (Danio rerio). Dev Comp Immunol 2010;34: 1263e73. Li S, Lu L, Feng H, Wu N, Chen D, Zhang Y, et al. IFN regulatory factor 10 is a negative regulator of the IFN responses in fish. J Immunol 2014;193: 1100e9. Hori TS, Gamperl AK, Booman M, Nash GW, Rise ML. A moderate increase in ambient temperature modulates the Atlantic cod (Gadus morhua) spleen transcriptome response to intraperitoneal viral mimic injection. BMC Genomics 2012;13:431. Rise ML, Hall J, Rise M, Hori T, Gamperl AK, Kimball J, et al. Functional genomic analysis of the response of Atlantic cod (Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid (pIC). Dev Comp Immunol 2008;32:916e31. Krasnov A, Kileng O, Skugor S, Jorgensen SM, Afanasyev S, Timmerhaus G, et al. Genomic analysis of the host response to nervous necrosis virus in Atlantic cod (Gadus morhua) brain. Mol Immunol 2013;54:443e52. Feng CY, Johnson SC, Hori TS, Rise M, Hall JR, Gamperl AK. Identification and analysis of differentially expressed genes in immune tissues of Atlantic cod stimulated with formalin-killed, atypical Aeromonas salmonicida. Physiol Genomics 2009;37(3):149e63. Rise ML, Nash GW, Hall JR, Booman M, Hori TS, Trippel EA, et al. Variation in embryonic mortality and maternal transcript expression among Atlantic cod (Gadus morhua) broodstock: a functional genomics study. Mar Genomics 2014;18:3e20. Rise ML, Hall JR, Alcock BP, Hori TS. Dynamic expression profiles of virusresponsive and putative antimicrobial peptide-encoding transcripts during Atlantic cod (Gadus morhua) embryonic and early larval development. Gene 2012;509:232e46. Gabriele L, Ozato K. The role of the interferon regulatory (IRF) family in dendritic cell development and function. Cytokine Growth Factor Rev 2007;18:503e10. Bowman S, Hubert S, Higgins B, Stone C, Kimball J, Borza T, et al. An integrated approach to gene discovery and marker development in Atlantic cod (Gadus morhua). Mar Biotechnol 2011;13:242e55. Johansen SD, Coucheron DH, Andreassen M, Karlsen BO, Furmanek T, Jorgensen TE, Emblem A, Breines R, Nordeide JT, Moum T, Nederbragt AJ, Stenseth NC, Jakobsen KS. Large-scale sequence analysis of Atlantic cod. New Biotechnology 2009;25:263e71. Star B, Nederbragt AJ, Jentoft S, Grimholt U, Malmstrom M, Gregers TF, et al. The genome sequence of Atlantic cod reveals a unique immune system. Nature 2011;477:207e10. Solem ST, Stenvik J. Antibody repertoire development in teleosts e a review with emphasis on salmonids and Gadus morhua L. Dev Comp Immunol 2006;30:57e76. Righton DA, Andersen KH, Neat F, Thorsteinsson V, Steingrund P, Svedang H, et al. Thermal niche of Atlantic cod Gadus morhua: limits, tolerance and optima. Mar Ecol Prog Ser 2010;420:1e13. Perez-Casanova JC, Rise ML, Dixon B, Alfonso LOB, Hall JR, Johnson SC, et al. The immune and stress response of Atlantic cod to long-term increases in water temperature. Fish Shellfish Immunol 2008;24:600e9. Hori TS, Gamperl AK, Nash G, Booman M, Barat A, Rise ML. The impact of a moderate chronic temperature increase on spleen immune-relevant gene transcription depends on whether Atlantic cod (Gadus morhua) are stimulated with bacterial versus viral antigens. Genome 2013;56:567e76. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28: 2731e9. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29(9):e45. MacDonald CC, Redondo JL. Reexamining the polyadenylation signal: were we wrong about AAUAAA? Mol Cell Endocrinol 2002;190:1e8. Putnam NH, Butts T, Ferrier DEK, Furlong RF, Hellsten U, Kawashima T, et al. The amphioxus genome and the evolution of the chordate karyotype. Nature 2008;453:1064e71.

