.=) 1991 Oxford University Press
Nucleic Acids Research, Vol. 19, No. 13 3577-3581
Characterization of a protein binding sequence in the promoter region of the 16S rRNA gene of the spinach chloroplast genome Laurence Baeza, Alain Bertrand, Regis Mache and Silva Lerbs-Mache* Laboratoire de Biologie Moleculaire Veg6tale, Universite Joseph Fourier, CNRS URA 1178, BP 85X, F-38041 Grenoble cedex, France Received April 4, 1991; Revised and Accepted June 3, 1991
ABSTRACT By means of mobility-shift assays and Exonuclease III mapping we have determined a 14 bp sequence (named CDF2 binding site) located in front of the 16S rRNA initiation start site which is protected by a spinach chloroplast extract. This region does not include neither one of the two '- 35' nor of the two '-10' E.coli-like promoter elements which are recognised by E.coli RNA polymerase in vitro. The CDF2 binding site is specifically recognized by two small polypeptides which migrate corresponding to 35 and 33 kDa respectively as shown by UV cross-linking experiments. In vivo transcription initiation of the 16S rRNA gene occurs 13 nucleotides downstream of the 14 bp sequence and is different from the transcription start site which is used by E.coli polymerase in vitro.
INTRODUCTION The transcription of plastid rRNA operons was shown to be regulated differently than the transcription of protein coding genes during chloroplast development (1, 2). This observation was made by run-on transcription assays and hybridization experiments. The specific control of the rRNA operon seems to be logical since the 'construction' of ribosomes is surely one of the crucial processes preceding the expression of plastome encoded photosynthletic genes. On the other hand, once built up, ribosomes represent rather stable complexes compared with mRNA turnover. But, at the moment, rather nothing is known which could explain such differential gene expression in chloroplasts at a molecular level. The possibility of regulation of plastid rRNA transcription by premature termination (attenuation) has been discussed (3), but experimental proof is still lacking. Two different RNA polymerase activities, one which transcribes tRNA and mRNA genes and another which transcribes preferentially rRNA genes have been suggested to exist in chloroplasts of Euglena gracilis (4, 5). Two different enzymes may also exist in spinach chloroplasts, one which is 'E. coli-like' and another one having no immunological similarities with subunits of E. coli RNA polymerase (6). *
To whom correspondence should be addressed
On the other hand many chloroplast tRNA and mRNA genes and all 16S rRNA genes sequenced so far do contain '-35' and '-10' 'E. coli like' promoter elements upstream of the transcription initiation start sites, and it was shown using in vitro transcription assays that they are implicated in the correct transcription of the genes (7-9). Consequently, tRNA, mRNA and rRNA genes could well be transcribed by the same type of 'E. coli like' chloroplast RNA polymerase. In spinach plastids the situation is still more complicated, since the 16S rRNA upstream region contains two tandem 'E. coli-like' promoter elements which are both used in vitro by E. coli RNA polymerase (10) but only one of them seems to be used in vivo (11). Therefore the questions arise how the chloroplast RNA polymerase(s) discriminate(s) between the two promoters and whether the second promoter is used under specific developmental or physiological conditions. As a first approach to find differences between these two promoters and/or 'specificities' of plastid rRNA upstream sequences we looked for putative cis acting regulatory elements and corresponding sequence-specific DNA binding proteins which might be implicated in the regulation of rRNA gene expression. Using mobility shift assays, Exonuclease III protection experiments and UV cross-linking we have determined a 14 bp protected sequence which does not include the 'E. coli-like' promoter elements and to which two small molecular weight chloroplast proteins can bind in a sequence-specific manner. This sequence is well conserved in all higher plant chloroplast 16S rRNA upstream regions known so far but is not found upstream of mRNA or tRNA coding chloroplast genes, thus it might be specific for rRNA genes. Possible functions of this sequence are discussed.
