Eur. J. Biochem. 205, 303-309 (1992)

GIFEBS 1992

Characterization of a cis-acting regulatory element involved in human-aromatase P-450 gene expression Katsumi TODA', Kaoru MIYAHARA

I,

Takeshi KAWAMOTO', Hisao IKEDA', Yusuke SAGARA3 and , Yutaka SHIZUTA'

Departments of I Medical Chemistry, Neuropsychiatry, and Obstetrics and Gynecology Kochi Medical School, Japan (Received November 4/December 16, 1991) - EJB 91 1485

The characteristics of a cis-acting regulatory region involved in the human-aromatase P-450 gene have been examined by transient expression analysis. The region spans from - 242 - - 166 relative to the cap site of the gene. A fragment containing the region excised from the gene enhances heterologous promoter activity as well as its own promoter activity in a position-independent and orientation-independent manner. The fragment exerts its enhancer activity in human BeWo choriocarcinoma cells in which the aromatase P-450 gene is expressed, but not in other cell lines tested. Deletion of 38 bp from the 3' end of the fragment results in a complete loss of enhancer activity. A gel-retardation assay with nuclear extracts from BeWo cells suggests the existence of a nuclear factor(s) which interacts with the fragment. These results suggest that the regulatory element in the fragment is involved in efficient transcription of the human-aromatase P-450 gene.

Human aromatase P-450 is a product of the CYP 19 gene [I], a member of the cytochrome P-450gene superfamily [2]. It catalyzes the final step of the synthesis of various estrogens by reactions involving three sequencial hydroxylations of corresponding androgens [3, 41. The enzyme activity is detected not only in gonadal organs and tissues such as ovary, testis and placenta [5 - 71, but also in brain, liver and adipose tissues [8 - 101. The mechanism of aromatization, and chemical and biophysical characterization of the enzyme has been studied extensively using highly purified human placental aromatase P-450 [ll-171. Recently, several groups including ours reported on the isolation of a full-length cDNA clone encoding human aromatase P-450 together with its complete nucleotide sequence [18-211. It was also demonstrated that two major species of mRNA, as revealed by Northern blot analyses, were generated by alternative usage of poly(A) addition signals [20 - 221. More recently, the human-aromatase P-450 gene was isokated and shown to be organized with ten exons which span over more than 70 kb in the genome [22-241. The nucleotide sequence analysis of the 5'-flanking region of the gene revealed the existence of TATA and CAAT boxes locating between -28 and - 23, and between - 83 and -78 relative to the cap site, respectively. In addition, a palindromic nucleotide sequence and two types of repetitive hexanucleotide sequences together with two putative AP-1 binding sites were also noticed [24]. Transient expression studies with a series of 5'deletion mutants of the gene fused to the chloramphenicol acetyltransferase gene revealed that deletion of the 5' region .___-

Correspondence to Y . Shizuta, Department of Medical Chemistry, Kochi Medical School, Nankoku, Kochi, Japan 783 Enzymes. Aromalase P-450 (EC 1.14.14.1); 8-galactosidase (EC 3.2.1.23): chloramphenicol acetyltransferase (EC 2.3.1.28); DNA polymerase I (EC 2.7.7.7); exonuclease 111 (EC 3.1.1 1.2); restriction endonucleases BurnHI, Bg/lI, BstNI, EcoRI, Hind111 and SrnuI (EC 3.1.21.4).

from -500 - -243 gave a 20-fold increase in promoter activity, whereas further deletion to -182 resulted in a decrease in the activity nearly to the basal level [24]. This observation suggests the existence of negative and positive cis-acting regulatory regions locating between -500 and -243, and between - 242 and - 183, respectively. In the present study, we attempted to characterize the latter cis-acting regulatory region required for efficient transcription of the gene. In this paper, we present a line of evidence to show that the regulatory region acts as an enhancer and that a nuclear factor(s) exists, which specifically interacts with the cis-acting regulatory region.

