Gene 546 (2014) 56–62
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Characterization of a novel carbonic anhydrase from freshwater pearl mussel Hyriopsis cumingii and the expression profile of its transcript in response to environmental conditions Gang Ren a,b, Yan Wang a,⁎, Jianguang Qin c, Jinyu Tang a, Xiafei Zheng a, Youming Li a a b c
College of Animal Sciences, Zhejiang University, Hangzhou 310058, PR China College of Life Science, Shaoxing University, Shaoxing 312000, PR China School of Biological Sciences, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia
a r t i c l e
i n f o
Article history: Received 15 November 2013 Received in revised form 16 May 2014 Accepted 19 May 2014 Available online 20 May 2014 Keywords: Hyriopsis cumingii Carbonic anhydrase Expression Shell growth pH homeostasis
a b s t r a c t Gene encoding for α-carbonic anhydrases (α-CAs) and their functions in fundamental metabolism and biomineralization are widely identified in mollusks. However, the transcriptional regulation of α-CA genes in response to various environmental conditions remains unknown. In the present study, we characterized a cDNA encoding for an α-CA (HcCA) from the freshwater pearl mussel Hyriopsis cumingii. The spatial and temporal expression patterns of HcCA indicate that this gene is mainly expressed in the mantle of juvenile mussels. The expression profile of HcCA under various environmental conditions reveals that the transcription of HcCA is significantly regulated by Ca2+ concentration, water temperature, pH and air exposure. Our results suggest that HcCA is a crucial target gene by which the external environmental conditions affecting shell growth and pH homeostasis of H. cumingii. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Carbonic anhydrases (CAs, EC 4.2.1.1) form a family of enzymes that catalyze the process of reversible hydration of CO2 to yield HCO− 3 and + H+ in the carbonic acid equilibrium (CO2 + H2O ↔ HCO− 3 + H ) (Badger and Price, 1994). CAs can participate in various physiological processes, such as respiration, pH homeostasis, ion transport, photosynthesis, synthesis of fatty acid and amino acid and biomineralization (Henry, 1996; Medakovic, 2000). To date, five CA (α, β, γ, δ, and ζ-CAs) families have been identified, and the α-CA is the predominant group in metazoans (Bertucci et al., 2013). Numerous CA genes and proteins have been identified from mollusks, exhibiting versatile functions related to biomineralization (Le Roy et al., 2012; Marie et al., 2008; Miyamoto et al., 1996; Norizuki and Samata, 2008) since Freeman and Wilbur (1948) first reported the carbonic anhydrase activity in the mantle of mollusks. Basically, CAs provide the substrate of HCO− 3 by hydrating CO2 for CaCO3 crystallization in molluscan biomineralization. Some studies revealed that CAs
Abbreviations: CA, carbonic anhydrase; RACE, rapid amplification of cDNA ends; NCBI, National Center for Biotechnology Information; qRT-PCR, quantitative reverse transcription-polymerase chain reaction; NLP, nacrein-like protein; ANOVA, analysis of variance; UTR, untranslated region. ⁎ Corresponding author at: Department of Applied Zoology, College of Animal Sciences, Zhejiang University, Hangzhou 310058, PR China. E-mail address: [email protected] (Y. Wang).
http://dx.doi.org/10.1016/j.gene.2014.05.039 0378-1119/© 2014 Elsevier B.V. All rights reserved.
can regulate Ca2 + transport and maintain Ca2 + homeostasis in the mantle of mollusks (Ebanks et al., 2010; Istin and Girard, 1970; Lopes-Lima et al., 2008). Nacrein, a type of CAs, is composed of a carbonic anhydrase domain and a Gly-X-Asn repeat domain, and is one of the organic matrix proteins accumulated in shells (Miyamoto et al., 2005). Nacreins in oysters Pinctada fucata and Crassostrea nippona can regulate the structure of CaCO3 crystal in shells by the calcium-bonding NG repeat domain (Miyamoto et al., 1996; Norizuki and Samata, 2008). Recent studies reported that CAs participate in pH homeostasis of mollusks (Connor and Gracey, 2011; Dickinson et al., 2012). Hyriopsis cumingii (Bivalvia: Unionidae) is a commercially important freshwater mussel in pearl farming, and provides more than 95% pearl production in the world (Wang et al., 2009). This mussel is widely cultured in ponds, lakes and rivers of middle and lower reaches of Yangtze River, China, and exhibits growth variation under different environmental conditions such as Ca2+ concentration, water temperature and pH. The optimal water temperature (24–28 °C) and neutral pH allow fast growth of H. cumingii and fast secretion of nacre in the mantle (Qiu and Shi, 1999; Xu et al., 1988). In commercial farming, H. cumingii is occasionally exposed to air for an extended period of time (e.g., over 1 day). The molecular mechanisms of the mussel in adaption to environmental change are unknown. In the present study, we identified an α-CA cDNA, designated as HcCA from H. cumingii, and analyzed its spatial and temporal expression patterns by real-time quantitative PCR. We also analyzed the expression profiles of HcCA under different Ca2+ concentrations, temperatures, pHs and air exposure. The objective of the
G. Ren et al. / Gene 546 (2014) 56–62
57
Hyriopsis cumingii at various developmental stages (embryos, larvae, mussels of 1, 2 or 4 years old) was collected from a commercial pearl mussel farm near Fengqiao Town, Zhuji City, Zhejiang Province, China (29°48 E, 120°23 N). 2-Year old mussels were used for cloning of HcCA cDNA fragment and expression analysis of HcCA mRNA under different Ca2 + concentrations, temperatures, pHs and air exposure. The spatial expression profile of HcCA in different tissues was tested with grafted mussels of 4 years old, and the temporal expression profile of HcCA was tested with embryos, larvae and mussels of 1, 2 or 4 years old.
the expert protein analysis system (http://web.expasy.org/blast/). Prediction of CA domain was performed using the simple modular architecture research tool (SMART; http://smart.embl-heidelberg.de/). The potential N-glycosylated site was predicted by NetNGlyc 1.0 tool (http://www.cbs.dtu.dk/services/NetNGlyc/). In silico analysis tools including SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/), PredictProtein (http://www.predictprotein.org), TMHMM 2.0 (http:// www.cbs.dtu.dk/services/TMHMM), and TMpred (http://www.ch. embnet.org/software/TMPRED) were integrated to predict the subcellular localization of HcCA protein. Multiple alignments of amino acid sequences of molluscan CA domains were performed using the ClustalX 1.81 software (http://www.clustal.org/), and edited by the GeneDoc software (http://www.psc.edu/biomed/genedoc). The Gly–Aln repeats in nacrein and nacrein-like protein sequences were removed before the alignment. The parameters of all bioinformatics tools mentioned above are set by default.
2.2. Identification of characterization of HcCA
2.3. Temporal and spatial expression of HcCA
2.2.1. cDNA fragment amplification Total RNA was extracted from the mantle pallial in non-grafted mussels of 2 years old using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer's protocol, and quantified by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, USA). 2.0 μg of total RNA was reversely transcribed with a PrimeScript® reverse transcriptase kit (TaKaRa) and primed with Oligo(dT)18. The partial HcCA cDNA fragment was amplified with the gene specific primers HcCAF1 and HcCAR1 which were designed on the conserved region of P. fucata nacrein cDNA sequence (GenBank accession no. D83523). The PCR product was electrophoresed on an agarose gel, purified with a DNA fragment purification kit (TaKaRa), and cloned into a pMD19-T vector with a TA cloning kit (TaKaRa). The recombinant plasmids were transformed into trans 5α chemically competent cell of Escherichia coli (TransGen Biotech, Beijing, China). The positive clones were screened by PCR with primers the HcCAF1 and HcCAR1 primers, and then subsequently sequenced.
2.3.1. Sample collection Spatial expression of HcCA in tissues was tested with grafted mussels of 4 years old (shell length 170 ± 8 mm, mean ± SD, n = 6). Thirteen samples were collected from gill (GL), labial palp (LP), hepatopancreas (HP), intestine (IN), adductor muscle (AM), pearl sac (PS), mantle center (MC), outer epithelium of the posterior mantle pallial (OpMP), inner epithelium and connective tissue of the posterior mantle pallial (IpMP), mantle edge (ME), foot (FT), hemolymph (HM) and gonad (GN), respectively. The samples used to test of temporal expression profile of HcCA at different development stages including whole embryos, whole larvae and the mantle center collected from mussels of 1, 2 or 4 years old (shell length of the mussels were 30 ± 2 mm, 80 ± 7 mm, and 170 ± 8 mm respectively, mean ± SD, n = 3). The embryos and larvae were isolated from the gill of mother mussels in May 2013 (n = 3). The samples were frozen in liquid nitrogen immediately and stored at −80 °C until RNA isolation.