S.M. Inkpen et al. / Fish & Shellfish Immunology 44 (2015) 365e381 [40] Amores A, Force A, Yan Y, Joly L, Amemiya C, Fritz A, et al. Zebrafish hox clusters and vertebrate genome evolution. Science 1998;282:1711e4. [41] Allendorf FW, Thorgaard GH. Tetraploidy and the evolution of salmonid fishes. Pp. 1e53. In: Turner BJ, editor. Evolutionary genetics of fishes. New York, USA: Plenum Press; 1984. [42] Lee E, Jo M, Park J, Zhang W, Lee J. Alternative splicing variants of IRF-1 lacking exons 7, 8, and 9 in cervical cancer. Biochem Biophys Res Comm 2006;347: 882e8. [43] Li Y, Hu X, Song Y, Lu Z, Ning T, Cai H, et al. Identification of novel alternative splicing variants of interferon regulatory factor 3. Biochem Biophys Acta 2011;1809:166e75. [44] Graham RR, Kyogoku C, Sigurdsson S, Vlasova IA, Davies LRL, Baechler EC, et al. Three functional variants of IFN regulatory factor 5 (IRF5) define risk and protective haplotypes for human lupus. Proc Natl Acad Sci U S A 2007;104: 6758e63. [45] Zhang L, Pagano JS. IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency. Mol Cell Biol 1997;17:5748e57. [46] Ruangsri J, Salger SA, Caipang CMA, Kiron V, Fernandes JMO. Differential expression and biological activity of two piscidin paralogues and a novel splice variant in Atlantic cod (Gadus morhua L.). Fish Shellfish Immunol 2012;32:396e406. [47] Meraro D, Hashmueli S, Koren B, Azriel A, Oumard A, Kirchhoff S, et al. Protein-protein and DNA-protein interactions affect the activity of lymphoidspecific IFN regulatory factors. J Immunol 1999;163:6468e78. [48] Zapata AG, Chiba A, Varas A. Cells and tissues of the immune system of fish. pp. 1e40. In: Iwama G, Nakanishi T, editors. The fish immune system: organism, pathogen, and environment. San Diego, CA, USA: Academic Press, Inc; 1996. [49] Yao CL, Kong P, Huang XN, Wang ZY. Molecular cloning and expression of IRF1 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2010;28: 654e60. [50] Hu G, Xia J, Lou H, Chen X, Li J, Liu Q. An IRF-3 homolog that is up-regulated by DNA virus and poly I: C in turbot, Scophthalmus maximus. Fish Shellfish Immunol 2011;31:1224e31. [51] Hu G, Yin X, Lou H, Xia J, Dong X, Zhang J, et al. Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter. Dev Comp Immunol 2011;35:164e73. [52] Hu G, Yin X, Xia J, Dong X, Zhang J, Liu Q. Molecular cloning and characterization of interferon regulatory factor 7 (IRF-7) in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol 2010;29:963e71.