MATERIALS AND METHODS Materials Human BeWo choriocarcinoma cells, human Flow 3000 embryonic brain fibroblasts, human KG-1 -C mixed glioma cells, human TYK-nu undifferentiated ovarian carcinoma cells and mouse Y-1 adrenal tumor cells were obtained from the Japanese Cancer Research Resources Bank. Restriction endonucleases and the Klenow fragment of DNA polymerase I were purchased from Takara Shuzo Co. Ltd. (Kyoto, Japan). [ L X - ~ ~ P I ~ was C T Ppurchased from the Amersham Corp. (Amersham, England) and ['4C]chloramphenicol was from NEN Research Products. The plasmid pCH110, which contains the bacterial lac2 gene under the transcriptional control of the simian-virus-40 early promoter [25],was obtained from Pharmacia LKB Biotechnology. All other chemicals were obtained commercially and of analytical grade. Construction of recombinant plasmids Two kinds of plasmid, 4-138/CAT and pAlocat2, were employed to monitor enhancer activity. The plasmid, 4-1381

304

.

A

-300

-YO0

0

.... 0

-100

.

+lo0

el00

+700

: : a a “

C

1

2

3 Fig. 1. Structure of the chimeric constructs and the effect of the 77-bp fragment on promoter activity of the aromatase P-450 gene. ( A ) The diagram shows the structure of the chimeric constructs used in these experiments. A-l38/CAT contains 138 bp of the 5’-flanking sequence and the first 76 bp of exon 1 of the human-aromatase P-450 gene (open box) into the Hind111 site of pSV00CAT (lane 1, A-I38/CAT).A single copy (lane 2, A-l38/CATESN) or two copies (lane 3, A-138/CATE25’N)of the 77-bp fragment extending from -242 - - 166 relative to the cap sitc. represented by the arrow, were inserted by blunt-end ligation into the SphI site of A-l38/CAT. The closed box with CAT indicates the hactcrial chloramphenicol acetyltransferasegene. The direction of the arrow shows the 5’40-3’ orientation of the fragment in the aromatase P-450 gene. The numbers above the diagram refer to nucleotide positions relative to the cap site of the aromatase P-450 gene taken as + 1 . The TATA box and the CAAT box beginning at -28 and -83 are indicated by vertical arrowheads, respectively. (B) The autoradiogram shows the results of chloramphenicol acetyltransferase assays using the constructs indicated in panel (A). Lane 1, A-l38/CAT; lane 2, 4-138) CATES‘N ;lane 3. d-138/CATE25’N.The number indicated on the top of each lane shows the relative value of chloramphenicolacetyltransferase activity expressed transiently in BeWo cells as compared with that of d-l38/CAT.

CAT, contains 138 bp of the 5’-flanking sequence and the first 76 bp of exon 1 of the human-aromatase P-450 gene located at the 5’ side of the chloramphenicol acetyltransferase gene [24]. The plasmid, pAIOcat2[26], is a derivative of pSV2-cat [27], in which the simian-virus-40 enhancer has been deleted but the basal promoter elements and 21-bp repeated sequences have been retained. A 77-bp fragment spanning from - 242 - - 166 relative to the cap site of the human-aromatase P-450 gene was excised from the construct, A-242/CAT [24], by digestion with Hind111 and BstNI. To link the fragment to the 5’ end of the promoter region in various copy-numbers and orientations, it was inserted by blunt-end ligation into the SphI site of d-l38/CAT or the BgBI site of pAlocatl. The fragment was also inserted into the 3‘ side of the chloramphenicol acetyltransferase gene using the BamHI site of pAlocatl. In order to obtain fragments deleted either from the 5’ end or from the 3’ end, the fragment was first inserted into the SmuI site of pUC119 plasmid. Then, two kinds of construct, in which the fragment was inserted in a different orientation, were selected. Deletion of the fragment using these constructs was carried out according to the method including exonuclease 111 digestion [28]. Each deleted fragment with an appropriate size was excised from the vector by EcoRIHind111 digestion and inserted into the BglII site of pAIocatl in various copy numbers and orientations by blunt-end ligation. The precise 5‘ and 3‘ endpoints of the deleted fragments were determined by nucleotide sequencing.