present study is to explore the function and transcriptional regulation mechanism of HcCA in metabolism and biomineralization of H. cumingii. 2. Materials and methods 2.1. Mussel
2.2.2. Rapid amplification of cDNA ends (RACE) The 3′- and 5′-ends of cDNA were amplified by nested PCR using the FirstChoice® RLM-RACE kit (Ambion, Austin, TX, USA) and the SMART® RACE kit (Clontech, Palo Alto, CA, USA) respectively according to the manufacturer's protocols. The gene specific primers for RACE were designed according to the partial HcCA cDNA sequence obtained above (Table 1). 3′- and 5′-RACE products were isolated, purified, cloned, and sequenced as described in the cDNA fragment amplification. 2.2.3. Bioinformatics analysis The full-length cDNA sequence was identified by BLASTx analysis in NCBI database (http://www.ncbi.nlm.nih.gov/). The predicted amino acid sequence was determined using the BLAST Network Service on
2.3.2. Real-time PCR assay Total RNAs from the embryos, larvae, and tissues of 1, 2 or 4 year old mussels were extracted using RNAiso Plus (TaKaRa). The cDNA from total RNA was synthesized by a PrimeScript® Reverse Transcriptase kit (TaKaRa), using oligo (dT)18 as a primer. The gene-specific primers (RT-HcCAF and RT-HcCAR) for real-time quantitative PCR were designed according to the complete HcCA cDNA sequence (Table 1) with a correlation coefficient of R2 = 0.998 and an amplification efficiency of 93.2%. β-actin (GenBank accession no. HM045420) was used as an endogenous reference gene for calibration with a correlation coefficient of R2 = 0.999 and an amplification efficiency of 94.7% for the primers RTactinF and RT-actinR. qRT-PCR was performed on an iQ™5 Real Time PCR detection system (Bio-Rad Laboratories, Hercules, USA) with the SYBR® Premix Ex Taq™ PCR kit (TaKaRa) according to the manufacturer's
Table 1 Primers used in the present study. Primer name
Sequence 5′ → 3′
Sequence information
HcCAF1 HcCAR1 3′ RACE adapter HcCAF2 3′ RACE outer primer HcCAF3 3′ RACE inner primer HcCAR2 HcCAR3 RT-HcCAF RT-HcCAR RT-actinF RT-actinR
CAATCTCCAATCAACATCGT TGGTCAGGGATCCCTCGTATG GCGAGCACAGAATTAATACGACTCACTATAGGT12VN GCCGTACAGCGAGGGACAAG GCGAGCACAGAATTAATACGACT CTGGCGGACATTATCGGAAGC CGCGGATCCGAATTAATACGACTCACTATAGG GGGAGCGGCGTAACGTCCTTTTG TTGACCACCTGGGCACAGCTTCC GTCTACAGTCAAAATGGTGGAAACG CAGACCCAATGAGTTCACCCG CCCTGGAATCGCTGACCGTAT GCTGGAAGGTGGAGAGAGAAG
PCR amplifying of cDNA fragment PCR amplifying of cDNA fragment 3′ RACE reverse translation 1st round 3′ RACE 1st round 3′ RACE 2nd round 3′ RACE 2nd round 3′ RACE 1st round 5′ RACE 2nd round 5′ RACE qRT-PCR of HcCA qRT-PCR of HcCA qRT-PCR of β-actin qRT-PCR of β-actin
58
G. Ren et al. / Gene 546 (2014) 56–62
protocol. Real-time RCR was performed in the following program: denaturation at 95 °C for 1 min, 40 cycles of 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s, followed by the determination of the melting curve, which was carried out through 0.5 °C increments from 50 °C to 95 °C. Relative gene expression was determined by the 2−(ΔΔCt) method (Livak and Schmittgen, 2001). 2.4. Effects of environmental conditions on expression of HcCA mRNA 2.4.1. Ca2+ concentration A 10-week experiment was conducted on a mussel farm in Fengqiao Town from July to September, 2012. At the beginning of the experiment, the Ca2+ concentration in the pond water was 0.5 mM. Five Ca2+ concentrations (0.25, 0.75, 1.25, 1.75 and 2.0 mM) were designed with two replicates. Mussels of 2 years old (shell length 110 ± 8 mm, mean ± SD) were cultured in polyethylene tanks (2000 L) at a density of nine mussels per tank. During the experiment, the mussels were fed with yeast (Angel Yeast Co., Ltd., Yili, China) twice daily. The Ca2+ concentration in tanks was measured with the EDTA titration method weekly, and was maintained at the designed levels by adding CaCl2. At the end of the experiment, the mussels were killed and the posterior mantle tissue was sampled from each mussel. The samples were preserved in liquid nitrogen immediately and stored at −80 °C until analysis. The expression profile of HcCA was tested with the qRT-PCR method as described in Section 2.3.2. Nacre deposition in the mussel and calcium content in the posterior mantle tissue were measured with the methods described in Ren et al. (2013a,b). 2.4.2. Water temperature and pH A 2-week experiment was conducted on a mussel farm in Fengqiao Town in May 2013. Three treatments were designed, including control (pH was 7.3 at 26 °C), low temperature (pH was 7.3 at 17 °C), and low pH (pH was 5.0 at 26 °C) with two replicates each. The 2-year old mussels were reared in tanks (150 L) at a density of nine mussels per tank, and fed with yeast (Angel Yeast Co., Ltd.). Prior to the trial, mussel was acclimated in aerated well water at 26 °C and pH 7.30 ± 0.05 for 2 days. During the experiment, water temperature and pH in the tanks were monitored twice daily. Sulfuric acid of 1 M was used to adjust pH to 5.0 ± 0.5 in the low pH treatment, and ice packs were used to adjust water temperature to 17 ± 1 °C in the low temperature treatment. At the end of the experiment, extrapallial fluid (EPF) in the central extrapallial space of the mussel was sampled with a sterile syringe. The mantle center was sampled from each mussel, frozen in liquid nitrogen, and then stored at − 80 °C. pH of the EPF was measured with a pH meter (FE30-FiveEasy, Mettler Toledo, Shanghai, China). The expression profile of HcCA mRNA in the mantle center was tested with the qRT-PCR method as described in Section 2.3.2. 2.4.3. Air exposure A 3-day experiment was conducted, and 150 mussels of 2 years old were placed in an incubator with temperature 24 ± 1 °C, relative humidity 60 ± 5%, and photoperiod 12 h light:12 h dark. Twelve mussels were sampled randomly at 0, 0.5, 1, 2 and 3 days. Extrapallial fluid (EPF) and mantle center were sampled from the mussels as described in Section 2.4.2. The pH of the EPF was measured as described in Section 2.4.2, and the expression profile of HcCA in the mantle center tissue was tested as described in Section 2.3.2. 2.5. Statistical analysis One-way ANOVA was performed to test the differences in the expression of HcCA transcripts (Section 2.3) either between tissues in the 4-year old mussels or between developmental stages of embryos, larvae, and the mantle center of mussel of 1, 2 or 4 years old. The differences in pH of the extrapallial fluid and HcCA transcripts in the mantle center between mussels reared at different Ca2+ concentrations (Section 2.4.1)
or different periods of air exposure (Section 2.4.3) were also examined with one-way ANOVA. Further comparisons were performed with Tukey's HSD test. The differences in pH of the extrapallial fluid and HcCA transcripts in the mantle center between the control and the mussel at either low temperature or low pH were examined with Student's t-test (Section 2.4.2). Differences were considered statistically significant at P b 0.05 and very significant at P b 0.01. All the statistics were performed with SPSS software (version 19.0, SPSS Inc., Chicago, Illinois, USA). 3. Results 3.1. Full-length cDNA of HcCA The full-length HcCA cDNA (GenBank accession no. KF206121) comprised 1911 bp, containing a 54-bp 5′-untranslated region (UTR), a 1653-bp open reading frame (ORF) and a 204-bp 3′-UTR. 3.2. Structure of deduced HcCA protein The deduced HcCA protein comprised 550 amino acids with a predicted molecular weight of 58.95 kDa. It contained a putative signal peptide with 19 residues and a mature polypeptide with a CA domain (amino acids 108–370). Comparing with human CA VI (PBD: 3FE4, chain B), three predicted zinc binding residues in the active sites of CA domain of HcCA were conserved at His207, His209 and His232. Residues associated substrate in the hydrophobic pocket were also conserved at Val121, Val143, Leu198 and Trp209. The NetNGlyc service indicated that there were three potential N-glycosylated sites (Asn304, Asn395 and Asn440) in HcCA. The in silico analysis of PredictProtein, TMHMM 2.0, and TMpred did not detect the transmembrane domain in the deduced HcCA peptides. 3.3. Sequence comparisons of molluscan α-CA domains Sequence alignment was performed to identify the relationships of CA domains among HcCA and other molluscan α-CAs that included nacrein and nacrein-like proteins (NLPs) (Fig. 1). The deduced CA domain of HcCA shared identities of 67.9–78.1% with other molluscan CA domains. Multiple alignment analysis further showed that the deduce HcCA domain was strictly conserved in the zinc binding sites and the substrate association sites (Fig. 1). 3.4. Spatial and temporal expressions of HcCA The spatial expression profile of HcCA in the 4-year old mussel by qRT-PCR showed that HcCA mRNA was abundant in the mantle, especially in the mantle center (MC) and inner epithelium and the connective tissue of the posterior mantle pallial (IpMP) (Fig. 2). No HcCA mRNA was detected in any embryonic stages, and the highest expression of HcCA mRNA was found in 1-year old mussel (P b 0.01) (Fig. 3). The expression of HcCA mRNA in the mantle center of 1-year old mussel was higher than that in the 2–4 year old mussel (Fig. 3). 3.5. Expression of HcCA mRNA under various environmental conditions 3.5.1. Ca2+ concentration The nacre deposition on the shell, calcium in the posterior mantle pallial, and HcCA transcripts in the posterior mantle pallial of the 2-year old mussel varied with Ca2+ concentrations. The highest HcCA transcripts were found at 1.75 mM Ca2+ (P b 0.05; Fig. 4a), but there was no significant change between calcium in the posterior mantle pallial (P = 0.57; Fig. 4b). Higher nacre deposition was found in the 1.25 mM and 1.75 mM Ca2+ treatments (P b 0.05; Fig. 4c).