MATERIALS AND METHODS Preparation of the spinach chloroplast extract Intact spinach chloroplasts were prepared by homogenisation of 500g of leaves from young spinach plants (3 weeks old, leaves not larger than 5cm in length) in 1.5 1 of GR medium (0.33 M sorbitol,2 mM EDTA, 1 mM MnCl2, 1 mM MgCl2, 1mM Na4P207, 50 mM HEPES/NaOH, pH 6,8) according to
3578 Nucleic Acids Research, Vol. 19, No. 13 Morgenthaler and Price (12). The filtered homogenate was centrifuged for 30s at 6,000 rpm in a Dupont Sorvall GSA rotor. The pellet was resuspended in 72 ml of GR and intact chloroplasts were recovered from 12 30ml-two-layer Percoll gradients (13). Chloroplasts were diluted with 2 volumes of GR and pelleted by centrifugation for 2 min at 5,000 rpm in a Sorvall SS-34 rotor. The chloroplasts were resuspended in 150 ml PA (50 mM Tris/HCl pH 7.8, 1mM EDTA, 1mM DTT, 100 mM (NH4)2SO4, 1mM benzamidine and 1mM phenylmethylsulfonyl fluoride) and homogenized with a Polytron for 3 times 1 s. Glycerol was added to a final concentration of 25% and the homogenate was centrifuged for lh at 20,000 rpm in a Beckman JA-20 rotor (48,400 x g). The supematant was loaded on a 6 ml heparin-Sepharose column, washed with 30 ml PB (PA containing 25% glycerol and 0.1 % Triton X-100) and proteins were eluted with a linear gradient of 100 mM to 1.5 M (NH4)2SO4 in PB (20 ml each). Protein fractions eluting with 300 to 600 mM (NH4)2SO4 were dialysed against PA containing 15 mM (NH4)2SO4 and stored in small aliquots under liquid nitrogen until use. Mobility shift assays and Exonuclease Ill protection Gel retardation assays were done according to Straney and Crothers (14). All reaction mixtures (20 ,ul) contained 44 mM Tris, pH 8.0, 10 mM NaCl, 0.4 mM EDTA, 0.8 mM DTT, 1 jig of poly(dI dC), 1 ng of labelled DNA, 5 Id of chloroplast protein extract or 0.1 units E. coli RNA polymerase and 1.85 mM MgCl2 if not otherwise indicated. Following incubation at 30°C for 15 min the DNA protein complexes were analysed on 4% polyacrylamide gels under non-denaturing conditions as described elsewhere (14). The sequences of the synthetic oligonucleotides arranged according to the 5' overhanging ends which will result after hybridization are shown below: oligo 1 oligo 2 oligo 3 oligo 4 oligo 5 oligo 6
5'GAGAATGAATAAGAGGCTCGTGGGATT TTACTTATTCTCCGAGCACCCTAACTC 5' 5'GATACAAGTTATGCCTTGGAATGAA TGTTCAATACGGAACCTTACTTTCT 5' 5' TTTAGTTCCACCCGAAGAAGCAGGGCCA TCAAGGTGGGCTTCTTCGTCCCGG
For gel retardation 0.5 ng each of oligo 1 and 2, or 3 and 4, or 5 and 6, were hybridized in 30 td of 40 mM PIPES, pH 6.4, 1 mM EDTA, 0.4 mM NaCl and 80% formamide over night at 42°C. Afterwards, the resulting 5' overhanging ends were filled in using labelled dATP and/or dGTP and Klenow enzyme as described (16). The oligonucleotide hybrids were purified on 15% non-denaturing polyacrylamide gels and eluted from the gel as described for single stranded oligonucleotides (16). For competition assays the hybrids were used directly after precipitation from the hybridization solution without further
purification. Exonuclease III protection assays were performed according to Lam et al. (15). The 274 bp fragment was labelled with T4 polynucleotide kinase and [,y-32P]ATP. UV cross-linking The binding reaction was carried out under the same conditions as for gel retardation assays. Tubes containing 20 Al of reaction mixture were covered with Saran wrap and placed at a distance of 4.5 cm under a Min UVIS transilluminator (Desaga). After irradiation at 254 nm for 30 min the samples were analysed on 10% denaturing polyacrylamide SDS gels.
.I
Mg
-
-
-
+
Ut
4
-
Figure 1. Mg'+ dependence of the DNA protein complex formation. The labelled promoter containing 274 bp fragment was incubated without enzyme (lane 1), with E.coli RNA polymerase (lanes 2 and 3) or spinach chloroplast extract (lanes 4 to 6), in the absence (lanes 3 and 4) or in the presence of 1.85 mM Mg++ (lane 4) or 5 mM Mg++ (lanes 1, 2 and 6) and assayed for complex formation by gel retardation.
281 271 234 194
-
X
8 -88
118 s
72
-100
_123
r Xa
'4 $'
~~~;,5 e it
Figure 2. Exonuclease III mapping of the chloroplast protein binding site on the 274 bp promoter-containing fragment. 1 ng of 5' end labelled DNA was incubated without (lanes 1 and 2) or with 10 pJ (lanes 4 and 5) and 15 p1 (lanes 6 and 7) of spinach extract at 30°C for 15 min. After digestion with 35 units (lanes 1, 4 and 6) or 70 units (lanes 2, 5 and 7) of Exonuclease IlH samples were extracted with phenol/CHC13 and separated on urea/polyacrylamnide gels. As molecular size standards labelled OX-174-RF/ Hae Ill DNA fragments were used (lane 3). The number of bases are given at the left side of the figure.
Primer extension For primer extension analysis the 25 bp oligonucleotide (oligo 4) was hybridized to total RNA prepared from leaves of light or dark grown one week old spinach seedlings. Oligonucleotide labelling, hybridization and reverse transcriptase reaction were performed as described (16).
Nucleic Acids Research, Vol. 19, No. 13 3579
B
A --35'.