Cell culture, DNA transfections and chloramphenicol acetyltransferase assays BeWo choriocarcinoma cells were grown at 37-C in Ham’s F-12K medium supplemented with 15% fetal bovine serum. Flow 3000 embryonic brain fibroblasts and TYK-nu ovarian carcinoma cells were cultured in Eagle’s minimum essential medium supplemented with 10% fetal bovine serum. HeLa epitheloid carcinoma cells and KG-1-C mixed glioma cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% and 20% each of fetal bovine serum, respectively. Y-1 adrenal tumor cells were grown in Ham’s F12 medium supplemented with 15% fetal bovine serum. The cells were plated 24 h before D N A transfection at a density of 1 x lo6 cells per 90-mm dish. D N A transfection was carried out by the calcium-phosphate coprecipitation method [29] using a total of 20 pg D N A mixture consisting of 5 pg of the recombinant plasmid containing the bacterial chloramphenicol acetyltransferase gene, 5 pg pCHl10 serving as an internal standard and 30 pg pUC118 as a carrier plasmid. The cell lysates prepared 48 h after DNA transfection were assayed for /I-galactosidase activity according to the method of Foster et al. [30]. A portion of the cell lysate containing the equivalent amount of P-galactosidase activity in each cell line was used for measurement of chloramphenicol acetyltransferase activity according to the method of Gorman et al. [27]. Chloramphenicol acetyltransferase activity was quantitated

305

A

1

2

PA 10 c a t 2 E Y 5 ’N

.............. ..................... ._._..........a

C A 1

3 4

pAlocat1E23’N

5

pAlo c a t 1 E Y3’R

--

I-

Fig. 2. Structure of the chimeric constructs and the effect of the 77-bp fragment on the activity of the heterologous promoter. (A) The diagram shows the structure of the chimeric constructs uscd in these experiments. The vector, pAl ocat2, in which the bacterial chloramphenicol acetyltransferasc gene is under the control of the basal core promoter of the simian-virus-40early gene as indicated by stippled box, was cmployed (lane 1. pAlocat2). Two copies of the 77-bp fragmcnt werc inserted into thc 5’ end of thc promoter sequence in the normal (lane 2, pA1ocatZE25’N)or reverse orientation (lane 3, pAlocatzE,5’R) relative to the chloramphenicol acetyltransferase gene. The fragments wcre also inserted into the 3’ sidc of the chloramphenicol acetyllransferase gene in the normal (lane 4, pA locatZE23’N)or reverse orientation (lane 5 , pAlocatzEz3’R).The numbers above the diagram refer to nucleotide position relative to the cap site of the simian-virus-40early gene takcn as + 1. The TATA box and a cluster of the GC boxes in the promoter sequence are indicated by vertical arrowheads. (B) The autoradiogram shows thc results of chloramphenicol acetyltransferase assays using the constructs presented in panel (A). Lane 1, pAIocatz;lane 2, pAlocatzEz5’N;lane 3, pAlocat2E25’R;lane 4, pAlocat2E23’N;lane 5 , pAlocat2E,3’R. The number indicated on the top of each lane shows the relative value o f chloramphenicol acetyltransferase activity as compared with that of pAlocat2.

by scanning the silica gel thin-layer-chromatography plates using a chromatoscanner (Aloka). Extraction of total cellular RNA and Northern blot analysis

Total cellular RNA was extracted from BeWo cells, Flow 3000 cells, HeLa cells, KG-1-C cells, TYK-nu cells and Y-1 cells according to thc method of Chomczynski and Sacchi [31]. Analyses of RNA by Northern-blot hybridization were performcd as described by Sambrook et al. [28]. Preparation of nuclear extracts and gel-retardation assays