G. Ren et al. / Gene 546 (2014) 56–62
59
Fig. 1. Multiple alignment of the amino acid sequences of molluscan α-CA domains. Identical residues are highlighted in black, and similar residues in 80% and 60% identifications are highlighted in gray and light gray, respectively. Three Zn2+-binding histidines are indicated by red circles above the alignment, and residues consisting of substrate association sites are indicated by blue stars. Residues providing indirect zinc ligands are indicated by magenta diamonds, and the catalytic proton shuttle His174 is indicated by a green triangle. NLP represents nacrein-like protein. The sequences are taken from GenBank including Crassostrea gigas CA (BAM93475), Tridacna gigas CA (AAX16122), Patella vulgata CA (CCJ09593), Pinctada maxima NLP (BAA90540), Pinctada margaritifera NLP (AEC03970), Pinctada fucata nacrein (BAA11940), Crassostrea nippon NLP (BAF42334), Mizuhopecten yessoensis NLP (BAF42331), Haliotis tuberculata CA (AEL22201), Haliotis gigantea CA (BAH58350), and Turbo marmoratus nacrein (BAB91157).
3.5.2. Low water temperature and pH The expressions of HcCA in 2-year old mussel at low temperature (17 °C) or low pH (5.0) were significantly down-regulated compared with that of the control (P b 0.01; Fig. 5). The pH in the
extrapallial fluid of mussel at low pH was higher than that in control (P b 0 .05), while no significant difference was found in pH in the extrapallial fluid between mussels at 17 °C and the control (P N 0.05).
Fig. 2. Expression of HcCA mRNA in different tissues of Hyriopsis cumingii. Expression of HcCA mRNA is analyzed by qRT-PCR using β-actin as a reference gene. MC: mantle center; IpMP: inner epithelium and connective tissues of the posterior mantle pallial; OpMP: outer epithelium of the posterior mantle pallial; ME: mantle edge; AM: adductor muscle; GL: gill; LP: labial palp; HP: hepatopancreas; IN: intestine; FT: foot; PS: pearl sac; HM: hemolymph; GN: gonad. Each bar represents mean ± SEM for different tissues of six pearl mussels of 4 years old. Means with different superscript letters are significantly different at P b 0.05 by the Tukey's HSD test.
Fig. 3. Expression of HcCA mRNA at different developmental stages from fertilized eggs to adults. Expression of HcCA mRNA is analyzed by qRT-PCR using β-actin as a reference gene. OO-4C: 4-cell oosperm; CL: cleavage; GA: gastrulae; GL-UM: unmatured glochidia; GL-M: matured glochidia; JM-1: 1-year old juvenile mussel; JM-2: 2-year old juvenile mussel; AM-4: 4-year old adult mussel. Statistical significance is tested using Tukey's HSD test (**P b 0.01).
60
G. Ren et al. / Gene 546 (2014) 56–62
Fig. 5. Expression of HcCA mRNA in the mantle center and pH of extrapallial fluid in 2 year old Hyriopsis cumingii at different pHs and temperatures. β-actin was used as the internal control to normalize the expression data analyzed by qRT-PCR. Control: pH 7.3 at 26 °C; low pH: pH 5.0 at 26 °C; low temperature: pH 7.3 at 17 °C. Data are presented as mean ± SEM (n = 18). Statistical significance is tested using Student's t-test (**P b 0.01, *P b 0.05).
3.5.3. Air exposure Survival of the mussel was 100% on day 0–3 after air exposure, but declined to 90% on day 4. Compared with day 0, the expression of HcCA was up-regulated on day 2 (P b 0.01, Fig. 6), but was downregulated on day 3. The pH in the extrapallial fluid increased gradually from day 0 to day 1, but no significant difference was found in pH during the 4-day air exposure (P N 0.05). 4. Discussion In the present study, we cloned a novel α-CA gene named HcCA from the freshwater pearl mussel H. cumingii. The in silico analysis suggests that the deduced HcCA protein is an extracellular protein. Despite the low sequence similarities to the other molluscan CA domains (67.9–78.1%), the zinc binding and substrate sites of the deduced HcCA are completely conserved in the CA domain (Christianson and Fierke, 1996).
Fig. 4. HcCA mRNA expression, calcium content in posterior mantle pallial (pMP) and nacre deposition in 2-year old Hyriopsis cumingii at different Ca2+ concentrations. (a) HcCA mRNA expression in the pMP by qRT-PCR. β-actin is used as the internal control to normalize the expression data. (b) Calcium content (μg Ca: mg dry weight) in pMP. (c) Nacre deposition. Data are presented as mean ± SEM (n = 18), and the data with different letters are significantly different (Tukey's HSD test, P b 0.05).
Fig. 6. Expression of HcCA mRNA in the mantle center and pH of extrapallial fluid in 2 year old Hyriopsis cumingii during 3-day air exposure. β-actin was used as the internal control to normalize the expression data analyzed by qRT-PCR. Data are expressed as mean ± SEM. Statistical significance is tested using Tukey's HSD test (**P b 0.01). No significant change was observed between extrapallial fluid pH values.
G. Ren et al. / Gene 546 (2014) 56–62
The mantle tissue of mollusks has multiple functions, including respiration, calcium storage and biomineralization (Gosling, 2003). Recent studies reveal that mollusks express several CA isoforms in the mantle (Le Roy et al., 2012; Werner et al., 2013; Zhang et al., 2012). The existence of different CAs in the mantle results in versatile functional roles of CAs, including acid–base regulation, ion transport, respiration and biomineralization (Medakovic, 2000). In the present study, the high expression level of HcCA was found in the mantle center and the mantle pallial of adult mussel, suggesting that HcCA might participate in the mantle metabolic functions. High expression level of HcCA in 1-year old mussel, relative to other development stages (Fig. 3) suggests that HcCA might participate in regulation of shell growth of H. cumingii since shell growth is generally faster in juvenile than in adult mussel (Aldridge, 1999). Gastrulae and glochidia are the developmental stages for shell formation in mollusks (Kniprath, 1981). The mantle edge and pearl sac are tissues where organic matrices are secreted. Few HcCA transcript was detected either at the embryonic stages or in the mantle edge (ME) and pearl sac (PS) of 4-year old mussel. This implies that HcCA might not participate in shell formation of H. cumingii as a shell matrix protein. The proteomic analysis on the matrix proteins of shell and pearl (Berland et al., 2013) has also showed that no peptide matches the deduced HcCA protein sequence. Therefore, HcCA might affect shell growth of H. cumingii through maintaining Ca2+ concentration in the mantle tissue (Ebanks et al., 2010; Istin and Girard, 1970; LopesLima et al., 2008) or maintaining pH homeostasis (Connor and Gracey, 2011; Dickinson et al., 2012). Ca2+ concentration is an important environmental factor for shell growth in freshwater mollusks (Dalesman and Lukowiak, 2010). In most Chinese lakes and ponds for H. cumingii farming, Ca2+ concentration varies from 0.175 to 1.25 mM (Ling et al., 2008). To date, the appropriate Ca2+ concentration for the growth of H. cumingii has not been determined. In the present study, the expression of HcCA mRNA in the mantle pallial is consistent with the nacre deposition on shell at different Ca2+ concentrations (Fig. 4a, c). Metabolic acidosis is a determinant factor driving calcium flux towards shell growth in mollusks (LopesLima et al., 2009). CAs can catalyze hydration of CO2 to provide H+ for calcium active transporter such as Ca2+-ATPase and Ca2+/H+ exchanger, thereby facilitate calcium absorption from the ambient environment and its transfer to the shell (Ebanks et al., 2010; Istin and Girard, 1970; Lopes-Lima et al., 2008). In the present study, the expression profile of HcCA at different Ca2+ concentrations suggests that the expression of HcCA is regulated by the environmental Ca2+ concentration. Water temperature and pH are crucial to the growth of mollusks. Growth rate of H. cumingii is higher at 24–28 °C than at 18 °C (Xu et al., 1988), and the mantle of mussels synthesizes and secrets more organic matrix in water at neutral pH than at acid or alkaline pH (Qiu and Shi, 1999). In the present study, the down-regulation of HcCA at low temperature (17 °C) and pH (5.0) suggests that low temperature and pH limit HcCA modulation on the shell growth of H. cumingii. In acidic water, CaCO3 deposited in the shell of bivalves can dissolve and increase the pH in mantle fluid (Heming et al., 1988). Bivalves have a large surface area of mantle with developed circulatory hemolymph (Gosling, 2003), and can absorb oxygen through mantle to compensate aerobic metabolism under air exposure (Byrne and McMahon, 1994). Air exposure can result in metabolic acidosis in mussels (Anacleto et al., 2013; Connor and Gracey, 2011), and the dissolution of CaCO3 deposited in shell and other CaCO3 reserve (Lopes-Lima et al., 2009). This mechanism is contributing to the pH homeostasis in mussel (Thorp and Covich, 2001). However, HCO− 3 produced by dissolution of CaCO3 (Heming et al., 1988) cannot freely permeate across cell membranes in the form of free CO2 (Henry, 1996). In the present study, the up-regulation of HcCA mRNA on day 2 after air exposure suggests that HcCA might play a role in the dehydration of extracellular HCO− 3 to CO2 for diffusion across the mantle, thereby maintain the acid–base balance of extrapallial fluid of H. cumingii in the early stage of air exposure.
