Vol. 174, No. 12

JOURNAL OF BACTERIOLOGY, June 1992, p. 4157-4165

0021-9193/92/124157-09$02.00/0 Copyright © 1992, American Society for Microbiology

Characterization of a Major Polymorphic Tandem Repeat in Mycobacterium tuberculosis and Its Potential Use in the Epidemiology of Mycobacterium kansasii and Mycobacterium gordonae PETER W. M. HERMANS,* DICK VAN SOOLINGEN, AND JAN D. A. VAN EMBDEN National Institute of Public Health and Environmental Protection, P. O. Box 1, 3720 BA Bilthoven, The Netherlands Received 26 November 1991/Accepted 11 April 1992

In this study, the occurrence of repeated DNA sequences in the chromosome of Mycobacterium tuberculosis was investigated systematically. By screening a M. tuberculosis lambda gt-11 gene library with labeled total chromosomal DNA, five strongly hybridizing recombinants were selected, and these contained DNA sequences that were present in multiple copies in the chromosome of M. tuberculosis. These recombinants all contained repeated sequences belonging to a single family of repetitive DNA, which shares homology with a previously described repeated sequence present in recombinant pPH7301. Sequence analysis of pPH7301 showed the presence of a 10-bp sequence that was tandemly repeated and invariably separated by 5-bp unique spacer sequences. Southern blot analysis revealed that the majority of the repeated DNA in M. tuberculosis is composed of this family of repetitive DNA. Because the 10-bp repeats are slightly heterogeneous in sequence, we designated this DNA as a major polymorphic tandem repeat, MPTR. The presence of this repeated sequence in various other mycobacterial species was investigated. Among the MPTR-containing mycobacterial species the chromosomal location of the repetitive DNA is highly variable. The potential use of this polymorphism in the epidemiology of mycobacterioses is discussed.

Reiterations of DNA sequences have been found to occur in the chromosomes of a wide variety of bacteria. Repeated DNA sequences include genes such as those encoding the 16S and 23S rRNA (5, 18, 36), insertion sequence elements (20, 25), and short repetitive DNA such as the crossover hot spot instigator (chi) sequence (32) and repetitive extragenic palindromic (REP) sequences (35). Repetitive DNA sequences have also been found in mycobacteria. The insertion elements IS900 from Mycobacterium paratuberculosis (4, 12), IS901 from Mycobacterium avium (19), IS1096 from Mycobacterium smegmatis (2), IS1081 from Mycobacterium bovis, and the IS3 family of insertion elements present in the species of the Mycobacterium tuberculosis complex (15, 22, 37) are present in multiple copies in the mycobacterial chromosome (16, 40). Additionally, unidentified repeated sequences, or repeats which do not share characteristics with other sequences, have been found in Mycobacterium leprae (3, 13, 43) and M. tubercu-

losis (6, 14, 15, 27). The mycobacterial repeated DNA sequences described

above were selected from gene libraries on the basis of their

species specificity or differences in hybridization to particular DNA probes. However, no systematic study has been done on the major classes of repetitive DNA in mycobac-

teria. In this study, we investigated systematically the occurrence of repetitive DNA in M. tuberculosis. We show that a major repetitive DNA in this species belongs to a family consisting of short tandemly repeated sequences of 10 bp, separated by 5-bp spacer DNA. Furthermore, we analyzed the presence of this DNA family in other mycobacterial species and the potential use of this repetitive DNA for *

Corresponding author.

subtyping of mycobacterial strains and the epidemiology of mycobacterioses.

MATERUILS AND METHODS Bacterial strains, plasmids, and culture conditions. The bacterial strains and plasmids used in this study are listed in Table 1. Plasmid pPH7301 is a pEX2 recombinant contaiqlrng a 2.4-kb DNA fragment of M. tuberculosis (14). Media, reagents, and enzymes were used as described by Thole et al. (38). The culturing of mycobacterial strains and the isolation of genomic DNA were performed as reported previously (40). DNA techniques. The M. tuberculosis lambda gt-11 gene library from R. A. Young was screened as described by Young et al. (45). Plaques were transferred to Colony/Plaque Screen Membranes (Dupont, Boston, Mass.) as described by Noordhoek et al. (24). Southern blot hybridization procedures (33) were performed as described previously (16). DNA was radioactively labeled with [ot-32P]dCTP by using the multiprime DNA labeling kit (Amersham International plc, Amersham, United Kingdom). DNA was nonradioactively labeled with horseradish peroxidase by using the enhanced chemiluminescence gene detection system (Amersham). The 181-bp probe TR1 was prepared by polymerase chain reaction (PCR) (14, 28) by using the amplimers I (5'CGCCGGTGCCGACGTTGCCC) and F (5'CTCT'TCAA TGCCGGCAGCTT) and recombinant pPH7301 as target DNA (see Fig. 3). TR2, which is a trimer of the 10-bp repeated sequence (5'GCCGGTGTTG), was prepared by chemical synthesis (Applied Biosystems, Inc., Foster City, Calif.). Chromosomal DNA from M. tuberculosis 19 and M. bovis BCG strain 43 was sheared by passaging the DNA 25 times 4157

4158

HERMANS ET AL.

J. BACTERIOL.

TABLE 1. Mycobacterial strains used in this study Bacterial strain(s)

Species

10, 14-16, 19, 23, 97, 122, 164, 165 38, 166, 167 41, 168-171 44 102 43, 45, 105, 106, 172 253 158, 239 254 48, 50, 51, 178 255, 256 162 257 156, 238 60 173, 174 258 203-208 223-234, 351-359 56, 161 53, 160, 179-187, 189-200, 202 360-368 242-248 240 259 249 260 261 262 64, 65, 155, 241 175-177 163 263 250 251 264 252

M. tuberculosis M. africanum M. bovis M. bovis BCG M. bovis BCG M. bovis BCG M. aichiense M. asiaticum M. aurum M. avium M. chelonei M. chitae M. diernhoferi M. flavescens M. fortuitum M. gastri M. gilvum M. gordonae M. gordonae M. intracellulare M. kansasii M. kansasii M. malmoense M. marinum M. neoaurum M. nonchromogenicum M. parafortuitum M. perigrinum M. phlei M. scrofulaceum M. szulgai M. terrae M. thermoresistibile M. triviale M. ulcerans M. vaccae M. xenopi