Nuclear extracts of BeWo cells, HeLa cells, TYK-nu cells and Y-1 cells were prepared according to the method of Dignam et al. [32]. Binding reactions were performed a t 25°C for 20 min in a final volume of 10 pl containing 20 mM Hepes (pH 7.9), 60 mM KC1,O.l m M EDTA, 0.5 m M dithiothreitol, 3 mM MgC12, 10% (by mass) glycerol, 0.1 mg/ml 2[poly(dI) ’ poly(dC)], 125 pg (3000 cpm) of the 32P-labeled 77-bp fragment and the indicated amounts of the nuclear extracts. The mixture was separated by electrophoresis on a 5% polyacrylamide gel using the Tris/glycine buffer system [33]. After electrophoresis, the gel was transfcrred to Whatman 3MM paper, dried and autoradiographed. For competition experiments, all experimental conditions cmployed were the same as those described above except that appropriate amounts of the unlabelled 77-bp fragment or the 90-bp fragment excised from pUCl18 by Pi~uII-EcoRIdigestion were included in the reaction mixture as specific and non-specific competitor DNA, respectively.

RESULTS AND DISCUSSION Detection of enhancer activity in the S’danking region of the aromatase P-450 gene The results of our previous studies using a series of 5’-deletion mutants in the promoter region of the humanaromatase P-450 gene suggested that the region between - 242 a n d - 183 relative to the cap site is required for efficient transcription of the gene [24]. In this study, we prepared the genomic fragment extending from - 242 - - 166 relative to the cap site and examined, by means of the transient-expression assay, whether o r not this fragment includes any cisacting enhancer-like element. As shown in Fig. 1, the chimeric construct, A-138/ CATES’N, which contains a single copy of the fragment in the plasmid A-1 38/CAT [24], expresses chloramphenicol acetyltransferase activity four times greater than that of the plasmid, A-l38/CAT in BeWo cells. When the chimeric construct containing two copies of the fragment (A-138/CAT E25’N) was transfected into BeWo cells, a n increase in enhancement became more marked, i.e. 18-fold. These results indicate that the fragment contains a cis-acting element(s) which enhances its own promoter activity. I n the next experiment, we examined whether the fragment enhances the activity of a heterologous promoter. For this purpose, we employed the plasmid, pAlocatz as a test vector, which contains the chloramphenicol acetyltransferase gene under the control of the enhancerless simian-virus40 early promoter [26]. When two copies of the fragment were inserted, promoter activity was enhanced significantly in BeWo cells in an orientation-independent manner as shown in Fig. 2; a sixfold enhancement in the normal orientation relative to

306 Table 1. Enhancer activity of the 77-bp fragment in six different lines of cultured cells. The pAlocat2alone or pAIocatzcontaining eight copies of the 77-bp fragment linked to the 5’ end of the promoter sequence was transfected into six different lines of cultured cells. Chloramphenicol acetyltransferase activities of pA locatz and pAlocatZ with the fragments were expressed as the percentage of

50

chloramphenicolconverted to its acetylated derivatives. Enhancement of promoter activity by the fragment in each cell line is expressed as relative fold enhancement of chloramphenicol acetyltransferase activity as compared with that of pAlocatz. Each value is corrected by determining the 8-galactosidase activity as described in Materials and Methods. Experiments were repeated more than two times for each cell line and the average values were presented.