AATTTCCCCGAGCCTGATTATCCCTAAACCCAACGTCAGTTTTTCTATTTTGACTTGCT ----===
Pa "-35's ,-lo TAT T-TGACGTGAGGGGGT CCCCCGCCGTGATTGAATGAGAATGAA
Pi
> oliqo 1ad 2 P2 ,.-l* o.hal
16 S rRNA
1
AAGTAATGCAACTATGAATCTCATGGAGAG;TTCGGGG
2
3
4
Figure 3. Mobility shift assays of the chloroplast extract with the two fragments resulting after cleavage of the 274 bp fragment with HhaI. A: The nucleotide sequence of the 270 bp non-transcribed strand with the corresponding Hha I restriction endonuclease cleavage site. The 5' and 3' ends of the fragment result from the cleavage by Eco RI, thus the double stranded fragment is 4 bp longer. The E.coli-like '-10' and '-35' promoter elements are underlined. The two initiation start sites of E. coli RNA polymerase in vitro are marked P1 and P2. Pc corresponds to the in vivo initiation start site (see below). The positions of synthesized oligonucleotides are marked below the sequence. B: 1 ng of the promoter-containing 163 bp fragment (lanes 1 and 2) or of the 111 bp fragment (lanes 3 and 4) were incubated at 30°C for 15 min without (lanes 1 and 3) or with chloroplast extract (lanes 2 and 4) and analysed by gel-electrophoresis.
RESULTS Mobility shift assays were performed in the absence or in the of 1.85 or 5 mM Mg+ + using the 274 bp fragment shown in Fig.3 and E. coli RNA polymerase or chloroplast extracts prepared as described in Materials and Methods (Fig. 1). In both cases complex formation is strongly dependent on the concentration of Mg+ +. In the presence of 5 mM Mg+ + and chloroplast extract two DNA protein complexes are formed (lane 6). One of them has about the same mobility as the complex which is formed in the presence of E. coli polymerase (compare lanes 6 and 2). The smaller one of the two complexes (lane 6) is still formed at 1.85 mM Mg+ + (lane 5) but not in the absence of Mg++ (lane 4). All following experiments were performed with chloroplast extracts at 1.85 mM Mg+ +,i.e. only the smaller one of the two complexes was examined. The Exonuclease IH digestion pattern shows two fragments which are protected by the spinach extract: one of 188 and one of about 100 bp (Fig. 2, lanes 4-7). Since the DNA fragment was labelled on both 5' ends the protected region could be located between bases 86 and 100 or between bases 174 and 188 on the non-transcribed DNA strand (compare bold printed sequences in Fig. 3A). To discriminate between these two possibilities the 274 bp 5'end labelled fragment was cleaved by HhaI yielding two fragments of 163 and 111 bp respectively (see Fig. 3A). Both fragments were tested for complex formation in gel retardation assays (Fig. 3B). Only the 163 bp fragment, which contains the two E. coli-like promoter elements, gives a mobility shift in the presence of the chloroplast extract (lane 2). As additional control experiments mobility shift assays were performed using labelled oligonucleotide hybrids corresponding to the two sequences in question (oligo 1/2 and oligo 3/4, Fig. 3A) and in addition to an intragenic part of the spinach rbcL gene (oligo 5/6; for sequence see Materials and Methods). The formation of a DNA protein complex is only observed in the presence of oligonucleotide hybrid 1/2 (Fig. 4A). This confirms the sequence specificity of the binding. In another experiment retardation assays
A
presence
1
2 3 4
5 6
B
1
2 3 4 5 6 7
8
Figure 4. Mobility shift assays of the chloroplast extract with different oligonucleotides (A) or with the 274 bp fragment in the presence of unlabelled oligonucleotides as competitor (B). A: Labelled oligonucleotide hybrids (1 ng, 14,000 cpm) 1/2 (lanes 1 and 2) 3/4 (lanes 3 and 4) and 5/6 (lanes 5 and 6; for sequences see Materials and Methods) were incubated without (lanes 1, 3, 5) or with chloroplast extract (lanes 2, 4, 6) and analysed for DNA protein complex formation. B: The labelled 274 bp fragment was incubated without (lane 1) or with chloroplast extract (lanes 2-8) in the presence of 1 ytg poly(dIdC) and 3 Mg (lane 3) 300 ng (lane 4) or 50 ng (lane 5) of oligonucleotide hybrids 1/2 or with 3 Ag (lane 6), 300 ng (lane 7) or 50 ng (lane 8) oligonucleotide hybrids 3/4.
carried out using the labelled 274 bp fragment and increasing amounts of unlabelled oligonucleotide hybrids 1/2 or 3/4 (Fig. 4B). Only the oligonucleotide hybrids 1/2 can act as competitor for protein binding (lane 3). This result shows that the mobility shift obtained with the large 274 bp fragment is
were
3580 Nucleic Acids Research, Vol. 19, No. 13 " -35" GAGAATGAAT
ALQAGGCYCNGQrG
ATTG
Spinach
(17)
GAATGGAT
AAaG&CC !QaG
ATTG
Tobacco
(18)
GAATGGAT
A&GAGCNCTOGGG
ATTG
Sinapis alba
(19)
92-
GAGAATGGAT
ALQAOOGCYCQON
ATTA
Soybean
(20)
67-
CTGAGTAGAT
A&AQQG- atagg0a
GTTG
Pea
(21)
AAQ&QKCCoGGGG
ATTG
Spirodela oligorhiza
(22)
TTGTTATTGA
AAGOOOCYtONQOO
ATTG
Marchantia polymorpha (23)
GGGAATGGAT
AgQ&GWCtOv!O
ATTG
Zea mays
(24)
GGGAATGGAT
AG&OGCYtG?GQG
ATTG
Rice
(25)
GAGAATGAAT
45-
29-
Figure 5. Two polypeptides migrating in the region of 35 and 33 kDa are specifically cross-linked to oligonucleotide hybrids 1/2. Labelled oligonucleotide hybrids (5 ng; 70,000 cpm) 1/2 (lane 1); 3/4 (lane 2) and 5/6 (lane 3) were incubated with chloroplast extract and irradiated by UV as described in Materials and Methods. DNA protein complexes were analysed by SDS-PAGE. Control experiments, containing no protein are comparable with lanes 2 and 3 (not shown).