Property or origin

Clinical isolates Clinical isolates Clinical isolates Vaccine strain Vaccine strain Clinical isolates

208: ATCC 19277b

180: ATCC 25221b Clinical isolates

Source or reference

This laboratory This laboratory This laboratory This laboratory Organon Teknikaa This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory F. Portaelsc This laboratory This labortory F. Portaels This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory This laboratory

a Organon Teknika N.V., Veedijk 58-2300, Turnhout, Belgium. b American Type Culture Collection, Rockville, Md. c Prince Leopold Institute of Tropical Medicine, Antwerp, Belgium.

through a 26-gauge needle and used as a DNA probe. The average size of the sheared DNA was 10 kb. DNA sequencing was performed by using the chaintermination method (29). The DNA sequencing was initiated by the pEX vector primers 86.25 (5'GACTCCTGGAGCC CG) and 17.5.88 (5'AAGCTTGGCTGCAGGTC). The search for DNA homology (26) within the pPH7301 sequence and homology of pPH7301 with published sequences were investigated by using the DNA program PC/Gene release 6.5 (IntelliGenetics Inc., Mountain View, Calif.) and the EMBL nucleotide sequence library 26 v.1, respectively. Peptide synthesis and ELISA. The peptides rpl, rp2, and rp3 (see Fig. 4) were prepared by the peptide synthesis method described by Geysen et al. (11) by using the Epitope Scanning Kit (Cambridge Research Biochemicals, Cambridge, United Kingdom). The peptides were analyzed by enzyme-linked immunosorbent assay (ELISA) by using monoclonal antibody (MAb) F116-5, which recognizes a 24and a 30-kDa protein of M. tuberculosis (41). The synthesis and ELISA of the peptides were performed as recommended by the manufacturer. Nucleotide sequence accession numbers. The sequence data for the two sequences of pPH7301 are entered in the EMBL,

GenBank, and DDBJ nucleotide sequence data bases under accession numbers X60430 and X60431. RESULTS Systematic investigation of the presence of repetitive DNA in M. tuberculosis. In order to investigate systematically the occurrence of repetitive DNA in the chromosome of M. tuberculosis, fractionated BstEII-digested M. tuberculosis DNA fragments were hybridized with labeled total chromosomal DNA of M. tuberculosis. We assumed that fragments containing repetitive DNA would hybridize significantly stronger compared with those fragments containing merely single copy sequences. As shown in Fig. la, a limited number of BstEII fragments hybridized with labeled chromosomal M. tuberculosis DNA, suggesting that these fragments contain DNA which is present in multiple copies in the M. tuberculosis chromosome. Similar results were obtained with chromosomal DNA from M. bovis BCG (Fig. lb). In a previous study we showed that pPH7301 contains repetitive mycobacterial DNA, because the insert of pPH7301 hybridizes with multiple chromosomal restriction fragments of M. tuberculosis (14). In order to investigate whether these strongly hybridizing BstEII fragments contain

i.0

CHARACTERIZATION OF MPTR IN M. TUBERCULOSIS

VOL. 174, 1992 b

1

1

4

3

2

23.1 9.4 6.6 -

2

in recombinant pPH7301 is a major repetitive DNA present in the chromosome of M. tuberculosis. To obtain insight in the frequency of occurrence and the distribution of repetitive DNA in the mycobacterial genome, a lambda gt-11 M. tuberculosis gene library was screened with 32P-labeled chromosomal M. tuberculosis DNA as a probe. About 10% of the mycobacterial DNA-containing phage strongly hybridized with the labeled M. tuberculosis DNA. Five strongly hybridizing phage recombinants were selected, and the DNAs of these clones were used as probes to hybridize to fractionated BstEII-digested chromosomal M. tuberculosis DNA. All phage DNA probes hybridized with multiple BstEII fragments of M. tuberculosis, and the majority of the hybridizing BstEII fragments corresponded in size to the fragments which appeared after hybridization with the insert of pPH7301 (Fig. 2), strengthening the idea that this insert contains a major repetitive DNA in M. tuberculosis. We also investigated the presence of such repetitive DNA in M. bovis BCG, M. kansasii, and M. fortuitum. The banding pattern of M. bovis BCG was identical to that of M. tuberculosis, indicating that M. bovis BCG is virtually identical to M. tuberculosis with respect to the presence and location of this major repetitive DNA. M. kansasii DNA fragments hybridized weakly with the lambda gt-11 inserts, and fragments of M. fortuitum did not hybridize with these DNA probes (Fig. 2). Characterization of the M. tuberculosis DNA insert in recombinant pPH7301. In order to characterize the repetitive DNA which is present in pPH7301, we sequenced 526 and 268 bp of the left and right ends, respectively, of the 2.4-kb DNA insert of this recombinant (Fig. 3). Both sequences contained multiple repeats of 10 bp, interspaced by 5-bp nonrepetitive sequences. Any of the 10-bp repeats shared at least six bases. On the basis of the maximum sequence homology, we derived the following consensus sequence for the 10-bp repeat: 5'GCCGGTGTTG. A search in the EMBL DNA data library revealed a striking homology of this

c

3

4

1

2

3

4

=

L

IA

.~~~~~~Awf

i 7) 0 .E

.