40 .w

C Q)

E

P,

Cell line

30 (0

r

Conversion pAIOcatz

C

W

a

-0

Enhancement PA

+ (fragment)8 -fold

%

2c

BeWo Flow3000 HeLa KG-1-C TYK-nu

L

1(

Y-1

0

I

I

I

I

I

I

I

I

1

2

3

4

5

6

7

8

Copy Number Fig. 3. Effect of the multimerizationof the 77-bpfragment on the activity of the heterologous promoter. A single, two, three, four or eight copies of the 77-bp fragment were inserted into the 5’ end of the promoter sequence ofpAlocat2,and they were transfected into BeWo cells. The effect of the multimerization of the fragment on promoter activity is

expressed as relative fold enhancement of chloramphenicol acetyltransferase activity as compared with that of pAIocatz.

the chloramphenicol acetyltransferase gene (pAlocat2E,5’N) and a sevenfold enhancement in the reverse orientation (pAlocat2E25’R).The enhancement by two copies of the fragment was also observed in an orientation-independent manner even when they were inserted into the 3‘ side of the chloramphenicol acetyltransferase gene; a 5.8-fold enhancement in the normal orientation (pAIocat2E23’N)and a 6.1-fold enhancement in the reverse orientation (pAlocat2E23’R). As presented in Fig. 3, the enhancement of promoter activity by the fragment is dependent on copy numbers and the effect is cooperative rather than additive as reported for other enhancer elements [34 - 391. These results indicate that the region between -242 and - 166 relative to the cap site actually contains a cis-acting enhancer element(s), which results in a n increase in heterologous promoter activity as well as its own promoter activity in a manner dependent on copy numbers but independent of position and orientation. Cell-type specificity of enhancer activity

We then examined whether the fragment functions in all kinds of cells or whether it works only in certain specific cells. For this purpose, the chimeric construct containing eight

0.69

18.4 0.66

0.77

0.87

11.7 2.89 3.9

9.92 3.45 3.48

0.45

46.0 0.96 1.12 0.85

0.74 0.97

copies of the fragment in the vector, pAlocat2,was transfected into six different lines of cultured cells and chloramphenicol acetyltransferase activity transiently expressed was determined. As shown in Table 1, enhancement of chloramphenicol acetyltransferase activity is observed only in human choriocarcinoma cells (BeWo) and not in other cell lines tested, including human embryonic brain fibroblasts (Flow 3000), human epitheloid carcinoma cells (HeLa), human mixed glioma cells (KG-1-C), human ovarian carcinoma cells (TYKnu) and mouse adrenal tumor cells (Y-1). Northern-blot analyses using total cellular RNA prepared from these six lines of cells reveal that the aromatase P-450 gene is expressed only in BeWo cells and not in the others tested (Fig. 4). These results, taken together, indicate that the fragment may function as a n enhancer only in the specific cells where the aromatase P-450 gene is expressed.

Localization of the nucleotide sequence essential for enhancer activity

In order to localize the nucleotide sequence required for enhancer activity, we deleted the fragment either from the 5’ end or the 3‘ end and examined enhancer activities of the deleted fragments by transient expression analysis. Fig. 5 summarizes the results of these experiments. Deletion from the 3’ end of the fragment to - 174 resulted in augmentation of enhancer activity up to three-times greater than the original activity. Enhancer activity was still retained when the fragment was deleted up to - 185. It was completely lost, however, when deletion was proceeded to -203. However, deletion from the 5’ end of the fragment up to -239 resulted in a marked reduction of enhancer activity. Further deletion led to a complete disappearance of the enhancement, even if the deleted fragments were tandemly ligated more than three copies. It is therefore concluded that the 57-bp region between -242 and -186 relative to the cap site is responsible for exhibiting enhancer activity. In the nucleotide sequence of the 57-bp region, there is no consensus sequence of the enhancer

307

Fig. 4. Expression of the aromatase P-450gene in six different cell lines. Total cellular RNA was prepared from about 1 x lo7 cells of each cell line as described in Materials and Methods. 8 pg of each of the RNA was size-fractionated on a 1YOagarose gel containing 1.9% formaldehyde according to the method of Sambrook et al. [28]. After electrophoresis, the RNA was transferred to a nylon membrane filter, fixed and hybridized with 32P-labeledhuman-aromatase P-450cDNA. The same blot was rehybridized with a 32P-labeled human p-actin probe to make sure that nearly the same amounts of RNA were loaded. Cell lines analyzed are indicated above each lane. The positions of mRNA of aromatase P-450and j-actin are indicated by arrows. -2?0