-
_
a
-p :: 0
9_
.0._
l_ _ f
--
c\ c c c c
ip
T
m O
A
small proteins can be detected which migrate according to molecular weights of about 35 and 33 kDa (lane 1). Neither the hybrids 3/4 nor those corresponding to a fragment of the rbcL gene are linked to polypeptides under the same experimental conditions, i.e. the binding of the two polypeptides to the oligonucleotide hybrid 1/2 is sequence specific. If we now regard the protected region in more detail we find that it is located between the ' -10' E. coli-like promoter element of the first promoter and the '-35' element of the second promoter. It covers the transcription initiation start site which is used by E.coli polymerase in vitro (P1 in Fig. 3; 10). SI nuclease mapping of in vivo 16S rRNA transcripts located the transcription initiation also to this region but the start site was not determined precisely (10, 11). To assure that in vivo the transcription of 16S rRNA starts indeed inside of the 14 bp protected region described above we mapped the 5' termini of 16S rRNA transcripts by primer extension (Fig. 6). Surprisingly, it was found that E. coli polymerase and spinach chloroplast RNA polymerase evidently do not use the same site for initiation. The in vivo transcript starts 27 bp downstream of P1 outside of the protected region. We named it Pc (for promoter chloroplast, see Fig. 3A).
DISCUSSION
;-0
_-
ACGT
Figure 7. Comparison of 16S rRNA upstream sequences including the CDF2 binding motif. References are given at the right side. The start of the '-35' region of the E.coli-like promoters are underlined.
L
D
Figure 6. Mapping of the putative in vivo transcription initiation start site by primer extension. Total RNA from 1 week old light grown (L) or dark grown (D) spinach seedlings were hybridized to labelled oligonucleotide 4 (100,000 cpm) for primer extension. The sequencing reaction was performed with the same primer.
indeed only related to the small sequence represented by the oligonucleotides 1 and 2. Finally, the DNA binding protein(s) were characterized by UV cross-linking to the labelled oligonucleotide hybrids and subsequent analysis by SDS-PAGE (Fig. 5). Only oligonucleotide hybrids 1/2 are covalently linked to proteins by this assay. Two
A region of about 14 bp, which is located 13 bp upstream of the transcription initiation start site of 16S rRNA, was found to be protected by a spinach chloroplast extract. In analogy to the first sequence-specific DNA binding factor which was described so far (15) we propose to name this region binding site of CDF2 (chloroplast DNA binding factor 2). Considering the position of this binding site one could imagine the binding of a repressor as well as an initiation factor. The small size of the region rather excludes that it could be RNA polymerase itself. Binding of chloroplast RNA polymerase is more likely under higher Mg++ concentrations when the larger complex is formed whose size is more comparable to the complex which is formed with E. coli RNA polymerase (see Fig. 1). A comparison of chloroplast 16S rRNA upstream regions containing this sequence is shown in Fig.7. Regions analogous to the CDF2 binding site are boxed. A computer search for the presence of this sequence upstream of chloroplast mRNA and tRNA genes was negative. Thus it seems to be specific for chloroplast rRNA genes of higher plants.
Nucleic Acids Research, Vol. 19, No. 13 3581 Transcription initiation start sites for 16S rRNA were mapped precisely in maize (24), Spirodela(22) and pea (21). It is interesting to mention that in Spirodela as in spinach, two E. colilike promoter sequences exist. However, in Spirodela, the binding site of CDF2 is located upstream of the first promoter sequence and not, as in spinach, upstream of the second promoter sequence. Transcription initiation starts in the region of the first promoter, the second promoter is not used. A detailed analysis of transcription initiation in vitro was made in pea (21). Deletion analysis of the 5' regulatory sequences of the gene have shown that 54 bp upstream of the transcription initiation start site are necessary for correct initiation. Interestingly, the first deletion which results in a complete loss of the capacity of correct initiation was located at position -45 on the pea sequence (see 21), i.e. when the first A at the 5' end of the CDF2 binding site is removed. Thus the idea emerges that the CDF2 binding site may be rather implicated in the process of correct initiation of transcription of 16S rRNA than in its repression. To know something more on a possible role of the CDF2 binding site in the regulation of transcription experiments are in progress to isolate the two proteins and to test their function in vitro.
ACKNOWLEDGEMENT We thank Dr. A.-M.Lescure for providing the 274 bp fragment of the 16S rRNA for recloning in pUC 18.
REFERENCES 1. 2. 3. 4.
5.
6. 7. 8. 9. 10. 11.
12. 13. 14. 15. 16. 17.
18. 19. 20. 21. 22. 23.