AmiXw

Bd~

4.4 -

2. 3 2.0 -

0.6

FIG. 1. Occurrence of repetitive DNA in M. tuberculosis and M. bovis BCG. Southern blots containing BstEII-digested chromosomal DNA from M. bovis BCG 43 (lane 1), M. bovis BCG 44 (lane 2), M. tuberculosis 19 (lane 3), and M. tuberculosis 23 (lane 4) were hybridized with labeled total chromosomal DNA from M. bovis BCG 43 (a) and M. tuberculosis 19 (b) and with the 2.4-kb EcoRI fragment of pPH7301 (c). The DNA probes were labeled with 32p. Hybridizing BstEII bands which were found in all lanes are marked with arrows. Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

the repetitive DNA present in the recombinant pPH7301, we reprobed the filter carrying the fractionated BstEII fragments with the 2.4-kb EcoRI insert of this plasmid. Surprisingly, most bands hybridizing with the 2.4-kb insert of pPH7301 were of the same size as the bands which were strongly hybridizing with the total chromosomal DNA probes (Fig. lc). This result suggests that the repetitive DNA a 1 23. I 9. 4 6.6

23

b

4

1

2

4

Q

d

c

3

2

4159

A

1

7

I

A

1

f q

A

I

I

A

- g P.

4.4 - P 2. 3 2.0 - t

o.6

-

FIG. 2. Characterization of M. tuberculosis lambda gt-11 recombinants, selected from the gene library by plaque blot hybridization with total chromosomal DNA of M. tuberculosis as a probe. Southern blots of BstEII-digested chromosomal DNA from M. tuberculosis 15 (lane 1), M. bovis 41 (lane 2), M. kansasii 53 (lane 3), and M. fortuitum 60 (lane 4) were hybridized with the 2.4-kb EcoRI fragment of pPH7301 (a) and total phage DNA of the recombinant clones lambda 7401 (b), lambda 7501 (c), lambda 7601 (d), lambda 7701 (e), and lambda 7801 (f). Labeled lambda gt-11 DNA did not hybridize with these strains (data not shown). The DNA probes were labeled with 32p. Cohybridizing BstEII fragments are marked with arrows. Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

C ALC G rG HERMANS ET AL.

4160

J. BACTrERIOL.

EcoRI

GAATTCCGAG TAACTGACGA GCACOGGCOG GGTCCTGACG GTAATGGGGT 50 A TGACGGTGAT GGAGCCGACA TGGACGOQGG GGTCGAGGCC CAA.GTrAATG GAT7GAACAG 110

EcoRI

pPH7301

cro

EcoRI

-I

lacZ

AGATGTCCGG GATGGCGATC GGGCCG&TGC CACCaACCGC GGCGAAGCCG ACCGGATGG 170 4-_

500

GCOGGATGTO GATGGOCOOC AGCACGGTAA TCGGGCCGAT CCCGCCGCTG ACOTOGGOC 230 D

CCACCGCGGG GAACAGCGGG AGGGTGTAGC CCACGGCGAA GCCGGCCAGG CCCTGGTAGT 290

aQ i L CAT QGCCCOCON SGCCA& T C CG C siCGCGNTCT GrT = TAGCoGAcATT ;= A G C

470

IGjCCTGACACCTG TTGAAACTGC CGCATEA&G& CCCAGTGC

CCTiCc

526

CTCGTGATA _CCCCCCAA GCTGA_CAGC a T;a CGI A ^

60

COCCOCGCCA

C=

350 410

bp

Reactivity with Moab F116-5

pPH7 301

SVSAEFRVTDREGPD

rpl rp2 rp3

SVSAEFRVTDEHG SAEFRVTDZHGRG EFRVTDEHGRGPD

+ +

FIG. 4. Characterization of the epitope of MAb F116-5 expressed by E. coli containing recombinant pPH7301. A simplified physical map of pPH7301 is depicted; vector DNA (open bars) and the 2.4-kb EcoRI M. tuberculosis DNA insert in which the sequenced DNA parts are indicated by closed bars are represented. The translated sequence of the junction of cro-lacZ and the M. tuberculosis DNA insert, the reactivity of MAb (Moab) F116-5 with E. coli containing pPH7301, and the overlapping synthetic peptides rpl, rp2, and rp3 are depicted. The mycobacterial residues are given in boldface.

the MAb F116-5 (data not shown). These data suggest that the 24- and 30-kDa proteins are not encoded by the mycoC180 OQ 3A bacterial DNA downstream of cro-lacZ and that the epitope recognized by the MAb F116-5 in E. coli carrying pPH7301 was artificially created by the fusion of cro-lacZ with the }A GJ C C CAC6-TG 240 mycobacterial DNA insert. To investigate this possibility, =¢GT CW CGGAATrC 268 we mapped the epitope by determining the reactivity of EcoRI F116-5 with three overlapping synthetic peptides which correspond to the translated DNA sequence at the junction FIG. 3. Partial sequence of the 2.4-kb EcoRI M. tuberculosis DNA insert of recombinant pPH7301. The sequenced parts of of the cro-lacZ gene and the M. tuberculosis DNA in pPH7301 are depicted in Fig. 4. The 10-bp repeated DNA elements pPH7301 (Fig. 4). The results showed that at least three are boxed; mismatches with the consensus sequence 5'GCCGGT cro-lacZ-derived amino acids in the epitope are essential for GTTG are marked with points. The amplimer pairs A and D (14) and the recognition by MAb F116-5. We conclude that the fusion I and F are depicted with arrows. Numbers at right indicate base protein expressed by pPH7301 contains an artificially crepairs. ated epitope recognized by MAb F116-5 as a result of the fusion of cro-lacZ and the mycobacterial DNA present in pPH7301. consensus 1O-bp sequence with M. tuberculosis sequences Identification of a MPTR from M. tuberculosis. To investilocated downstream from the 65-kDa heat shock protein gate whether the 10-bp repeat present in pPH7301 was gene (31). This DNA region was found to contain three responsible for the characteristic patterns of hybridizing clusters of 10-bp repeats, each of which shares at least five repetitive chromosomal DNA, fractionated BstEII-digested bases with the consensus sequence of the tandem repeat of M. tuberculosis DNA fragments were hybridized with a pPH7301. As in pPH7301, the 10-bp repeats were separated 181-bp pPH7301 fragment, which was obtained by PCR by 5-bp spacer DNA. Furthermore, we found that the 10-bp amplification with the amplimers I and F (Fig. 3). This consensus repeat (5'GCCGGTG1TG) shares significant hofragment is composed of 12 10-bp repeats separated by 5-bp mology with the recombination signal chi (5'GG.TfiLTGG) spacer sequences. The result shown in Fig. 5 demonstrates and the REP sequences [5'GC (Gff)GiAICG(G/A) that all bands hybridizing with the 181-bp probe correspond CG(C/T)] (35), which are both present in multiple copies in to those hybridizing with the 2.4-kb insert of pPH7301, the chromosome of Escherichia coli (32). indicating that the 10-bp-repeat-containing DNA is indeed a The repetitive DNA-containing recombinant plasmid major repetitive DNA in M. tuberculosis. This assumption pPH7301 is a derivative of a lambda gt-11 recombinant that was confirmed by the hybridization of M. tuberculosis DNA was originally selected because of its reactivity with the fragments with synthetic DNA probe TR2, which is comMAb F116-5 (14), Wvhich recognizes a 24- and a 30-kDa posed of a trimer of the consensus 10-bp repeated sequence protein of M. tuberculosis (41). The M. tuberculosis DNA in (5'GCCGGTGTTG) (Fig. 5c). We conclude that the 10-bp pPH7301 located immediately downstream of the cro-lacZ repetitive DNA element with the consensus sequence 5'GC gene has been used as a target sequence in PCR. About 15% CGGTGTTG is a major repetitive DNA in the M. tubercuof the M. tuberculosis strains investigated were negative in losis chromosome. Because this sequence is polymorphic PCR, and we have shown that these strains lacked the and tandemly present in the chromosome of M. tuberculosis, chromosomal DNA fragment corresponding to the cloned we designated it as a major polymorphic tandem repeat, M. tuberculosis DNA fragment immediately downstream of MPTR. the cro-lacZ gene and adjacent to the repeated DNA in Occurrence of the MPTR among different mycobacterial pPH7301 (14). Yet these M. tuberculosis strains were shown species. In our previous study, we have shown that DNA to express the 24- and 30-kDa polypeptides recognized by homologous to the insert of pPH7301 is present in the M.