-z?o

-2?O

-210

-200

-390

-180

-l!O

Fold Number Enhancement

COPY TCCACCCAAGGCGGGACTCTATAATCTGATTGTGGGTCATAA~ACCCTCATT~CAGAGGAGG~CATGCCCCATACCC [-242--166]

3

25

-1 7 51

3

75.8

[-242-1 861

3 3

13.4

[-242- -2043 [-242--215]

4

1.2

[-242-

1.o

3

2.2 [-218--166] 4 1.2 [-212--166] 5 1.3 Fig. 5. Enhancer activity of the deleted fragment in BeWo cells. The nucleotide sequence of the 77-bp fragment is shown at the top of this figure. The fragment was deleted either from the 5’ end or from the 3’ end and 3 - 5 copies of each deleted fragment were inserted into the 5’ end of the promoter sequence of pAIocat2. Horizontal bars refer to the regions inserted into the vector. The 5’ and 3‘ endpoints of each fragment are shown at the left side of the bar in brackets. Copy numbers of each fragment inserted into the vector are indicated at the right side of the bars. Enhancer activity of each fragment is expressed as relative fold enhancement of chloramphenicol acetyltransferase activity as compared with that of pAIocatz and presented in the right-hand column of this figure. [-238--1S6]

element so far reported [40] except for the existence of a pahdromic motif between - 209 and - 196 (5’-GGGTCATAAGACCC-3’), which is similar to the sequence recognized by the steroid hormone receptor [40]. Binding of a nuclear factor($) to the fragment containing enhancer activity The fact that the fragment acts as an enhancer in a celltype specific manner suggests that a nuclear factor(s) produced in BeWo cells interact with the enhancer element(s). Accordingly, we analyzed the binding of a protein factor(s) in the nuclear extracts of BeWo cells to the fragment by gel-retardation assay. As shown in Fig. 6A, the j’P-labeled 77-bp fragment generates a retarded band on the gel by incubation with the extracts (lanes 1 and 2). This indicates that a nuclear factor(s) produced in BeWo cells forms a complex with the

DNA fragment. The complex formed is derived from sequence-specific DNA protein interaction, since the addition of excess amounts of the unlabeled specific DNA fragment abolishes the retardation (lanes 5 and 6) and yet the nonspecific DNA fragment does not (lanes 3 and 4). These facts indicate that the nuclear extract of BeWo cells contains a protein factor(s) which specifically interacts with the cis-acting enhancer element(s) of the aromatase P-450 gene. In order to examine whether the factor(s) is present ubiquitously or if it is specifically expressed in BeWo cells, we prepared nuclear extracts from HeLa cells, TYK-nu cells and Y-I cells, and performed gel-retardation assays. As shown in Fig. 6 B, the DNA protein complex as observed with the nuclear extracts of BeWo cells (lane 1) is not detected by the incubation with any of the extracts from other cells (lanes 2-4), although faint bands of DNA protein complexes with different mobility are observed. Therefore, the factor(s) which forms the com-

308 REFERENCES 1. Nebert, D. W., Nelson, D. R., Adesnik, M., Coon, M. J., Esrook. R. W., Gonzalez, F. J., Guengerich, F. P., Gunsalus, I. C., Johnson, E. F., Kemper, B., Levin, W., Phillips, I. R., Sato, R. & Waterman, M. R. (1989) D N A 8, 1 - 13.