Mullet, J.E. and Klein, R.R. (1987) EMBO J. 6, 1571-1579. Klein, R.R. and Mullet, J.E. (1990) J. Biol. Chem. 265, 1895-1902. Briat, J.F., Dron, M. and Mache, R. (1983) FEBS Lett. 163, 1-5. Greenberg, B.M., Narita, J.O., De-Luca-Flaherty, C., Gruissem, W., Rushlow, K.A. and Hallick, R.B. (1984) J. Bio. Chem. 259, 14880-14887. Narita, O.J., Rushlow, E.K. and Hallick, R.B. (1985) J. Biol. Chem. 260, 11194-11199. Lerbs, S., Brautigam, E. and Mache, R (1988) Mol. Gen. Genet.211, 459-464. Gruissem, W. and Zurawski, G. (1985a) EMBO J. 4, 1637-1644. Gruissem, W. and Zurawski, G. (1985b) EMBO J. 4, 3375-3383 Link, G. (1984) EMBO J. 3, 1697-1704. Lescure, A.M., Bisanz-Seyer, C., Pesey, H. and Mache, R. (1985) Nucl. Acids Res. 13, 8787-8796. Briat, J.F., Bisanz-Seyer, C. and Lescure, A.M. (1987) Curr. Genet. 11, 259-263 Morgenthaler, J.J., Marsden, M.P.F. and Price, C.A. (1975) Arch. Biochem. Biophys. 168, 289-301. Douce, R. and Joyard, J. (1982) In Edelman et al. (eds), Methods in Chloroplast Molecular Biology, Elsevier Biomedical Press, Amsterdam. Straney, D.C. and Crothers, D.M. (1985) Cell 43, 449-459. Lam, E., Hanley-Bowdoin, L. and Chua, N.H. (1988) J. Biol. Chem. 263, 8288-8293. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Briat, J.F., Dron, M., Loiseaux, S. and Mache, R. (1982) Nucl. Acids Res. 10, 6865-6878. Todoh, N., Shinozaki, K. and Sugiura, M. (1981) Nucl. Acids Res. 9, 5399-5406. Przybyl, D., Fritzsche, E., Edwards, K., Kossel, H., Falk, H., Thompson, J.A. and Link, G. (1984) Plant Mol. Biol. 3, 147-158. Allmen von, J.M. and Stutz, E. (1988) Nucl. Acids Res. 16, 1200. Sun, E., Wu, B.W. and Tewari, K.K. (1989) Mol. Cell. Biol. 9, 5650-5659. Keus, R.J.A., Dekker, A.F., Roon van, M.A. and Groot, G.S.P. (1983) Nucl. Acids Res. 11, 6465-6474. Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T, Sano, S., Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S., Inokuchi, H. and Ozeki, H. (1986) Nature 322, 572-574.
24. Strittmatter, G., Gozdzicka-Josefiak, A. and Kossel, H. (1985) EMBO J. 4, 599-604. 25. Hiratsuka, J. Shimada, H., Whittier, R., Ishibashi, T., Sakamoto, M., Mori, M. Kondo, C., Honji, Y., Sun, C.R., Meng, B.Y., Li, Y.Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K. and Sugiura, M. (1989) Moi. Gen. Genet. 217, 185-194.
Nucleic Acids Research, Vol. 19, No. 13 3577-3581
Characterization of a protein binding sequence in the promoter region of the 16S rRNA gene of the spinach chloroplast genome Laurence Baeza, Alain Bertrand, Regis Mache and Silva Lerbs-Mache* Laboratoire de Biologie Moleculaire Veg6tale, Universite Joseph Fourier, CNRS URA 1178, BP 85X, F-38041 Grenoble cedex, France Received April 4, 1991; Revised and Accepted June 3, 1991
ABSTRACT By means of mobility-shift assays and Exonuclease III mapping we have determined a 14 bp sequence (named CDF2 binding site) located in front of the 16S rRNA initiation start site which is protected by a spinach chloroplast extract. This region does not include neither one of the two '- 35' nor of the two '-10' E.coli-like promoter elements which are recognised by E.coli RNA polymerase in vitro. The CDF2 binding site is specifically recognized by two small polypeptides which migrate corresponding to 35 and 33 kDa respectively as shown by UV cross-linking experiments. In vivo transcription initiation of the 16S rRNA gene occurs 13 nucleotides downstream of the 14 bp sequence and is different from the transcription start site which is used by E.coli polymerase in vitro.