61
5. Conclusion A novel α-CA gene named HcCA was cloned from the freshwater pearl mussel H. cumingii, and the deduced HcCA protein is an extracellular CA. Spatial and temporal expression patterns of HcCA suggest that HcCA may play a role in regulating the shell growth of H. cumingii. The expression of HcCA in H. cumingii is affected by the environmental Ca2+ concentration, water temperature, pH and air exposure. Conflict of interest The authors declare that there is no conflict of interest in this paper. Acknowledgments This research was funded by the Major State Basic Research of China (Grant No. 2009CB118706), the Special Fund for Agro-Scientific Research in the Public Interest of China (200903028), the Shaoxing Municipal Science and Technology Plan Project of China (2011A22007) and the Foundation of Zhejiang Education Committee of China (Y201225243). References Aldridge, D.C., 1999. The morphology, growth and reproduction of Unionidae (Bivalvia) in a Fenland waterway. J. Molluscan Stud. 65, 47–60. Anacleto, P.I.C., Maulvault, A.L.I.S., Barrento, S., Mendes, R.E.R., Nunes, M.L., Rosa, R., Marques, A.O.N., 2013. Physiological responses to depuration and transport of native and exotic clams at different temperatures. Aquaculture 408–409, 136–146. Badger, M.R., Price, G.D., 1994. The role of carbonic anhydrase in photosynthesis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45, 369–392. Berland, S., Ma, Y., Marie, A., Andrieu, J.P., Bedouet, L., Feng, Q., 2013. Proteomic and profile analysis of the proteins laced with aragonite and vaterite in the freshwater mussel Hyriopsis cumingii shell biominerals. Protein Pept. Lett. 20, 1170–1180. Bertucci, A., Moya, A., Tambutte, S., Allemand, D., Supuran, C.T., Zoccola, D., 2013. Carbonic anhydrases in anthozoan corals — a review. Bioorg. Med. Chem. 21, 1437–1450. Byrne, R.A., McMahon, R.F., 1994. Behavioral and physiological responses to emersion in freshwater bivalves. Am. Zool. 34, 194–204. Christianson, D.W., Fierke, C.A., 1996. Carbonic anhydrase: evolution of the zinc binding site by nature and by design. Acc. Chem. Res. 29, 331–339. Connor, K.M., Gracey, A.Y., 2011. Circadian cycles are the dominant transcriptional rhythm in the intertidal mussel Mytilus californianus. Proc. Natl. Acad. Sci. U. S. A. 108, 16110–16115. Dalesman, S., Lukowiak, K., 2010. Effect of acute exposure to low environmental calcium on respiration and locomotion in Lymnaea stagnalis (L.). J. Exp. Biol. 213, 1471–1476. Dickinson, G.H., Ivanina, A.V., Matoo, O.B., Portner, H.O., Lannig, G., Bock, C., Beniash, E., Sokolova, I.M., 2012. Interactive effects of salinity and elevated CO2 levels on juvenile eastern oysters, Crassostrea virginica. J. Exp. Biol. 215, 29–43. Ebanks, S.C., O'Donnell, M.J., Grosell, M., 2010. Characterization of mechanisms for Ca2+ 2− and HCO− 3 /CO3 acquisition for shell formation in embryos of the freshwater common pond snail Lymnaea stagnalis. J. Exp. Biol. 213, 4092–4098. Freeman, J.A., Wilbur, K.M., 1948. Carbonic anhydrase in molluscs. Biol. Bull. 94, 55–59. Gosling, E.M., 2003. Bivalve molluscs: biology ecology and culture, Blackwell, Oxford. Heming, T.A., Vinogradov, G.A., Klerman, A.K., Komov, V.T., 1988. Acid–base regulation in the freshwater pearl mussel Margaritifera margaritifera: effects of emersion and low water pH. J. Exp. Biol. 137, 501–511. Henry, R.P., 1996. Multiple roles of carbonic anhydrase in cellular transport and metabolism. Annu. Rev. Physiol. 58, 523–538. Istin, M., Girard, J.P., 1970. Carbonic anhydrase and mobilisation of calcium reserves in the mantle of lamellibranchs. Calcif. Tissue Res. 5, 247–260. Kniprath, E., 1981. Ontogeny of the molluscan shell field: a review. Zool. Scr. 10, 61–79. Le Roy, N., Marie, B., Gaume, B., Guichard, N., Delgado, S., Zanella-Cleon, I., Becchi, M., Auzoux-Bordenave, S., Sire, J.Y., Marin, F., 2012. Identification of two carbonic anhydrases in the mantle of the European abalone Haliotis tuberculata (Gastropoda, Haliotidae): phylogenetic implications. J. Exp. Zool. B 318, 353–367. Ling, Q.X., Wang, Y., Gao, J.H., Zhu, S.B., Wang, W.L., 2008. Water quality for culturing freshwater pearl mussel, Hyriopsis cumingii in waters scatted in different regions in China. J. Shanghai Fish. Univ. 17, 328–332. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−(ΔΔCt) method. Methods 25, 402–408. Lopes-Lima, M., Bleher, R., Forg, T., Hafner, M., Machado, J., 2008. Studies on a PMCA-like protein in the outer mantle epithelium of Anodonta cygnea: insights on calcium transcellular dynamics. J. Comp. Physiol. B 178, 17–25. Lopes-Lima, M., Lopes, A., Casaca, P., Nogueira, I., Checa, A., Machado, J., 2009. Seasonal 2+ variations of pH, pCO2, pO2, HCO− in the haemolymph: implications on 3 and Ca the calcification physiology in Anodonta cygnea. J. Comp. Physiol. B. 179, 279–286. Marie, B., Luquet, G., Bedouet, L., Milet, C., Guichard, N., Medakovic, D., Marin, F., 2008. Nacre calcification in the freshwater mussel Unio pictorum: carbonic anhydrase activity and purification of a 95 kDa calcium-binding glycoprotein. ChemBioChem 9, 2515–2523.
62
G. Ren et al. / Gene 546 (2014) 56–62
Medakovic, D., 2000. Carbonic anhydrase activity and biomineralization process in embryos, larvae and adult blue mussels Mytilus edulis L. Helgol. Mar. Res. 54, 1–6. Miyamoto, H., Miyashita, T., Okushima, M., Nakano, S., Morita, T., Matsushiro, A., 1996. A carbonic anhydrase from the nacreous layer in oyster pearls. Proc. Natl. Acad. Sci. U. S. A. 93, 9657–9660. Miyamoto, H., Miyoshi, F., Kohno, J., 2005. The carbonic anhydrase domain protein nacrein is expressed in the epithelial cells of the mantle and acts as a negative regulator in calcification in the mollusc Pinctada fucata. Zool. Sci. 22, 311–315. Norizuki, M., Samata, T., 2008. Distribution and function of the nacrein-related proteins inferred from structural analysis. Mar. Biotechnol. 10, 234–241. Qiu, A.D., Shi, A.J., 1999. Effects of pH on nacre secretion of freshwater pearl mussel (Hyriopsis cumingii). Acta Zool. Sin. 45, 361–370. Ren, G., Hu, X., Tang, J., Wang, Y., 2013a. Characterization of cDNAs for calmodulin and calmodulin-like protein in the freshwater mussel Hyriopsis cumingii: differential expression in response to environmental Ca2+ and calcium binding of recombinant proteins. Comp. Biochem. Physiol. B 165, 165–171. Ren, G., Jin, Y.F., Shi, W.L., Chen, Y., 2013b. Effects of cerium(III) treatments on calcium metabolism of the freshwater pearl mussel Hyriopsis cumingii. J. Chin. Rare Earth Soc. 31, 344–352. Thorp, J.H., Covich, A.P., 2001. Ecology and classification of North American freshwater invertebrates, 2nd ed. Academic Press, San Diego.