Fig. 6. Binding of nuclear factor(s) to the 77-bp fragment. (A) The 32Plabeled 77-bp fragment was incubated without nuclear extracts from BeWo cells (lane I), or it was incubated with 6.25 pg nuclear extract in the absence ofcompetitor DNA (lane 2) or in the presence of either a 25-fold molar excess of non-specific competitor DNA (lane 3), a 50fold molar excess of non-specific competitor DNA (lane 4), a 25-fold molar excess of specific competitor DNA (lane 5), or a 50-fold molar excess of specific competitor DNA (lane 6). It was then separated by electrophoresis and visualized by autoradiography as described in Materials and Methods. The positions of the DNA protein complex formed and free probe arc indicated by the arrow and arrowhead, respectively. (B) Thc 32P-labeled77-bp fragmcnt was incubated with 1.51 pg nuclear cxtract prepared from four different cell lines. They were then separated by electrophoresis and visualized as described in Materials and Methods. Lane 1 , incubation with the nuclear extracts of BeWo cells; lanc 2, incubation with the nuclear extracts of HeLa cells; lane 3, incubation with the nuclear extracts of TYK-nu cells; lane 4, incubation with the nuclear extracts of Y-1 cells. The position of the free probe is indicated with an arrowhead.

plex with the 77-bp fragment seems to be preferentially expressed in BeWo cells. Nevertheless, neither DNase I footprinting nor methylation-interference analysis gave any clear result to define the nucleotide sequence responsible for binding of the nuclear factor(s) of BeWo cells (data not shown). The reason(s) for this observation is not clear at the moment, but this might reflect that the binding of the nuclear factor(s) to the element is not tight enough as is the case recently reported by lnoue et al., for the CAMPresponsive element of the human cytochrome P-450,,,gene [41]. Further study is required to clarify this point and it will open the way to isolate and characterize a trans-acting factor(s) which regulates enhanced transcription of the human aromatase P-450 gene in a celltype specific manner. We arc grateful to Isao Kuribayashi for technical assistance and to Michiho Geshi for secretarial assistance. We thank Dr. Kozo Makino a t the Research Institute for Microbial Diseases, Osaka University for providing us with thc human p-actin probe. This work was supported in part by research grants from Uehara Memorial Foundation, Inamori Foundation, Toray Science Foundation, Special Education and Research Fund of Kochi Medical School, and by Grants-in-Aid for Science and Cancer Research from the Ministry of Education. Science and Culture of Japan.