INTRODUCTION The transcription of plastid rRNA operons was shown to be regulated differently than the transcription of protein coding genes during chloroplast development (1, 2). This observation was made by run-on transcription assays and hybridization experiments. The specific control of the rRNA operon seems to be logical since the 'construction' of ribosomes is surely one of the crucial processes preceding the expression of plastome encoded photosynthletic genes. On the other hand, once built up, ribosomes represent rather stable complexes compared with mRNA turnover. But, at the moment, rather nothing is known which could explain such differential gene expression in chloroplasts at a molecular level. The possibility of regulation of plastid rRNA transcription by premature termination (attenuation) has been discussed (3), but experimental proof is still lacking. Two different RNA polymerase activities, one which transcribes tRNA and mRNA genes and another which transcribes preferentially rRNA genes have been suggested to exist in chloroplasts of Euglena gracilis (4, 5). Two different enzymes may also exist in spinach chloroplasts, one which is 'E. coli-like' and another one having no immunological similarities with subunits of E. coli RNA polymerase (6). *
To whom correspondence should be addressed
On the other hand many chloroplast tRNA and mRNA genes and all 16S rRNA genes sequenced so far do contain '-35' and '-10' 'E. coli like' promoter elements upstream of the transcription initiation start sites, and it was shown using in vitro transcription assays that they are implicated in the correct transcription of the genes (7-9). Consequently, tRNA, mRNA and rRNA genes could well be transcribed by the same type of 'E. coli like' chloroplast RNA polymerase. In spinach plastids the situation is still more complicated, since the 16S rRNA upstream region contains two tandem 'E. coli-like' promoter elements which are both used in vitro by E. coli RNA polymerase (10) but only one of them seems to be used in vivo (11). Therefore the questions arise how the chloroplast RNA polymerase(s) discriminate(s) between the two promoters and whether the second promoter is used under specific developmental or physiological conditions. As a first approach to find differences between these two promoters and/or 'specificities' of plastid rRNA upstream sequences we looked for putative cis acting regulatory elements and corresponding sequence-specific DNA binding proteins which might be implicated in the regulation of rRNA gene expression. Using mobility shift assays, Exonuclease III protection experiments and UV cross-linking we have determined a 14 bp protected sequence which does not include the 'E. coli-like' promoter elements and to which two small molecular weight chloroplast proteins can bind in a sequence-specific manner. This sequence is well conserved in all higher plant chloroplast 16S rRNA upstream regions known so far but is not found upstream of mRNA or tRNA coding chloroplast genes, thus it might be specific for rRNA genes. Possible functions of this sequence are discussed.
MATERIALS AND METHODS Preparation of the spinach chloroplast extract Intact spinach chloroplasts were prepared by homogenisation of 500g of leaves from young spinach plants (3 weeks old, leaves not larger than 5cm in length) in 1.5 1 of GR medium (0.33 M sorbitol,2 mM EDTA, 1 mM MnCl2, 1 mM MgCl2, 1mM Na4P207, 50 mM HEPES/NaOH, pH 6,8) according to
3578 Nucleic Acids Research, Vol. 19, No. 13 Morgenthaler and Price (12). The filtered homogenate was centrifuged for 30s at 6,000 rpm in a Dupont Sorvall GSA rotor. The pellet was resuspended in 72 ml of GR and intact chloroplasts were recovered from 12 30ml-two-layer Percoll gradients (13). Chloroplasts were diluted with 2 volumes of GR and pelleted by centrifugation for 2 min at 5,000 rpm in a Sorvall SS-34 rotor. The chloroplasts were resuspended in 150 ml PA (50 mM Tris/HCl pH 7.8, 1mM EDTA, 1mM DTT, 100 mM (NH4)2SO4, 1mM benzamidine and 1mM phenylmethylsulfonyl fluoride) and homogenized with a Polytron for 3 times 1 s. Glycerol was added to a final concentration of 25% and the homogenate was centrifuged for lh at 20,000 rpm in a Beckman JA-20 rotor (48,400 x g). The supematant was loaded on a 6 ml heparin-Sepharose column, washed with 30 ml PB (PA containing 25% glycerol and 0.1 % Triton X-100) and proteins were eluted with a linear gradient of 100 mM to 1.5 M (NH4)2SO4 in PB (20 ml each). Protein fractions eluting with 300 to 600 mM (NH4)2SO4 were dialysed against PA containing 15 mM (NH4)2SO4 and stored in small aliquots under liquid nitrogen until use. Mobility shift assays and Exonuclease Ill protection Gel retardation assays were done according to Straney and Crothers (14). All reaction mixtures (20 ,ul) contained 44 mM Tris, pH 8.0, 10 mM NaCl, 0.4 mM EDTA, 0.8 mM DTT, 1 jig of poly(dI dC), 1 ng of labelled DNA, 5 Id of chloroplast protein extract or 0.1 units E. coli RNA polymerase and 1.85 mM MgCl2 if not otherwise indicated. Following incubation at 30°C for 15 min the DNA protein complexes were analysed on 4% polyacrylamide gels under non-denaturing conditions as described elsewhere (14). The sequences of the synthetic oligonucleotides arranged according to the 5' overhanging ends which will result after hybridization are shown below: oligo 1 oligo 2 oligo 3 oligo 4 oligo 5 oligo 6
5'GAGAATGAATAAGAGGCTCGTGGGATT TTACTTATTCTCCGAGCACCCTAACTC 5' 5'GATACAAGTTATGCCTTGGAATGAA TGTTCAATACGGAACCTTACTTTCT 5' 5' TTTAGTTCCACCCGAAGAAGCAGGGCCA TCAAGGTGGGCTTCTTCGTCCCGG
For gel retardation 0.5 ng each of oligo 1 and 2, or 3 and 4, or 5 and 6, were hybridized in 30 td of 40 mM PIPES, pH 6.4, 1 mM EDTA, 0.4 mM NaCl and 80% formamide over night at 42°C. Afterwards, the resulting 5' overhanging ends were filled in using labelled dATP and/or dGTP and Klenow enzyme as described (16). The oligonucleotide hybrids were purified on 15% non-denaturing polyacrylamide gels and eluted from the gel as described for single stranded oligonucleotides (16). For competition assays the hybrids were used directly after precipitation from the hybridization solution without further
purification. Exonuclease III protection assays were performed according to Lam et al. (15). The 274 bp fragment was labelled with T4 polynucleotide kinase and [,y-32P]ATP. UV cross-linking The binding reaction was carried out under the same conditions as for gel retardation assays. Tubes containing 20 Al of reaction mixture were covered with Saran wrap and placed at a distance of 4.5 cm under a Min UVIS transilluminator (Desaga). After irradiation at 254 nm for 30 min the samples were analysed on 10% denaturing polyacrylamide SDS gels.