120

CHARACTERIZATION OF MPTR IN M. TUBERCULOSIS

VOL. 174, 1992

b

a 1

23.1

2

3

4

5

1

6

2

9. 4

6. 6

-

6. 6

4 .4

-

4 4

-

2 .3

-

21..0

-

3 . 2 0

-

.

.

c

4

5

6

1 23.1 9.44 6. 6

-

9 .4

3

4161

4 4 .

2 3 2. 0 .

2

3

4

5

6

-

-

-

-

.W-x

I

...

MD

4" 0.6

W.W, 0.6

0.6

FIG. 5. Characterization of the M. tuberculosis repeated DNA sequence present in the recombinant plasmid pPH7301 by Southern blot analysis. BstEII-digested chromosomal DNA from M. tuberculosis strains 14 (lane 1) and 122 (lane 2), M. kansasii strains 363 (lane 3) and 364 (lane 4), and M. gordonae strains 358 (lane 5) and 359 (lane 6) were hybridized with the 2.4-kb EcoRI insert of pPH7301 (a), the 181-bp amplified fragment TR1 of pPH7301 (b), and the oligonucleotide probe TR2 (c). The probe was labeled with 32p (a and b) or horseradish peroxidase (c). Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

tuberculosis complex species, M. gordonae, and M. kansasii, and not in the mycobacterial species M. avium, M. fortuitum, M. intracellulare, M. scrofulaceum, and M. smegmatis (14). To assess whether the MPTR sequence is indeed present in M. gordonae and M. kansasii, digested DNA of these species was hybridized with the MPTRcontaining probes described in the previous section. The results show that hybridization with the 181-bp probe and the 30-bp synthetic trimer consensus probe results in the same banding patterns as hybridization with labeled pPH7301 DNA (Fig. 5). We conclude that repetitive DNA in M. gordonae and M. kansasii indeed shares sequence homology with the MPTR consensus sequence of M. tuberculosis. In order to determine the occurrence of the MPTR among members of the genus Mycobacterium more extensively, we tested 23 other mycobacterial species (Table 1). Southern blot analysis revealed the presence of MPTR-homologous DNA only in M. asiaticum, M. gastri and M. szulgai, whereas chromosomal DNA from the other 20 mycobacterial species did not hybridize with the probe (data not shown). Interestingly, all mycobacterial species containing MPTR-homologous DNA belong to a subgroup of slowly growing mycobacteria, which are naturally sensitive to rifampin.

DNA polymorphism of MPTR-containing restriction fragments in various mycobacterial species. In order to investigate a possible restriction fragment length polymorphism (RFLP) in MPTR-containing chromosomal DNA of the different

mycobacterial species of the M. tuberculosis complex, we analyzed several strains of each species. Previous findings have shown little RFLP among pPH7301-containing BstEII fragments of the M. tuberculosis complex strains (14, 16).

Use of the restriction enzyme BssHII resulted in more RFLP and, therefore, this enzyme was used to investigate the RFLP of a number of M. tuberculosis complex strains. The results show little RFLP among the species M. tuberculosis, M. africanum, and M. bovis BCG (Fig. 6), although the DNA fingerprints observed by using the IS986-based DNA probe (16) were highly polymorphic, indicating a low degree of similarity among these strains (data not shown). However, the three M. africanum strains differed from the other M tuberculosis complex strains in the absence of a 5.5-kb BssHII fragment. This suggests that this difference might be used to distinguish M. africanum from the other M. tuberculosis complex species. In addition, we investigated the MPTR-containing mycobacterial species which do not belong to the M. tuberculosis complex. Figure 7a shows the RFLP analysis of various strains of M. gastri, M. kansasii, M. szulgai and M. gordonae. Among each species different multiple banding patterns were observed. Each of the two M. gastri strains and the three M. szulgai strains showed a different hybridization pattern with the MPTR probe. Furthermore, among 17 M. kansasii strains 7 different banding patterns were obtained, whereas 12 of the 14 M. gordonae DNA fingerprints were different (Fig. 7). DNA fingerprinting of M. kansasii and M. gordonae strains. Because both M. gordonae and M. kansasii showed a high degree of polymorphism in the MPTR-containing restriction fragments, the potential value of the MPTR probe for use in the epidemiology of both mycobacterial species was examined. We analyzed 12 M. gordonae strains, which were obtained from regional health laboratories in the period of January to September 1990. These strains revealed six different RFLP types (Fig. 8). Interestingly, the different M.