Wang, Y., Wang, W.L., Qin, J.G., Wang, X.D., Zhu, S.B., 2009. Effects of integrated combination and quicklime supplementation on growth and pearl yield of freshwater pearl mussel, Hyriopsis cumingii (Lea, 1852). Aquac. Res. 40, 1634–1641. Werner, G.D., Gemmell, P., Grosser, S., Hamer, R., Shimeld, S.M., 2013. Analysis of a deep transcriptome from the mantle tissue of Patella vulgata Linnaeus (Mollusca: Gastropoda: Patellidae) reveals candidate biomineralising genes. Mar. Biotechnol. 15, 230–243. Xu, Z.K., Xu, Z.D., Wu, Q., 1988. Effects of temperature on the physiology of Hyriopsis cumingii. Fish. Sci. 7, 9–11. Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., Xiong, Z., Que, H., Xie, Y., Holland, P.W., Paps, J., Zhu, Y., Wu, F., Chen, Y., Wang, J., Peng, C., Meng, J., Yang, L., Liu, J., Wen, B., Zhang, N., Huang, Z., Zhu, Q., Feng, Y., Mount, A., Hedgecock, D., Xu, Z., Liu, Y., Domazet-Loso, T., Du, Y., Sun, X., Zhang, S., Liu, B., Cheng, P., Jiang, X., Li, J., Fan, D., Wang, W., Fu, W., Wang, T., Wang, B., Zhang, J., Peng, Z., Li, Y., Li, N., Wang, J., Chen, M., He, Y., Tan, F., Song, X., Zheng, Q., Huang, R., Yang, H., Du, X., Chen, L., Yang, M., Gaffney, P.M., Wang, S., Luo, L., She, Z., Ming, Y., Huang, W., Zhang, S., Huang, B., Zhang, Y., Qu, T., Ni, P., Miao, G., Wang, J., Wang, Q., Steinberg, C.E., Wang, H., Li, N., Qian, L., Zhang, G., Li, Y., Yang, H., Liu, X., Wang, J., Yin, Y., Wang, J., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Characterization of a novel carbonic anhydrase from freshwater pearl mussel Hyriopsis cumingii and the expression profile of its transcript in response to environmental conditions Gang Ren a,b, Yan Wang a,⁎, Jianguang Qin c, Jinyu Tang a, Xiafei Zheng a, Youming Li a a b c
College of Animal Sciences, Zhejiang University, Hangzhou 310058, PR China College of Life Science, Shaoxing University, Shaoxing 312000, PR China School of Biological Sciences, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia
a r t i c l e
i n f o
Article history: Received 15 November 2013 Received in revised form 16 May 2014 Accepted 19 May 2014 Available online 20 May 2014 Keywords: Hyriopsis cumingii Carbonic anhydrase Expression Shell growth pH homeostasis
a b s t r a c t Gene encoding for α-carbonic anhydrases (α-CAs) and their functions in fundamental metabolism and biomineralization are widely identified in mollusks. However, the transcriptional regulation of α-CA genes in response to various environmental conditions remains unknown. In the present study, we characterized a cDNA encoding for an α-CA (HcCA) from the freshwater pearl mussel Hyriopsis cumingii. The spatial and temporal expression patterns of HcCA indicate that this gene is mainly expressed in the mantle of juvenile mussels. The expression profile of HcCA under various environmental conditions reveals that the transcription of HcCA is significantly regulated by Ca2+ concentration, water temperature, pH and air exposure. Our results suggest that HcCA is a crucial target gene by which the external environmental conditions affecting shell growth and pH homeostasis of H. cumingii. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Carbonic anhydrases (CAs, EC 4.2.1.1) form a family of enzymes that catalyze the process of reversible hydration of CO2 to yield HCO− 3 and + H+ in the carbonic acid equilibrium (CO2 + H2O ↔ HCO− 3 + H ) (Badger and Price, 1994). CAs can participate in various physiological processes, such as respiration, pH homeostasis, ion transport, photosynthesis, synthesis of fatty acid and amino acid and biomineralization (Henry, 1996; Medakovic, 2000). To date, five CA (α, β, γ, δ, and ζ-CAs) families have been identified, and the α-CA is the predominant group in metazoans (Bertucci et al., 2013). Numerous CA genes and proteins have been identified from mollusks, exhibiting versatile functions related to biomineralization (Le Roy et al., 2012; Marie et al., 2008; Miyamoto et al., 1996; Norizuki and Samata, 2008) since Freeman and Wilbur (1948) first reported the carbonic anhydrase activity in the mantle of mollusks. Basically, CAs provide the substrate of HCO− 3 by hydrating CO2 for CaCO3 crystallization in molluscan biomineralization. Some studies revealed that CAs
Abbreviations: CA, carbonic anhydrase; RACE, rapid amplification of cDNA ends; NCBI, National Center for Biotechnology Information; qRT-PCR, quantitative reverse transcription-polymerase chain reaction; NLP, nacrein-like protein; ANOVA, analysis of variance; UTR, untranslated region. ⁎ Corresponding author at: Department of Applied Zoology, College of Animal Sciences, Zhejiang University, Hangzhou 310058, PR China. E-mail address: [email protected] (Y. Wang).
http://dx.doi.org/10.1016/j.gene.2014.05.039 0378-1119/© 2014 Elsevier B.V. All rights reserved.
can regulate Ca2 + transport and maintain Ca2 + homeostasis in the mantle of mollusks (Ebanks et al., 2010; Istin and Girard, 1970; Lopes-Lima et al., 2008). Nacrein, a type of CAs, is composed of a carbonic anhydrase domain and a Gly-X-Asn repeat domain, and is one of the organic matrix proteins accumulated in shells (Miyamoto et al., 2005). Nacreins in oysters Pinctada fucata and Crassostrea nippona can regulate the structure of CaCO3 crystal in shells by the calcium-bonding NG repeat domain (Miyamoto et al., 1996; Norizuki and Samata, 2008). Recent studies reported that CAs participate in pH homeostasis of mollusks (Connor and Gracey, 2011; Dickinson et al., 2012). Hyriopsis cumingii (Bivalvia: Unionidae) is a commercially important freshwater mussel in pearl farming, and provides more than 95% pearl production in the world (Wang et al., 2009). This mussel is widely cultured in ponds, lakes and rivers of middle and lower reaches of Yangtze River, China, and exhibits growth variation under different environmental conditions such as Ca2+ concentration, water temperature and pH. The optimal water temperature (24–28 °C) and neutral pH allow fast growth of H. cumingii and fast secretion of nacre in the mantle (Qiu and Shi, 1999; Xu et al., 1988). In commercial farming, H. cumingii is occasionally exposed to air for an extended period of time (e.g., over 1 day). The molecular mechanisms of the mussel in adaption to environmental change are unknown. In the present study, we identified an α-CA cDNA, designated as HcCA from H. cumingii, and analyzed its spatial and temporal expression patterns by real-time quantitative PCR. We also analyzed the expression profiles of HcCA under different Ca2+ concentrations, temperatures, pHs and air exposure. The objective of the
G. Ren et al. / Gene 546 (2014) 56–62
57
Hyriopsis cumingii at various developmental stages (embryos, larvae, mussels of 1, 2 or 4 years old) was collected from a commercial pearl mussel farm near Fengqiao Town, Zhuji City, Zhejiang Province, China (29°48 E, 120°23 N). 2-Year old mussels were used for cloning of HcCA cDNA fragment and expression analysis of HcCA mRNA under different Ca2 + concentrations, temperatures, pHs and air exposure. The spatial expression profile of HcCA in different tissues was tested with grafted mussels of 4 years old, and the temporal expression profile of HcCA was tested with embryos, larvae and mussels of 1, 2 or 4 years old.
the expert protein analysis system (http://web.expasy.org/blast/). Prediction of CA domain was performed using the simple modular architecture research tool (SMART; http://smart.embl-heidelberg.de/). The potential N-glycosylated site was predicted by NetNGlyc 1.0 tool (http://www.cbs.dtu.dk/services/NetNGlyc/). In silico analysis tools including SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/), PredictProtein (http://www.predictprotein.org), TMHMM 2.0 (http:// www.cbs.dtu.dk/services/TMHMM), and TMpred (http://www.ch. embnet.org/software/TMPRED) were integrated to predict the subcellular localization of HcCA protein. Multiple alignments of amino acid sequences of molluscan CA domains were performed using the ClustalX 1.81 software (http://www.clustal.org/), and edited by the GeneDoc software (http://www.psc.edu/biomed/genedoc). The Gly–Aln repeats in nacrein and nacrein-like protein sequences were removed before the alignment. The parameters of all bioinformatics tools mentioned above are set by default.
2.2. Identification of characterization of HcCA
2.3. Temporal and spatial expression of HcCA
2.2.1. cDNA fragment amplification Total RNA was extracted from the mantle pallial in non-grafted mussels of 2 years old using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer's protocol, and quantified by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, USA). 2.0 μg of total RNA was reversely transcribed with a PrimeScript® reverse transcriptase kit (TaKaRa) and primed with Oligo(dT)18. The partial HcCA cDNA fragment was amplified with the gene specific primers HcCAF1 and HcCAR1 which were designed on the conserved region of P. fucata nacrein cDNA sequence (GenBank accession no. D83523). The PCR product was electrophoresed on an agarose gel, purified with a DNA fragment purification kit (TaKaRa), and cloned into a pMD19-T vector with a TA cloning kit (TaKaRa). The recombinant plasmids were transformed into trans 5α chemically competent cell of Escherichia coli (TransGen Biotech, Beijing, China). The positive clones were screened by PCR with primers the HcCAF1 and HcCAR1 primers, and then subsequently sequenced.
2.3.1. Sample collection Spatial expression of HcCA in tissues was tested with grafted mussels of 4 years old (shell length 170 ± 8 mm, mean ± SD, n = 6). Thirteen samples were collected from gill (GL), labial palp (LP), hepatopancreas (HP), intestine (IN), adductor muscle (AM), pearl sac (PS), mantle center (MC), outer epithelium of the posterior mantle pallial (OpMP), inner epithelium and connective tissue of the posterior mantle pallial (IpMP), mantle edge (ME), foot (FT), hemolymph (HM) and gonad (GN), respectively. The samples used to test of temporal expression profile of HcCA at different development stages including whole embryos, whole larvae and the mantle center collected from mussels of 1, 2 or 4 years old (shell length of the mussels were 30 ± 2 mm, 80 ± 7 mm, and 170 ± 8 mm respectively, mean ± SD, n = 3). The embryos and larvae were isolated from the gill of mother mussels in May 2013 (n = 3). The samples were frozen in liquid nitrogen immediately and stored at −80 °C until RNA isolation.