.I
Mg
-
-
-
+
Ut
4
-
Figure 1. Mg'+ dependence of the DNA protein complex formation. The labelled promoter containing 274 bp fragment was incubated without enzyme (lane 1), with E.coli RNA polymerase (lanes 2 and 3) or spinach chloroplast extract (lanes 4 to 6), in the absence (lanes 3 and 4) or in the presence of 1.85 mM Mg++ (lane 4) or 5 mM Mg++ (lanes 1, 2 and 6) and assayed for complex formation by gel retardation.
281 271 234 194
-
X
8 -88
118 s
72
-100
_123
r Xa
'4 $'
~~~;,5 e it
Figure 2. Exonuclease III mapping of the chloroplast protein binding site on the 274 bp promoter-containing fragment. 1 ng of 5' end labelled DNA was incubated without (lanes 1 and 2) or with 10 pJ (lanes 4 and 5) and 15 p1 (lanes 6 and 7) of spinach extract at 30°C for 15 min. After digestion with 35 units (lanes 1, 4 and 6) or 70 units (lanes 2, 5 and 7) of Exonuclease IlH samples were extracted with phenol/CHC13 and separated on urea/polyacrylamnide gels. As molecular size standards labelled OX-174-RF/ Hae Ill DNA fragments were used (lane 3). The number of bases are given at the left side of the figure.
Primer extension For primer extension analysis the 25 bp oligonucleotide (oligo 4) was hybridized to total RNA prepared from leaves of light or dark grown one week old spinach seedlings. Oligonucleotide labelling, hybridization and reverse transcriptase reaction were performed as described (16).
Nucleic Acids Research, Vol. 19, No. 13 3579
B
A --35'.
AATTTCCCCGAGCCTGATTATCCCTAAACCCAACGTCAGTTTTTCTATTTTGACTTGCT ----===
Pa "-35's ,-lo TAT T-TGACGTGAGGGGGT CCCCCGCCGTGATTGAATGAGAATGAA
Pi
> oliqo 1ad 2 P2 ,.-l* o.hal
16 S rRNA
1
AAGTAATGCAACTATGAATCTCATGGAGAG;TTCGGGG
2
3
4
Figure 3. Mobility shift assays of the chloroplast extract with the two fragments resulting after cleavage of the 274 bp fragment with HhaI. A: The nucleotide sequence of the 270 bp non-transcribed strand with the corresponding Hha I restriction endonuclease cleavage site. The 5' and 3' ends of the fragment result from the cleavage by Eco RI, thus the double stranded fragment is 4 bp longer. The E.coli-like '-10' and '-35' promoter elements are underlined. The two initiation start sites of E. coli RNA polymerase in vitro are marked P1 and P2. Pc corresponds to the in vivo initiation start site (see below). The positions of synthesized oligonucleotides are marked below the sequence. B: 1 ng of the promoter-containing 163 bp fragment (lanes 1 and 2) or of the 111 bp fragment (lanes 3 and 4) were incubated at 30°C for 15 min without (lanes 1 and 3) or with chloroplast extract (lanes 2 and 4) and analysed by gel-electrophoresis.