4162

J. BACTERIOL.

HERMANS ET AL. 1

2

3

4

5

6

r_ % *

7

8

9

10 11 12

r E _

I :X ~wi''fr0;0':wwrI, =:: .:X^A;

0 f i

3~^ I

4 .4

2. -3- L f

2. 0

typing.

FIG. 6. RFLP analysis of MPTR-containing chromosomal DNA of various M. tuberculosis complex strains. A Southern blot of BssHII-digested chromosomal DNAs from various M. tuberculosis complex strains was probed with the 32P-labeled 2.4-kb EcoRI fragment of pPH7301. The strains included M. tuberculosis 15 (lane 1), M. tuberculosis 164 (lane 2), M. tuberculosis 97 (lane 3), M. tuberculosis 10 (lane 4), M. bovis BCG 45 (lane 5), M. bovis BCG 106 (lane 6), M. bovis BCG 105 (lane 7), M. bovis BCG 102 (lane 8), M. africanum 166 (lane 9), M. africanum 167 (lane 10), M. africanum 38 (lane 11), M. bovis 168 (lane 12), M. bovis 169 (lane 13), M. bovis 170 (lane 14), and M. bovis 171 (lane 15). The 5.5-kb BssHII fragment which is absent in the three M. africanum strains is marked with an arrow. Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

a

K K K 1 1 1

RFLP type

23

I

0 0 0G G G K K K 7 4 8 4 9 10 7 8 1

-

-

Ai

-

K K 9 5

b

RFLP tpe 1K K K K K K K K K G G G G G G G G 1 1 2 4 3 2 1 11 12 13 14 5 6 6 15

-

-

4. 4 -

2. 3 -_ 2. 0 -

0. 6

DISCUSSION Previous studies have shown that M. tuberculosis contains various repetitive DNA sequences, hybridizing with multiple chromosomal restriction fragments of M. tuberculosis (6, 14, 27). In addition, M. tuberculosis usually contains various copies of an IS3-like insertion element (16, 22, 37, 40). This element is the only well-characterized repetitive sequence in M. tuberculosis. These repeated DNA sequences were isolated from M. tuberculosis gene libraries because of their strong signal in hybridization assays. In this study, we have investigated systematically the major repetitive DNA families in M. tuberculosis. We obtained various lines of evidence indicating that the repetitive DNA present in recombinant pPH7301 is a major type of repetitive DNA in M. tuberculosis. First, the majority of the M. tuberculosis fragments that strongly hybridized with

23.1 9. 4 6. 6

9 4 6. 6 4.4

gordonae RFLP types were associated with biochemical characteristics. The strains with the RFLP type Gl (lanes 3, 6, and 12 of Fig. 8) were isoniazid resistant and urease negative, whereas the strains with the RFLP types G2 and G3 (lanes 5, 7 and 10, and 8, 9 and 11 of Figure 8, respectively) were INH sensitive and urease negative, and isoniazid sensitive and urease positive, respectively (26a). In addition to the M. kansasii strains described in the previous section, we fingerprinted an additional set of 19 strains with 12 different phage types (Fig. 9) (7, 8). Nine different fingerprint patterns were distinguished among these strains. Generally, strains with a particular phage type displayed identical fingerprints. Interestingly, strains of RFLP type Kl, which was predominantly present among the M. kansasii strains, belong to six different phage types. This indicates that strains with RFLP type Kl belong to a heterogeneous group, which can be subdivided by phage

i_,.

2. 3 2.0

-

0.6

-

-

4

4W

FIG. 7. RFLP analysis of MPTR-containing chromosomal DNA of various mycobacterial species. (a) Southern blot analysis of BstEII-digested chromosomal DNAs from AI. gastri 173 (lane 1) and 174 (lane 2); M. kansasii 179 (lane 3), 180 (lane 4), 181 (lane 5), 160 (lane 15), 182 (lane 16), 183 (lane 17), 184 (lane 19), and 185 (lane 20); M. szulgai 175 (lane 6), 176 (lane 7), and 177 (lane 8); M. gordonae 203 (lane 9), 204 (lane 10), 205 (lane 11), 206 (lane 12), 207 (lane 13), and 208 (lane 14); and M. avium 178 (lane 18). (b) Lane 1, M. kansasii 360 (urine); lane 2, M. kansasii 361 (sputum); lane 3, M. kansasii 362 (sputum); lane 4, M. kansasii 363 (gastric fluid); lane 5, M. kansasii 364 (sputum); lane 6, M. kansasii 365 (urine); lane 7, M. kansasii 366 (clinical origin unknown); lane 8, M. kansasii 367 (lymph node); lane 9, M. kansasii 368 (unknown clinical origin). Lanes 10 to 17, M. gordonae strains 351 to 358, respectively. The blots were hybridized with the 2.4-kb EcoRI fragment of pPH7301 labeled with 32p (a) or with horseradish peroxidase (b). The different RFLP types among M. kansasii and M. gordonae strains are depicted. Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

CHARACTERIZATION OF MPTR IN M. TUBERCULOSIS

VOL. 174, 1992 RLPIp

18 17 1

23.1t

-

2

2

3

phagetype 1

1

5

2

1

2

3

3

3

4

5

6

7

8

9 10 11 12

7

2 3

3 4

4

5

6

6 7

K K K 3 10 1

K K6 5

K K 6 4

K 1

K K K 3 1 1

9

4163

9 10 12 13 13 14 14

1 RFU Ptyp

K 1

1

K K 1 2

K K K K 1 1 11 12

4.