2. Nebcrt, D. W. & Gonzalez, F. J. (1987) Annu. Rev. Biochem. 56, 945-993. 3. Thompson, E. A. Jr. & Siiteri, P. K. (1974) J . Biol. Chem. 24Y, 5373 - 5378. 4. Fishman, J. & Goto, J. (1981) J . B i d . Chem. 256,4466-4471. 5. Jungmann, R. A,, Kot, E. & Schwcppe, J. S. (1966) Steroid 8, 977 - 992. 6. Ryan, K. J. & Petro, Z. (1966) J . Clin. Endocrinol. Metah. 26. 46 - 52. 7. Tsai-Morris, C. H., Aquilano, D. R. & Dufau, M. L. (1984) Ann. N Y Acad. Sci. 438,666 - 669. 8. Rayan, K . J., Naftolin, F., Reddy, V., Flores, F. & Petro, Z. (1972) Am. J . Obstet. Gynecol. 14,454-460. 9. Smuk, M. & Schwers, J. (1977) J . C’lin. Lndocrinol. Metah. 45, 1009-1012. 10. Longcope, C., Pratt, J. H., Schncider, S. H. & Finebcrg. S. E. (1978) J . Clin. Endocrinol. Metah. 46, 146- 1 5 1 . 11. Mendelson, C. R., Wright, E. E., Evans, C. T., Portcr, J. C. & Simpson, E. R. (1985) Arch. Biochem. Biophyr. 243, 480491. 12. Tan, L. & Muto, N. (1986) Eur. J . Biochem. 156,243-250. 13. Nakajin, S., Shinoda, M. & Hall, P. F. (1986) Biochrm. Binphy. Res. Commun. 134,704-110. 14. Hagerman, D. D. (1987) J . Biol. Chem. 262,2398-2400. 15. Kellis, J. T. & Vickery, L. E. (1987) J . Biol. Chem. 262, 44134420. 16. Harada, N. (1988) J . Biochem. 103, 106-113. 17. Yoshida, N. & Osawa, Y. (1991) Biochemistrj 30, 3003-3010. 18. Corbin, C. J., Graham-Lorence, S., McPhaul, M., Mendclson, C. R. & Simpson, E. R. (1988) Proc. Nut1 Acud. Sci. U S A 85, 8948 - 8952. 19. Harada, N . (1988) Biochem. Biophys. Res. Commun. 156, 725732. 20. Toda, K., Terashima, M., Mitsuuchi, Y., Yamasaki, Y., Yokoyama, Y., Nojima, S., Ushiro, H., Maeda, T., Yamamoto. Y., Sagara, Y. & Shizuta, Y. (1989) FEBS Lett. 247, 371376. 21. Pompon, D., Liu, R. Y.-K., Bcsman, M. J., Wang, P.-L., Shively, J. E. & Chen, S. (1989) Mol. Endocrinol. 3, 1477- 1487. 22. Means, G. D., Mahendroo, M. S., Corbin, C. J., Mathis: J. M.. Powell, F. E., Mendelson, C. R. & Simpson, E. R. (1989) J . Biol. Chem. 264,19385-19391. 23. Harada, N., Yamada, K., Saito, K., Kibe, N., Dohmae, S. & Takagi, Y.(1990) Biochem. Biophys. Res. Commun. 166, 365 372. 24. Toda, K., Terashima, M., Kawamoto, T., Sumimoto, H., Yokoyama, Y., Kuribayashi, I., Mitsuuchi, Y., Macda. T.. Yamamoto, Y., Sagara, Y., Ikcda, H. &Shizuta, Y. (1990) Eur. J . Biochem. 193, 559 - 565. 25. Hall, C. V., Jacob, P. E., Ringold, G. M. & Lce, F. (1983) J . Mol. Appl. Genet. 2, 101- 109. 26. Laimins, L. A., Gruss, P., Pozzatti, R. & Khoury, G . (1984) J . Virof.49, 183- 189. 27. Gorman, C. M., Moffat. L. F. &Howard. B. H . (1982) M o l . Cell. Biol. 2, 1044-1051. 28. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a luhoratory manual, 2nd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 29. Graham, F. L. & van der Eb, A. J. (1973) Virology 52, 456-467. 30. Foster, R., Jahround, N., Varshney, U. & Gcdamu, L.(IY88) J . Biol. Chem. 263,11528 - 11 535. 31. Chomczynski, P. & Sacchi, N . (1987) Anal. Biochem. 162. 156159. 32. Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983) Nucleic Acid Res. 11, 1475-1489. 33. Staudt, L. M., Singh, H., Sen, R., Wirth, T., Sharp, P. A . & Baltimore, D. (1986) Nuture 323, 640-643.

309 34. Schirm, S., Jiricny, J. & Schaffner, W. (1987) Genes Dev. I , 6574. 35. Picrce, J. W., Lenardo, M. & Baltimore, D. (1988) Proc. N u t / Acad. Sci. USA 85,1482- 1486. 36. Goto, K., Okada, T. S. & Kondoh, H. (1990) Mol. Cell. Biol. 10, 958 -964. 37. Frain, M., Hardon, E., Ciliberto, G. & Sala-Trepat, J. M. (1990) Mol. Ck~ll.Biol. 10, 991 -999.

38. Hwung, Y.-P., Gu, Y.-Z. & Tsai, M.-J. (1990) Mol. Cell. Biol. 10, 1784- 1788. 39. Nishizawa, M. & Nagata, S. (1990) Mu/. CeN. Bid. 10, 20022011. 40. Locker, J. & Buzard, G. (1990) Sequence-J. DNA Mupping u i d Sequencing, I , 3 - 11. 41. Inouc, H., Watandbe, N., Higashi, Y . & Fujii-Kuriyarna, Y . (1991) Eur. J . Biochem. 195, 563-569.