present study is to explore the function and transcriptional regulation mechanism of HcCA in metabolism and biomineralization of H. cumingii. 2. Materials and methods 2.1. Mussel
2.2.2. Rapid amplification of cDNA ends (RACE) The 3′- and 5′-ends of cDNA were amplified by nested PCR using the FirstChoice® RLM-RACE kit (Ambion, Austin, TX, USA) and the SMART® RACE kit (Clontech, Palo Alto, CA, USA) respectively according to the manufacturer's protocols. The gene specific primers for RACE were designed according to the partial HcCA cDNA sequence obtained above (Table 1). 3′- and 5′-RACE products were isolated, purified, cloned, and sequenced as described in the cDNA fragment amplification. 2.2.3. Bioinformatics analysis The full-length cDNA sequence was identified by BLASTx analysis in NCBI database (http://www.ncbi.nlm.nih.gov/). The predicted amino acid sequence was determined using the BLAST Network Service on
2.3.2. Real-time PCR assay Total RNAs from the embryos, larvae, and tissues of 1, 2 or 4 year old mussels were extracted using RNAiso Plus (TaKaRa). The cDNA from total RNA was synthesized by a PrimeScript® Reverse Transcriptase kit (TaKaRa), using oligo (dT)18 as a primer. The gene-specific primers (RT-HcCAF and RT-HcCAR) for real-time quantitative PCR were designed according to the complete HcCA cDNA sequence (Table 1) with a correlation coefficient of R2 = 0.998 and an amplification efficiency of 93.2%. β-actin (GenBank accession no. HM045420) was used as an endogenous reference gene for calibration with a correlation coefficient of R2 = 0.999 and an amplification efficiency of 94.7% for the primers RTactinF and RT-actinR. qRT-PCR was performed on an iQ™5 Real Time PCR detection system (Bio-Rad Laboratories, Hercules, USA) with the SYBR® Premix Ex Taq™ PCR kit (TaKaRa) according to the manufacturer's
Table 1 Primers used in the present study. Primer name
Sequence 5′ → 3′
Sequence information
HcCAF1 HcCAR1 3′ RACE adapter HcCAF2 3′ RACE outer primer HcCAF3 3′ RACE inner primer HcCAR2 HcCAR3 RT-HcCAF RT-HcCAR RT-actinF RT-actinR
CAATCTCCAATCAACATCGT TGGTCAGGGATCCCTCGTATG GCGAGCACAGAATTAATACGACTCACTATAGGT12VN GCCGTACAGCGAGGGACAAG GCGAGCACAGAATTAATACGACT CTGGCGGACATTATCGGAAGC CGCGGATCCGAATTAATACGACTCACTATAGG GGGAGCGGCGTAACGTCCTTTTG TTGACCACCTGGGCACAGCTTCC GTCTACAGTCAAAATGGTGGAAACG CAGACCCAATGAGTTCACCCG CCCTGGAATCGCTGACCGTAT GCTGGAAGGTGGAGAGAGAAG
PCR amplifying of cDNA fragment PCR amplifying of cDNA fragment 3′ RACE reverse translation 1st round 3′ RACE 1st round 3′ RACE 2nd round 3′ RACE 2nd round 3′ RACE 1st round 5′ RACE 2nd round 5′ RACE qRT-PCR of HcCA qRT-PCR of HcCA qRT-PCR of β-actin qRT-PCR of β-actin
58
G. Ren et al. / Gene 546 (2014) 56–62
protocol. Real-time RCR was performed in the following program: denaturation at 95 °C for 1 min, 40 cycles of 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s, followed by the determination of the melting curve, which was carried out through 0.5 °C increments from 50 °C to 95 °C. Relative gene expression was determined by the 2−(ΔΔCt) method (Livak and Schmittgen, 2001). 2.4. Effects of environmental conditions on expression of HcCA mRNA 2.4.1. Ca2+ concentration A 10-week experiment was conducted on a mussel farm in Fengqiao Town from July to September, 2012. At the beginning of the experiment, the Ca2+ concentration in the pond water was 0.5 mM. Five Ca2+ concentrations (0.25, 0.75, 1.25, 1.75 and 2.0 mM) were designed with two replicates. Mussels of 2 years old (shell length 110 ± 8 mm, mean ± SD) were cultured in polyethylene tanks (2000 L) at a density of nine mussels per tank. During the experiment, the mussels were fed with yeast (Angel Yeast Co., Ltd., Yili, China) twice daily. The Ca2+ concentration in tanks was measured with the EDTA titration method weekly, and was maintained at the designed levels by adding CaCl2. At the end of the experiment, the mussels were killed and the posterior mantle tissue was sampled from each mussel. The samples were preserved in liquid nitrogen immediately and stored at −80 °C until analysis. The expression profile of HcCA was tested with the qRT-PCR method as described in Section 2.3.2. Nacre deposition in the mussel and calcium content in the posterior mantle tissue were measured with the methods described in Ren et al. (2013a,b). 2.4.2. Water temperature and pH A 2-week experiment was conducted on a mussel farm in Fengqiao Town in May 2013. Three treatments were designed, including control (pH was 7.3 at 26 °C), low temperature (pH was 7.3 at 17 °C), and low pH (pH was 5.0 at 26 °C) with two replicates each. The 2-year old mussels were reared in tanks (150 L) at a density of nine mussels per tank, and fed with yeast (Angel Yeast Co., Ltd.). Prior to the trial, mussel was acclimated in aerated well water at 26 °C and pH 7.30 ± 0.05 for 2 days. During the experiment, water temperature and pH in the tanks were monitored twice daily. Sulfuric acid of 1 M was used to adjust pH to 5.0 ± 0.5 in the low pH treatment, and ice packs were used to adjust water temperature to 17 ± 1 °C in the low temperature treatment. At the end of the experiment, extrapallial fluid (EPF) in the central extrapallial space of the mussel was sampled with a sterile syringe. The mantle center was sampled from each mussel, frozen in liquid nitrogen, and then stored at − 80 °C. pH of the EPF was measured with a pH meter (FE30-FiveEasy, Mettler Toledo, Shanghai, China). The expression profile of HcCA mRNA in the mantle center was tested with the qRT-PCR method as described in Section 2.3.2. 2.4.3. Air exposure A 3-day experiment was conducted, and 150 mussels of 2 years old were placed in an incubator with temperature 24 ± 1 °C, relative humidity 60 ± 5%, and photoperiod 12 h light:12 h dark. Twelve mussels were sampled randomly at 0, 0.5, 1, 2 and 3 days. Extrapallial fluid (EPF) and mantle center were sampled from the mussels as described in Section 2.4.2. The pH of the EPF was measured as described in Section 2.4.2, and the expression profile of HcCA in the mantle center tissue was tested as described in Section 2.3.2. 2.5. Statistical analysis One-way ANOVA was performed to test the differences in the expression of HcCA transcripts (Section 2.3) either between tissues in the 4-year old mussels or between developmental stages of embryos, larvae, and the mantle center of mussel of 1, 2 or 4 years old. The differences in pH of the extrapallial fluid and HcCA transcripts in the mantle center between mussels reared at different Ca2+ concentrations (Section 2.4.1)
or different periods of air exposure (Section 2.4.3) were also examined with one-way ANOVA. Further comparisons were performed with Tukey's HSD test. The differences in pH of the extrapallial fluid and HcCA transcripts in the mantle center between the control and the mussel at either low temperature or low pH were examined with Student's t-test (Section 2.4.2). Differences were considered statistically significant at P b 0.05 and very significant at P b 0.01. All the statistics were performed with SPSS software (version 19.0, SPSS Inc., Chicago, Illinois, USA). 3. Results 3.1. Full-length cDNA of HcCA The full-length HcCA cDNA (GenBank accession no. KF206121) comprised 1911 bp, containing a 54-bp 5′-untranslated region (UTR), a 1653-bp open reading frame (ORF) and a 204-bp 3′-UTR. 3.2. Structure of deduced HcCA protein The deduced HcCA protein comprised 550 amino acids with a predicted molecular weight of 58.95 kDa. It contained a putative signal peptide with 19 residues and a mature polypeptide with a CA domain (amino acids 108–370). Comparing with human CA VI (PBD: 3FE4, chain B), three predicted zinc binding residues in the active sites of CA domain of HcCA were conserved at His207, His209 and His232. Residues associated substrate in the hydrophobic pocket were also conserved at Val121, Val143, Leu198 and Trp209. The NetNGlyc service indicated that there were three potential N-glycosylated sites (Asn304, Asn395 and Asn440) in HcCA. The in silico analysis of PredictProtein, TMHMM 2.0, and TMpred did not detect the transmembrane domain in the deduced HcCA peptides. 3.3. Sequence comparisons of molluscan α-CA domains Sequence alignment was performed to identify the relationships of CA domains among HcCA and other molluscan α-CAs that included nacrein and nacrein-like proteins (NLPs) (Fig. 1). The deduced CA domain of HcCA shared identities of 67.9–78.1% with other molluscan CA domains. Multiple alignment analysis further showed that the deduce HcCA domain was strictly conserved in the zinc binding sites and the substrate association sites (Fig. 1). 3.4. Spatial and temporal expressions of HcCA The spatial expression profile of HcCA in the 4-year old mussel by qRT-PCR showed that HcCA mRNA was abundant in the mantle, especially in the mantle center (MC) and inner epithelium and the connective tissue of the posterior mantle pallial (IpMP) (Fig. 2). No HcCA mRNA was detected in any embryonic stages, and the highest expression of HcCA mRNA was found in 1-year old mussel (P b 0.01) (Fig. 3). The expression of HcCA mRNA in the mantle center of 1-year old mussel was higher than that in the 2–4 year old mussel (Fig. 3). 3.5. Expression of HcCA mRNA under various environmental conditions 3.5.1. Ca2+ concentration The nacre deposition on the shell, calcium in the posterior mantle pallial, and HcCA transcripts in the posterior mantle pallial of the 2-year old mussel varied with Ca2+ concentrations. The highest HcCA transcripts were found at 1.75 mM Ca2+ (P b 0.05; Fig. 4a), but there was no significant change between calcium in the posterior mantle pallial (P = 0.57; Fig. 4b). Higher nacre deposition was found in the 1.25 mM and 1.75 mM Ca2+ treatments (P b 0.05; Fig. 4c).