9.4 6.6 4.4 -

23. 1

-

9.4

-

6. 6 -

4. 4 -

2.3 2.0 -

2. 3 2.0 -

0.60.6

FIG. 8. DNA fingerprinting of various M. gordonae isolates obtained from regional health laboratories. Lanes 1 to 12, BstEIIdigested chromosomal DNA from the M. gordonae strains 223 to 234, respectively. The blot was hybridized with the 2.4-kb EcoRI fragment of pPH7301 labeled with horseradish peroxidase. The different RFLP types among the M. gordonae strains are depicted. Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

labeled total chromosomal DNA of M. tuberculosis were found to hybridize also with pPH7301 DNA. Second, about 10% of the lambda gt-11 recombinants of M. tuberculosis strongly hybridized with chromosomal DNA, indicating the presence of repetitive DNA in these clones. Five of these clones were analyzed, and all five appeared to contain inserts that hybridized with the same M. tuberculosis fragments as pPH7301. Assuming that these five clones contain inserts from different parts of the chromosome, we conclude that this repetitive DNA is present at many different locations on the chromosome of M. tuberculosis. The genomic size of M. tuberculosis is 4,000 kb (1). Supposing an average DNA insert of 5 kb in the M. tuberculosis lambda gt-11 gene library and a nonbiased representation of the M. tuberculosis genome among the lambda gt-11 recombinants, one could expect the presence of approximately 80 different MPTRcontaining regions in the genome of M. tuberculosis. Recombinant pPH7301 was originally selected from the M. tuberculosis lambda gt-11 gene library on the basis of the expression of a 0-galactosidase fusion protein that reacted with MAb F116-5 (14). This antibody recognizes two polypeptides of 24 and 30 kDa in M. tuberculosis (41). In this study, we showed by epitope mapping that the epitope expressed by pPH7301 was artificially created because of the fusion of cro-lacZ with a M. tuberculosis DNA fragment, and presumably, this recombinant does not encode for the 24- or the 30-kDa polypeptide. Similarly, Thole and colleagues have described the selection of a lambda gt-11 recombinant reactive with a MAb recognizing the M. leprae 36-kDa antigen. Detailed analysis of this recombinant also showed that the antibody reacted with an artificially created epitope at the junction of cro-lacZ and a M. leprae DNA fragment, which shared homology with a natural epitope of the 36-kDa M. leprae antigen (39). Sequence analysis of the M. tuberculosis DNA insert in pPH7301 revealed the presence of two clusters of short,

-

FIG. 9. DNA fingerprinting of BstEII-digested chromosomal DNA from various M. kansasii strains with different phage types. Lane 1, strain 186; lane 2, strain 184; lane 3, strain 187; lane 4, strain 185; lane 5, strain 189; lane 6, strain 190; lane 7, strain 191; lane 8, strain 192; lane 9, strain 193; lane 10, strain 194; lane 11, strain 195; lane 12, strain 196; lane 13, strain 197; lane 14, strain 198; lane 15, strain 199; lane 16, strain 200; lane 17, strain 54; lane 18, strain 182; and lane 19, strain 202. The blot was hybridized with the 2.4-kb EcoRI fragment of pPH7301 labeled with horseradish peroxidase. The different RFLP types and phage types among the M. kansasii strains are depicted. Numbers at left indicate sizes of standard DNA fragments in kilobase pairs.

tandemly repeated sequences. These short repeats are 10 bp in length and they share at least a 6-bp homology. The 10-bp repeats were invariably found to be separated by 5-bp spacer DNA sequences which do not share mutual homology. Hybridization of chromosomal DNA with a labeled synthetic trimer of the 10-bp repeated sequence showed that the majority of the repeated DNA in M. tuberculosis is composed of such sequences. Because these repeats are slightly heterogeneous in sequence, we designated this DNA as a MPTR. Comparison of the consensus MPTR sequence, 5'GCCG GTG1TG, with the EMBL sequence data library revealed the presence of multiple MPTRs in a previously cloned M. tuberculosis fragment which is located in an open reading frame of 1,551 bp downstream from the 65-kDa heat shock protein gene (31). Again the 10-bp repeat was invariably spaced by stretches of 5 bp. The repeats are located within the 1,551-bp open reading frame and result in a translated sequence containing the repeat X-Gly-Asp-Y-Gly. Shinnick concluded that these repeats possibly represent immunodominant epitopes, which may play a role in the immune response to mycobacteria (31). Since this repetitive peptide motif is inherent to the MPTR structure and probably is present at many locations in the chromosome of M. tuberculosis, it is feasible that this DNA does not code for a functional protein and plays no direct role in the immune response to mycobacteria. Therefore, further investigation on the relevance of this putative protein in immunogenicity is necessary. The MPTR consensus sequence also showed significant homology with the DNA sequence chi, a prokaryotic signal for homologous recombination present in bacteriophage

4164

HERMANS ET AL.

lambda and E. coli (32). Although chi is repetitively present in the E. coli chromosome, this sequence is not known to be present in tandem arrays (21). Interestingly, minisatellite DNA sequences that occur in tandem arrays also share similarity with chi (17), suggesting that the MPTR arrays may be minisatellitelike sequences present in the M. tuberculosis chromosome. Although speculative, the similarity of the MPTR sequence with chi might implicate a function as a signal for recombination. Additionally, we observed sequence homology of the MPTR consensus with the REP sequences of E. coli. REP sequences are responsible for differential stability of different segments of mRNA within an operon as a consequence of the palindromic secondary structures formed in mRNA (23, 35). Recently, the protein binding capacity of REP sequences has been investigated. The histonelike protein HU and the enzyme gyrase are capable to bind REP in vitro (44). The repetitive nature and the partial homology with these sequences suggest that the MPTR could be a protein binding site in the chromosome of M. tuberculosis and possibly involved in regulatory functions such as regulation of gene expression and structural organization of the bacterial chromosome (35, 44). This study confirmed our previous observations that the MPTR is present in all species of the M. tuberculosis complex and that the different isolates of these species usually show little polymorphism in the MPTR-containing restriction fragments (14). By using the restriction enzyme BssHII, a 5.5-kb fragment was found to be present only in strains of M. tuberculosis, M. bovis, and M. bovis BCG, whereas the M. africanum strains lacked such a fragment. This suggests that MPTR DNA might be a useful, additional tool to differentiate M. afticanum from other M. tuberculosis complex species, which is very difficult by phenotypic analysis. Analysis of the presence of MPTR-homologous DNA among various mycobacterial species other than M. tuberculosis revealed the occurrence of homologous repetitive DNA in M. gordonae, M. kansasii, M. asiaticum, M. gastri, and M. szulgai. The presence of MPTR-homologous DNA among these mycobacterial species suggests an evolutionary relationship among these mycobacterial species. This is consistent with the phylogenetic relationship of these species based on the homology of the 16S rRNA sequences as described by Stahl and Urbance (34). Surprisingly, although the M. avium complex bacteria belong to this group of taxonomically closely related mycobacteria (on the basis of 16S rRNA homology), they do not contain MPTR-homologous DNA. In contrast to the banding patterns of MPTR-containing restriction fragments in M. tuberculosis complex, strains of M. gordonae and M. kansasii were found to be highly polymorphic. Therefore, DNA fingerprinting with MPTR DNA as a probe seems a useful tool to differentiate various isolates of these species. Although several reports suggest the clinical relevance of M. gordonae (9, 10), the pathogenicity of this organism remains obscure (42). In contrast, it is established that M. kansasii can be highly pathogenic in men and is isolated from patients with and without clinical symptoms (30). Therefore, the DNA fingerprint technique might be useful in studying the epidemiology of this species. Phage typing has been used to subtype M. kansasii strains (7, 8), and comparison of this method with DNA fingerprinting showed that strains with a given phage type can often be differentiated because of their RFLPs. We conclude that DNA fingerprinting can potentially be of great use in the epidemiology of M. gordonae and M. kansasii.