381

[53] Hu G, Chen X, Gong Q, Liu Q, Zhang S, Dong X. Structural and expression studies of interferon regulatory factor 8 in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol 2013;35:1016e24. [54] Tamura T, Tailor P, Yamaoka K, Kong HJ, Tsujimura H, O'Shea JJ, et al. IFN regulatory factor-4 and -8 govern dendritic cell subset development and their functional diversity. J Immunol 2005;174:2573e81. [55] Suzuki Y, Yasuike M, Kondo H, Aoki T, Hirono I. Molecular cloning and expression analysis of interferon regulatory 10 (IRF10) in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol 2011;30:67e76. [56] Chen X, Hu G, Dong X, Liu Q, Zhang S. Molecular cloning and expression analysis of interferon regulatory factor 8 (IRF8) in turbot, Scophthalmus maximus. Vet Immunol Immunopathol 2012;149:143e50. [57] Kileng O, Bergan V, Workenhe ST, Robertsen B. Structural and functional studies of an IRF-7-like gene from Atlantic salmon. Dev Comp Immunol 2009;33:18e27. [58] Cui H, Yan Y, Wei J, Huang X, Huang Y, Ouyang Z, et al. Identification and functional characterization of an interferon regulatory factor 7-like (IRF7-like) gene from orange-spotted grouper, Epinephelus coioides. Dev Comp Immunol 2011;35:672e84. [59] Raida MK, Buchmann K. Temperature-dependent expression of immunerelevant genes in rainbow trout following Yersinia ruckeri vaccination. Dis Aquat Org 2007;77:41e52. [60] Thanasaksiri K, Sakai N, Yamashita H, Hirono I. Influence of temperature on Mx gene expression profiles and the protection of sevenband grouper, Epinephelus septemfasciatus, against red-spotted grouper nervous necrosis virus (RGNNV) infection after poly (I: C) injection. Fish Shellfish Immunol 2014;40:441e5. [61] Dios S, Romero A, Chamorro R, Figueras A, Novoa B. Effect of the temperature during antiviral immune response ontogeny in teleosts. Fish Shellfish Immunol 2010;29:1019e27.

Web references [1] http://codgene.ca/; The Atlantic Cod Genomics and Broodstock Development Project (CGP). [2] https://www.ebi.ac.uk/Tools/msa/clustalo/; Web interface for Clustal Omega. [3] http://frodo.wi.mit.edu/; Web interface for Primer3. [4] http://www.ncbi.nlm.nih.gov/; National Center for Biotechnology Information web interface. [5] http://web.expasy.org/translate/; Web interface for ExPASy Translate tool.

Ontogeny of redox regulation in Atlantic cod (Gadus morhua) larvae.

Organization of the mitochondrial genome of Atlantic cod, Gadus morhua.

Effects of Loma morhua (Microsporidia) infection on the cardiorespiratory performance of Atlantic cod Gadus morhua (L).

Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

Correlations of age and growth rate with microbiota composition in Atlantic cod (Gadus morhua) larvae.

Life-history evolution and elevated natural mortality in a population of Atlantic cod (Gadus morhua).

Physiological and behavioural responses to noxious stimuli in the Atlantic cod (Gadus morhua).

Temperature and sex dependent effects on cardiac mitochondrial metabolism in Atlantic cod (Gadus morhua L.).

Heteroplasmy of short tandem repeats in mitochondrial DNA of Atlantic cod, Gadus morhua.

Highly localized divergence within supergenes in Atlantic cod (Gadus morhua) within the Gulf of Maine.

Egg buoyancy variability in local populations of Atlantic cod (Gadus morhua).

Alterations in the Atlantic cod (Gadus morhua) hepatic thiol-proteome after methylmercury exposure.

Spatial ecology of coastal Atlantic cod Gadus morhua associated with parasite load.

Temperature Modulates the Effects of Ocean Acidification on Intestinal Ion Transport in Atlantic Cod, Gadus morhua.

Adaptation to Low Salinity Promotes Genomic Divergence in Atlantic Cod (Gadus morhua L.).

Mitochondrial acclimation potential to ocean acidification and warming of Polar cod (Boreogadus saida) and Atlantic cod (Gadus morhua).

Climate warming causes life-history evolution in a model for Atlantic cod (Gadus morhua).

Transcriptome analysis of gill tissue of Atlantic cod Gadus morhua L. from the Baltic Sea.

Autonomic innervation of the ovary of the Atlantic cod,Gadus morhua.

Variation in embryonic mortality and maternal transcript expression among Atlantic cod (Gadus morhua) broodstock: a functional genomics study.

Identification of Atlantic cod (Gadus morhua), ling (Molva molva), and Alaska pollock (Gadus chalcogrammus) by PCR-ELISA using duplex PCR.

Differential Survival among Batches of Atlantic Cod (Gadus morhua L.) from Fertilisation through to Post-Metamorphosis.

Distinction among North Atlantic cod Gadus morhua stocks by tissue fatty acid profiles.

Quality changes during cod (Gadus morhua) desalting at different temperatures.