G. Ren et al. / Gene 546 (2014) 56–62
59
Fig. 1. Multiple alignment of the amino acid sequences of molluscan α-CA domains. Identical residues are highlighted in black, and similar residues in 80% and 60% identifications are highlighted in gray and light gray, respectively. Three Zn2+-binding histidines are indicated by red circles above the alignment, and residues consisting of substrate association sites are indicated by blue stars. Residues providing indirect zinc ligands are indicated by magenta diamonds, and the catalytic proton shuttle His174 is indicated by a green triangle. NLP represents nacrein-like protein. The sequences are taken from GenBank including Crassostrea gigas CA (BAM93475), Tridacna gigas CA (AAX16122), Patella vulgata CA (CCJ09593), Pinctada maxima NLP (BAA90540), Pinctada margaritifera NLP (AEC03970), Pinctada fucata nacrein (BAA11940), Crassostrea nippon NLP (BAF42334), Mizuhopecten yessoensis NLP (BAF42331), Haliotis tuberculata CA (AEL22201), Haliotis gigantea CA (BAH58350), and Turbo marmoratus nacrein (BAB91157).
3.5.2. Low water temperature and pH The expressions of HcCA in 2-year old mussel at low temperature (17 °C) or low pH (5.0) were significantly down-regulated compared with that of the control (P b 0.01; Fig. 5). The pH in the
extrapallial fluid of mussel at low pH was higher than that in control (P b 0 .05), while no significant difference was found in pH in the extrapallial fluid between mussels at 17 °C and the control (P N 0.05).
Fig. 2. Expression of HcCA mRNA in different tissues of Hyriopsis cumingii. Expression of HcCA mRNA is analyzed by qRT-PCR using β-actin as a reference gene. MC: mantle center; IpMP: inner epithelium and connective tissues of the posterior mantle pallial; OpMP: outer epithelium of the posterior mantle pallial; ME: mantle edge; AM: adductor muscle; GL: gill; LP: labial palp; HP: hepatopancreas; IN: intestine; FT: foot; PS: pearl sac; HM: hemolymph; GN: gonad. Each bar represents mean ± SEM for different tissues of six pearl mussels of 4 years old. Means with different superscript letters are significantly different at P b 0.05 by the Tukey's HSD test.
Fig. 3. Expression of HcCA mRNA at different developmental stages from fertilized eggs to adults. Expression of HcCA mRNA is analyzed by qRT-PCR using β-actin as a reference gene. OO-4C: 4-cell oosperm; CL: cleavage; GA: gastrulae; GL-UM: unmatured glochidia; GL-M: matured glochidia; JM-1: 1-year old juvenile mussel; JM-2: 2-year old juvenile mussel; AM-4: 4-year old adult mussel. Statistical significance is tested using Tukey's HSD test (**P b 0.01).
60
G. Ren et al. / Gene 546 (2014) 56–62
Fig. 5. Expression of HcCA mRNA in the mantle center and pH of extrapallial fluid in 2 year old Hyriopsis cumingii at different pHs and temperatures. β-actin was used as the internal control to normalize the expression data analyzed by qRT-PCR. Control: pH 7.3 at 26 °C; low pH: pH 5.0 at 26 °C; low temperature: pH 7.3 at 17 °C. Data are presented as mean ± SEM (n = 18). Statistical significance is tested using Student's t-test (**P b 0.01, *P b 0.05).
3.5.3. Air exposure Survival of the mussel was 100% on day 0–3 after air exposure, but declined to 90% on day 4. Compared with day 0, the expression of HcCA was up-regulated on day 2 (P b 0.01, Fig. 6), but was downregulated on day 3. The pH in the extrapallial fluid increased gradually from day 0 to day 1, but no significant difference was found in pH during the 4-day air exposure (P N 0.05). 4. Discussion In the present study, we cloned a novel α-CA gene named HcCA from the freshwater pearl mussel H. cumingii. The in silico analysis suggests that the deduced HcCA protein is an extracellular protein. Despite the low sequence similarities to the other molluscan CA domains (67.9–78.1%), the zinc binding and substrate sites of the deduced HcCA are completely conserved in the CA domain (Christianson and Fierke, 1996).
Fig. 4. HcCA mRNA expression, calcium content in posterior mantle pallial (pMP) and nacre deposition in 2-year old Hyriopsis cumingii at different Ca2+ concentrations. (a) HcCA mRNA expression in the pMP by qRT-PCR. β-actin is used as the internal control to normalize the expression data. (b) Calcium content (μg Ca: mg dry weight) in pMP. (c) Nacre deposition. Data are presented as mean ± SEM (n = 18), and the data with different letters are significantly different (Tukey's HSD test, P b 0.05).
Fig. 6. Expression of HcCA mRNA in the mantle center and pH of extrapallial fluid in 2 year old Hyriopsis cumingii during 3-day air exposure. β-actin was used as the internal control to normalize the expression data analyzed by qRT-PCR. Data are expressed as mean ± SEM. Statistical significance is tested using Tukey's HSD test (**P b 0.01). No significant change was observed between extrapallial fluid pH values.
G. Ren et al. / Gene 546 (2014) 56–62
The mantle tissue of mollusks has multiple functions, including respiration, calcium storage and biomineralization (Gosling, 2003). Recent studies reveal that mollusks express several CA isoforms in the mantle (Le Roy et al., 2012; Werner et al., 2013; Zhang et al., 2012). The existence of different CAs in the mantle results in versatile functional roles of CAs, including acid–base regulation, ion transport, respiration and biomineralization (Medakovic, 2000). In the present study, the high expression level of HcCA was found in the mantle center and the mantle pallial of adult mussel, suggesting that HcCA might participate in the mantle metabolic functions. High expression level of HcCA in 1-year old mussel, relative to other development stages (Fig. 3) suggests that HcCA might participate in regulation of shell growth of H. cumingii since shell growth is generally faster in juvenile than in adult mussel (Aldridge, 1999). Gastrulae and glochidia are the developmental stages for shell formation in mollusks (Kniprath, 1981). The mantle edge and pearl sac are tissues where organic matrices are secreted. Few HcCA transcript was detected either at the embryonic stages or in the mantle edge (ME) and pearl sac (PS) of 4-year old mussel. This implies that HcCA might not participate in shell formation of H. cumingii as a shell matrix protein. The proteomic analysis on the matrix proteins of shell and pearl (Berland et al., 2013) has also showed that no peptide matches the deduced HcCA protein sequence. Therefore, HcCA might affect shell growth of H. cumingii through maintaining Ca2+ concentration in the mantle tissue (Ebanks et al., 2010; Istin and Girard, 1970; LopesLima et al., 2008) or maintaining pH homeostasis (Connor and Gracey, 2011; Dickinson et al., 2012). Ca2+ concentration is an important environmental factor for shell growth in freshwater mollusks (Dalesman and Lukowiak, 2010). In most Chinese lakes and ponds for H. cumingii farming, Ca2+ concentration varies from 0.175 to 1.25 mM (Ling et al., 2008). To date, the appropriate Ca2+ concentration for the growth of H. cumingii has not been determined. In the present study, the expression of HcCA mRNA in the mantle pallial is consistent with the nacre deposition on shell at different Ca2+ concentrations (Fig. 4a, c). Metabolic acidosis is a determinant factor driving calcium flux towards shell growth in mollusks (LopesLima et al., 2009). CAs can catalyze hydration of CO2 to provide H+ for calcium active transporter such as Ca2+-ATPase and Ca2+/H+ exchanger, thereby facilitate calcium absorption from the ambient environment and its transfer to the shell (Ebanks et al., 2010; Istin and Girard, 1970; Lopes-Lima et al., 2008). In the present study, the expression profile of HcCA at different Ca2+ concentrations suggests that the expression of HcCA is regulated by the environmental Ca2+ concentration. Water temperature and pH are crucial to the growth of mollusks. Growth rate of H. cumingii is higher at 24–28 °C than at 18 °C (Xu et al., 1988), and the mantle of mussels synthesizes and secrets more organic matrix in water at neutral pH than at acid or alkaline pH (Qiu and Shi, 1999). In the present study, the down-regulation of HcCA at low temperature (17 °C) and pH (5.0) suggests that low temperature and pH limit HcCA modulation on the shell growth of H. cumingii. In acidic water, CaCO3 deposited in the shell of bivalves can dissolve and increase the pH in mantle fluid (Heming et al., 1988). Bivalves have a large surface area of mantle with developed circulatory hemolymph (Gosling, 2003), and can absorb oxygen through mantle to compensate aerobic metabolism under air exposure (Byrne and McMahon, 1994). Air exposure can result in metabolic acidosis in mussels (Anacleto et al., 2013; Connor and Gracey, 2011), and the dissolution of CaCO3 deposited in shell and other CaCO3 reserve (Lopes-Lima et al., 2009). This mechanism is contributing to the pH homeostasis in mussel (Thorp and Covich, 2001). However, HCO− 3 produced by dissolution of CaCO3 (Heming et al., 1988) cannot freely permeate across cell membranes in the form of free CO2 (Henry, 1996). In the present study, the up-regulation of HcCA mRNA on day 2 after air exposure suggests that HcCA might play a role in the dehydration of extracellular HCO− 3 to CO2 for diffusion across the mantle, thereby maintain the acid–base balance of extrapallial fluid of H. cumingii in the early stage of air exposure.