J. BACTrERIOL.

ACKNOWLEDGMENTS We thank J. E. R. Thole and R. A. Hartskeerl for sequence analysis, R. van der Zee for peptide synthesis and ELISA, and J. G. Baas and J. E. M. Pijnenburg for technical assistance. We are also very grateful to P. E. W. de Haas for excellent service in DNA fingerprint analyses and to F. Portaels for providing us with mycobacterial strains. This study was financially supported by the World Health Organisation Programme for Vaccine Development. REFERENCES 1. Bradley, S. G. 1973. Relationships among mycobacteria and nocardiae based upon deoxyribonucleic acid reassociation. J. Bacteriol. 113:645-651. 2. Cirillo, J. D., R. G. Barletta, B. R. Bloom, and W. R. Jacobs, Jr. 1991. A novel transposon trap for mycobacteria: isolation and characterization of IS1096. J. Bacteriol. 173:7772-7780. 3. Clark-Curtiss, J. E., and M. A. Docherty. 1989. A species specific repetitive sequence in Mycobacterium leprae. J. Infect. Dis. 159:7-15. 4. Collins, D. M., D. M. Gabric, and G. W. de Lisle. 1989. Identification of a repetitive DNA sequence specific to Mycobacterium paratuberculosis. FEMS Microbiol. Lett. 60:175178. 5. Deonier, R. C., E. Ohtsubo, H.-J. Lee, and N. Davidson. 1974. Electron microscope heteroduplex studies of sequence relations among plasmids of Escherichia coli. VII. Mapping of ribosomal RNA genes in plasmid F14. J. Mol. Biol. 89:619-629. 6. Eisenach, K. D., J. T. Crawford, and J. H. Bates. 1988. Repetitive DNA sequences as probes for Mycobacterium tuberculosis. J. Clin. Microbiol. 26:2240-2245. 7. Engel, H. W. B., L. G. Berwald, J. M. Grange, and M. Kubin. 1980. Phage typing of Mycobacterium kansasii. Tubercle 61:1119. 8. Engel, H. W. B., L. G. Berwald, and A. H. Havelaar. 1980. The occurrence of Mycobacterium kansasii in tapwater. Tubercle 61:21-26. 9. Fasske, E., and K. H. Schr8der. 1989. Granulomatous pulmonary reactions after instillation of Mycobacterium gordonae. Med. Microbiol. Immunol. 178:149-161. 10. Gengoux, P., F. Portaels, J. M. Lachapelle, D. E. Minnikin, D. Tennstedt, and P. Tamigneau. 1987. Skin granulomas due to Mycobacterium gordonae. Int. J. Dermatol. 26:181-184. 11. Geysen, H. M., R. H. Meloen, and S. J. Barteling. 1984. Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. Proc. Natl. Acad. Sci. USA 81:3998-4002. 12. Green, E. P., M. L. V. Tizard, M. T. Moss, J. Thompson, D. J. Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989. Sequence and characteristics of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res. 17:9063-9073. 13. Grosskinsky, C. M., W. R. Jacobs, Jr., J. E. Clark-Curtiss, and B. R. Bloom. 1989. Genetic relationships among Mycobacterium leprae, Mycobacterium tuberculosis, and candidate leprosy vaccine strains determined by DNA hybridization: identification of an M. leprae-specific repetitive sequence. Infect. Immun. 57:1535-1541. 14. Hermans, P. W. M., A. R. J. Schuitema, D. van Soolingen, C. P. H. J. Verstynen, E. M. Bik, J. E. R. Thole, A. H. J. Kolk, and J. D. A. van Embden. 1990. Specific detection of Mycobacterium tuberculosis complex strains by polymerase chain reaction. J. Clin. Microbiol. 28:1204-1213. 15. Hermans, P. W. M., D. van Soolingen, E. M. Bik, P. E. W. de Haas, J. W. Dale, and J. D. A. van Embden. 1991. The insertion element IS987 from Mycobacterium bovis BCG is located in a hot spot integration region for insertion elements in Mycobacterium tuberculosis complex strains. Infect. Immun. 59:2695-2705. 16. Hermans, P. W. M., D. van Soolingen, J. W. Dale, A. R. J. Schuitema, R. A. McAdam, D. Catty, and J. D. A. van Embden. 1990. Insertion element IS986 from Mycobacterium tuberculosis: a useful tool for diagnosis and epidemiology of tuberculosis.

VOL. 174, 1992

CHARACTERIZATION OF MPTR IN M. TUBERCULOSIS

J. Clin. Microbiol. 28:2051-2058. 17. Jeffreys, A. J., V. Wilson, and S. L. Theyn. 1985. Hypervariable 'minisatellite' regions in human DNA. Nature (London) 314:6773. 18. Kiss, A., B. Sain, and P. Venetianer. 1977. The number of rRNA genes in Escherichia coli. FEBS Lett. 79:77-79. 19. Kunze, Z. M., S. Wall, R. Appelberg, M. T. Silva, F. Portaels, and J. J. McFadden. 1991. IS901, a new member of a widespread class of atypical insertion sequences, is associated with pathogenicity in Mycobacterium avium. Mol. Microbiol.

5:2265-2272. 20. Lam, S., and J. R. Roth. 1983. IS200: a Salmonella-specific insertion sequence. Cell 34:951-960. 21. Malone, R. E., D. K. Chattoraj, D. H. Faulds, M. M. Stahl, and F. W. Stahl. 1978. Hotspots for generalized recombination in the Escherichia coli chromosome. J. Mol. Biol. 121:473-491. 22. McAdam, R. A., P. W. M. Hermans, D. van Soolingen, Z. F. Zainuddin, D. Catty, J. D. A. van Embden, and J. W. Dale. 1990. Characterization of a Mycobacterium tuberculosis insertion sequence belonging to the IS3 family. Mol. Microbiol. 4:16071613. 23. Newbury, S. F., N. H. Smith, E. C. Robinson, I. D. Hiles, and C. F. Higgins. 1987. Stabilization of translationally active mRNA by procaryotic REP sequences. Cell 48:297-310. 24. Noordhoek, G. T., P. W. M. Hermans, L. M. Schouls, J. J. van der Sluis, and J. D. A. van Embden. 1989. Treponema pallidum subspecies pallidum (Nichols) and Treponema pallidum subspecies pertenue differ in at least one nucleotide: comparison of two homologous antigens. Microb. Pathog. 6:2942. 25. Nyman, K., K. Nakamura, H. Ohtsubo, and E. Ohtsubo. 1981. Distribution of the insertion sequence ISJ in gram-negative bacteria. Nature (London) 289:609-612. 26. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA

85:2444-2448. 26a.Portaels, F. Personal communication. 27. Reddi, P. P., G. P. Talwar, and P. S. Khandekar. 1988, Repetitive DNA sequence of Mycobacterium tuberculosis: analysis of differential hybridization pattern with other mycobacteria. Int. J. Lepr. 56:592-597. 28. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491. 29. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 30. Schraufnagel, D. E., J. A. Leech, and B. Pollak. 1986. Mycobacterium kansasii: colonization and disease. Br. J. Dis. Chest 80:131-137. 31. Shinnick, T. M. 1987. The 65-kilodalton antigen of Mycobacterium tuberculosis. J. Bacteriol. 169:1080-1088. 32. Smith, G. R., S. M. Kunes, D. W. Schultz, A. Taylor, and K. L.

4165

Triman. 1981. Structure of chi hotspots of generalized recombination. Cell 24:429-436. 33. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517. 34. Stahl, D. A., and J. W. Urbance. 1990. The division between fast- and slow-growing species corresponds to natural relationships among the mycobacteria. J. Bacteriol. 172:116-124. 35. Stern, M. J., G. Ferro-Luzzi Ames, N. H. Smith, E. C. Robinson, and C. F. Higgins. 1984. Repetitive extragenic palindromic sequences: a major component of the bacterial chromosome.

Cell 37:1015-1026. 36. Steward, G. C., F. E. Wilson, and K. F. Bott. 1982. Detailed physical mapping of the ribosomal RNA genes of Bacillus subtilis. Gene 19:153-162. 37. Thierry, D., M. D. Cave, K. D. Eisenach, J. T. Crawford, J. H. Bates, B. Gicquel, and J. L. Guesdon. 1990. IS6110, an IS-like element of Mycobacterium tuberculosis complex. Nucleic Acids Res. 18:188. 38. Thole, J. E. R., W. C. Keulen, A. H. J. Kolk, D. G. Groothuis, L. G. Berwald, R. H. Tiesjema, and J. D. A. van Embden. 1987. Characterization, sequence determination, and immunogenicity of a 64-kilodalton protein of Mycobacterium bovis BCG expressed in Escherichia coli. Infect. Immun. 55:1466-1475. 39. Thole, J. E. R., L. F. E. M. Stabel, M. E. G. Suykerbuyk, M. Y. L. de Wit, P. R. Klatser, A. H. J. Kolk, and R. A. Hartskeerl. 1990. A major immunogenic 36,000-molecularweight antigen from Mycobacterium leprae contains an immunoreactive region of proline-rich repeats. Infect. Immun. 58:8087. 40. van Soolingen, D., P. W. M. Hermans, P. E. W. de Haas, D. R. Soll, and J. D. A. van Embden. 1991. Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis. J. Clin. Microbiol. 29:2578-2586. 41. Verbon, A., S. Kuyper, H. M. Jansen, P. Speelman, and A. H. J. Kolk. 1990. Antigens in culture supernatant of Mycobacterium tuberculosis: epitopes defined by monoclonal and human antibodies. J. Gen. Microbiol. 136:955-964. 42. Wolinsky, E., and W. B. Schafer. 1979. Nontuberculous mycobacteria and associated diseases. Am. Rev. Respir. Dis. 119: 107-159. 43. Woods, S. A., and S. T. Cole. 1990. A family of dispersed repeats in Mycobacterium leprae. Mol. Microbiol. 4:1745-1751. 44. Yang, Y., and G. Ferro-Luzzi Ames. 1990. The family of repetitive extragenic palindromic sequences: interaction with DNA gyrase and histonelike protein HU, p. 211-226. In K. Drlica and M. Riley (ed.), The bacterial chromosome. American Society for Microbiology, Washington, D.C. 45. Young, R. A., B. R. Bloom, C. M. Grosskinsky, J. Ivanyi, D. Thomas, and R. W. Davis. 1985. Dissection of Mycobacterium tuberculosis antigens using recombinant DNA. Proc. Natl. Acad. Sci. USA 82:2583-2587.