61
5. Conclusion A novel α-CA gene named HcCA was cloned from the freshwater pearl mussel H. cumingii, and the deduced HcCA protein is an extracellular CA. Spatial and temporal expression patterns of HcCA suggest that HcCA may play a role in regulating the shell growth of H. cumingii. The expression of HcCA in H. cumingii is affected by the environmental Ca2+ concentration, water temperature, pH and air exposure. Conflict of interest The authors declare that there is no conflict of interest in this paper. Acknowledgments This research was funded by the Major State Basic Research of China (Grant No. 2009CB118706), the Special Fund for Agro-Scientific Research in the Public Interest of China (200903028), the Shaoxing Municipal Science and Technology Plan Project of China (2011A22007) and the Foundation of Zhejiang Education Committee of China (Y201225243). References Aldridge, D.C., 1999. The morphology, growth and reproduction of Unionidae (Bivalvia) in a Fenland waterway. J. Molluscan Stud. 65, 47–60. Anacleto, P.I.C., Maulvault, A.L.I.S., Barrento, S., Mendes, R.E.R., Nunes, M.L., Rosa, R., Marques, A.O.N., 2013. Physiological responses to depuration and transport of native and exotic clams at different temperatures. Aquaculture 408–409, 136–146. Badger, M.R., Price, G.D., 1994. The role of carbonic anhydrase in photosynthesis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45, 369–392. Berland, S., Ma, Y., Marie, A., Andrieu, J.P., Bedouet, L., Feng, Q., 2013. Proteomic and profile analysis of the proteins laced with aragonite and vaterite in the freshwater mussel Hyriopsis cumingii shell biominerals. Protein Pept. Lett. 20, 1170–1180. Bertucci, A., Moya, A., Tambutte, S., Allemand, D., Supuran, C.T., Zoccola, D., 2013. Carbonic anhydrases in anthozoan corals — a review. Bioorg. Med. Chem. 21, 1437–1450. Byrne, R.A., McMahon, R.F., 1994. Behavioral and physiological responses to emersion in freshwater bivalves. Am. Zool. 34, 194–204. Christianson, D.W., Fierke, C.A., 1996. Carbonic anhydrase: evolution of the zinc binding site by nature and by design. Acc. Chem. Res. 29, 331–339. Connor, K.M., Gracey, A.Y., 2011. Circadian cycles are the dominant transcriptional rhythm in the intertidal mussel Mytilus californianus. Proc. Natl. Acad. Sci. U. S. A. 108, 16110–16115. Dalesman, S., Lukowiak, K., 2010. Effect of acute exposure to low environmental calcium on respiration and locomotion in Lymnaea stagnalis (L.). J. Exp. Biol. 213, 1471–1476. Dickinson, G.H., Ivanina, A.V., Matoo, O.B., Portner, H.O., Lannig, G., Bock, C., Beniash, E., Sokolova, I.M., 2012. Interactive effects of salinity and elevated CO2 levels on juvenile eastern oysters, Crassostrea virginica. J. Exp. Biol. 215, 29–43. Ebanks, S.C., O'Donnell, M.J., Grosell, M., 2010. Characterization of mechanisms for Ca2+ 2− and HCO− 3 /CO3 acquisition for shell formation in embryos of the freshwater common pond snail Lymnaea stagnalis. J. Exp. Biol. 213, 4092–4098. Freeman, J.A., Wilbur, K.M., 1948. Carbonic anhydrase in molluscs. Biol. Bull. 94, 55–59. Gosling, E.M., 2003. Bivalve molluscs: biology ecology and culture, Blackwell, Oxford. Heming, T.A., Vinogradov, G.A., Klerman, A.K., Komov, V.T., 1988. Acid–base regulation in the freshwater pearl mussel Margaritifera margaritifera: effects of emersion and low water pH. J. Exp. Biol. 137, 501–511. Henry, R.P., 1996. Multiple roles of carbonic anhydrase in cellular transport and metabolism. Annu. Rev. Physiol. 58, 523–538. Istin, M., Girard, J.P., 1970. Carbonic anhydrase and mobilisation of calcium reserves in the mantle of lamellibranchs. Calcif. Tissue Res. 5, 247–260. Kniprath, E., 1981. Ontogeny of the molluscan shell field: a review. Zool. Scr. 10, 61–79. Le Roy, N., Marie, B., Gaume, B., Guichard, N., Delgado, S., Zanella-Cleon, I., Becchi, M., Auzoux-Bordenave, S., Sire, J.Y., Marin, F., 2012. Identification of two carbonic anhydrases in the mantle of the European abalone Haliotis tuberculata (Gastropoda, Haliotidae): phylogenetic implications. J. Exp. Zool. B 318, 353–367. Ling, Q.X., Wang, Y., Gao, J.H., Zhu, S.B., Wang, W.L., 2008. Water quality for culturing freshwater pearl mussel, Hyriopsis cumingii in waters scatted in different regions in China. J. Shanghai Fish. Univ. 17, 328–332. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−(ΔΔCt) method. Methods 25, 402–408. Lopes-Lima, M., Bleher, R., Forg, T., Hafner, M., Machado, J., 2008. Studies on a PMCA-like protein in the outer mantle epithelium of Anodonta cygnea: insights on calcium transcellular dynamics. J. Comp. Physiol. B 178, 17–25. Lopes-Lima, M., Lopes, A., Casaca, P., Nogueira, I., Checa, A., Machado, J., 2009. Seasonal 2+ variations of pH, pCO2, pO2, HCO− in the haemolymph: implications on 3 and Ca the calcification physiology in Anodonta cygnea. J. Comp. Physiol. B. 179, 279–286. Marie, B., Luquet, G., Bedouet, L., Milet, C., Guichard, N., Medakovic, D., Marin, F., 2008. Nacre calcification in the freshwater mussel Unio pictorum: carbonic anhydrase activity and purification of a 95 kDa calcium-binding glycoprotein. ChemBioChem 9, 2515–2523.
62
G. Ren et al. / Gene 546 (2014) 56–62
Medakovic, D., 2000. Carbonic anhydrase activity and biomineralization process in embryos, larvae and adult blue mussels Mytilus edulis L. Helgol. Mar. Res. 54, 1–6. Miyamoto, H., Miyashita, T., Okushima, M., Nakano, S., Morita, T., Matsushiro, A., 1996. A carbonic anhydrase from the nacreous layer in oyster pearls. Proc. Natl. Acad. Sci. U. S. A. 93, 9657–9660. Miyamoto, H., Miyoshi, F., Kohno, J., 2005. The carbonic anhydrase domain protein nacrein is expressed in the epithelial cells of the mantle and acts as a negative regulator in calcification in the mollusc Pinctada fucata. Zool. Sci. 22, 311–315. Norizuki, M., Samata, T., 2008. Distribution and function of the nacrein-related proteins inferred from structural analysis. Mar. Biotechnol. 10, 234–241. Qiu, A.D., Shi, A.J., 1999. Effects of pH on nacre secretion of freshwater pearl mussel (Hyriopsis cumingii). Acta Zool. Sin. 45, 361–370. Ren, G., Hu, X., Tang, J., Wang, Y., 2013a. Characterization of cDNAs for calmodulin and calmodulin-like protein in the freshwater mussel Hyriopsis cumingii: differential expression in response to environmental Ca2+ and calcium binding of recombinant proteins. Comp. Biochem. Physiol. B 165, 165–171. Ren, G., Jin, Y.F., Shi, W.L., Chen, Y., 2013b. Effects of cerium(III) treatments on calcium metabolism of the freshwater pearl mussel Hyriopsis cumingii. J. Chin. Rare Earth Soc. 31, 344–352. Thorp, J.H., Covich, A.P., 2001. Ecology and classification of North American freshwater invertebrates, 2nd ed. Academic Press, San Diego.
Wang, Y., Wang, W.L., Qin, J.G., Wang, X.D., Zhu, S.B., 2009. Effects of integrated combination and quicklime supplementation on growth and pearl yield of freshwater pearl mussel, Hyriopsis cumingii (Lea, 1852). Aquac. Res. 40, 1634–1641. Werner, G.D., Gemmell, P., Grosser, S., Hamer, R., Shimeld, S.M., 2013. Analysis of a deep transcriptome from the mantle tissue of Patella vulgata Linnaeus (Mollusca: Gastropoda: Patellidae) reveals candidate biomineralising genes. Mar. Biotechnol. 15, 230–243. Xu, Z.K., Xu, Z.D., Wu, Q., 1988. Effects of temperature on the physiology of Hyriopsis cumingii. Fish. Sci. 7, 9–11. Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., Xiong, Z., Que, H., Xie, Y., Holland, P.W., Paps, J., Zhu, Y., Wu, F., Chen, Y., Wang, J., Peng, C., Meng, J., Yang, L., Liu, J., Wen, B., Zhang, N., Huang, Z., Zhu, Q., Feng, Y., Mount, A., Hedgecock, D., Xu, Z., Liu, Y., Domazet-Loso, T., Du, Y., Sun, X., Zhang, S., Liu, B., Cheng, P., Jiang, X., Li, J., Fan, D., Wang, W., Fu, W., Wang, T., Wang, B., Zhang, J., Peng, Z., Li, Y., Li, N., Wang, J., Chen, M., He, Y., Tan, F., Song, X., Zheng, Q., Huang, R., Yang, H., Du, X., Chen, L., Yang, M., Gaffney, P.M., Wang, S., Luo, L., She, Z., Ming, Y., Huang, W., Zhang, S., Huang, B., Zhang, Y., Qu, T., Ni, P., Miao, G., Wang, J., Wang, Q., Steinberg, C.E., Wang, H., Li, N., Qian, L., Zhang, G., Li, Y., Yang, H., Liu, X., Wang, J., Yin, Y., Wang, J., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54.