RESULTS Mobility shift assays were performed in the absence or in the of 1.85 or 5 mM Mg+ + using the 274 bp fragment shown in Fig.3 and E. coli RNA polymerase or chloroplast extracts prepared as described in Materials and Methods (Fig. 1). In both cases complex formation is strongly dependent on the concentration of Mg+ +. In the presence of 5 mM Mg+ + and chloroplast extract two DNA protein complexes are formed (lane 6). One of them has about the same mobility as the complex which is formed in the presence of E. coli polymerase (compare lanes 6 and 2). The smaller one of the two complexes (lane 6) is still formed at 1.85 mM Mg+ + (lane 5) but not in the absence of Mg++ (lane 4). All following experiments were performed with chloroplast extracts at 1.85 mM Mg+ +,i.e. only the smaller one of the two complexes was examined. The Exonuclease IH digestion pattern shows two fragments which are protected by the spinach extract: one of 188 and one of about 100 bp (Fig. 2, lanes 4-7). Since the DNA fragment was labelled on both 5' ends the protected region could be located between bases 86 and 100 or between bases 174 and 188 on the non-transcribed DNA strand (compare bold printed sequences in Fig. 3A). To discriminate between these two possibilities the 274 bp 5'end labelled fragment was cleaved by HhaI yielding two fragments of 163 and 111 bp respectively (see Fig. 3A). Both fragments were tested for complex formation in gel retardation assays (Fig. 3B). Only the 163 bp fragment, which contains the two E. coli-like promoter elements, gives a mobility shift in the presence of the chloroplast extract (lane 2). As additional control experiments mobility shift assays were performed using labelled oligonucleotide hybrids corresponding to the two sequences in question (oligo 1/2 and oligo 3/4, Fig. 3A) and in addition to an intragenic part of the spinach rbcL gene (oligo 5/6; for sequence see Materials and Methods). The formation of a DNA protein complex is only observed in the presence of oligonucleotide hybrid 1/2 (Fig. 4A). This confirms the sequence specificity of the binding. In another experiment retardation assays
A
presence
1
2 3 4
5 6
B
1
2 3 4 5 6 7
8
Figure 4. Mobility shift assays of the chloroplast extract with different oligonucleotides (A) or with the 274 bp fragment in the presence of unlabelled oligonucleotides as competitor (B). A: Labelled oligonucleotide hybrids (1 ng, 14,000 cpm) 1/2 (lanes 1 and 2) 3/4 (lanes 3 and 4) and 5/6 (lanes 5 and 6; for sequences see Materials and Methods) were incubated without (lanes 1, 3, 5) or with chloroplast extract (lanes 2, 4, 6) and analysed for DNA protein complex formation. B: The labelled 274 bp fragment was incubated without (lane 1) or with chloroplast extract (lanes 2-8) in the presence of 1 ytg poly(dIdC) and 3 Mg (lane 3) 300 ng (lane 4) or 50 ng (lane 5) of oligonucleotide hybrids 1/2 or with 3 Ag (lane 6), 300 ng (lane 7) or 50 ng (lane 8) oligonucleotide hybrids 3/4.
carried out using the labelled 274 bp fragment and increasing amounts of unlabelled oligonucleotide hybrids 1/2 or 3/4 (Fig. 4B). Only the oligonucleotide hybrids 1/2 can act as competitor for protein binding (lane 3). This result shows that the mobility shift obtained with the large 274 bp fragment is
were
3580 Nucleic Acids Research, Vol. 19, No. 13 " -35" GAGAATGAAT
ALQAGGCYCNGQrG
ATTG
Spinach
(17)
GAATGGAT
AAaG&CC !QaG
ATTG
Tobacco
(18)
GAATGGAT
A&GAGCNCTOGGG
ATTG
Sinapis alba
(19)
92-
GAGAATGGAT
ALQAOOGCYCQON
ATTA
Soybean
(20)
67-
CTGAGTAGAT
A&AQQG- atagg0a
GTTG
Pea
(21)
AAQ&QKCCoGGGG
ATTG
Spirodela oligorhiza
(22)
TTGTTATTGA
AAGOOOCYtONQOO
ATTG
Marchantia polymorpha (23)
GGGAATGGAT
AgQ&GWCtOv!O
ATTG
Zea mays
(24)
GGGAATGGAT
AG&OGCYtG?GQG
ATTG
Rice
(25)
GAGAATGAAT
45-
29-
Figure 5. Two polypeptides migrating in the region of 35 and 33 kDa are specifically cross-linked to oligonucleotide hybrids 1/2. Labelled oligonucleotide hybrids (5 ng; 70,000 cpm) 1/2 (lane 1); 3/4 (lane 2) and 5/6 (lane 3) were incubated with chloroplast extract and irradiated by UV as described in Materials and Methods. DNA protein complexes were analysed by SDS-PAGE. Control experiments, containing no protein are comparable with lanes 2 and 3 (not shown).
-
_
a
-p :: 0
9_
.0._
l_ _ f
--
c\ c c c c
ip
T
m O
A
small proteins can be detected which migrate according to molecular weights of about 35 and 33 kDa (lane 1). Neither the hybrids 3/4 nor those corresponding to a fragment of the rbcL gene are linked to polypeptides under the same experimental conditions, i.e. the binding of the two polypeptides to the oligonucleotide hybrid 1/2 is sequence specific. If we now regard the protected region in more detail we find that it is located between the ' -10' E. coli-like promoter element of the first promoter and the '-35' element of the second promoter. It covers the transcription initiation start site which is used by E.coli polymerase in vitro (P1 in Fig. 3; 10). SI nuclease mapping of in vivo 16S rRNA transcripts located the transcription initiation also to this region but the start site was not determined precisely (10, 11). To assure that in vivo the transcription of 16S rRNA starts indeed inside of the 14 bp protected region described above we mapped the 5' termini of 16S rRNA transcripts by primer extension (Fig. 6). Surprisingly, it was found that E. coli polymerase and spinach chloroplast RNA polymerase evidently do not use the same site for initiation. The in vivo transcript starts 27 bp downstream of P1 outside of the protected region. We named it Pc (for promoter chloroplast, see Fig. 3A).
DISCUSSION
;-0
_-
ACGT
Figure 7. Comparison of 16S rRNA upstream sequences including the CDF2 binding motif. References are given at the right side. The start of the '-35' region of the E.coli-like promoters are underlined.
L
D
Figure 6. Mapping of the putative in vivo transcription initiation start site by primer extension. Total RNA from 1 week old light grown (L) or dark grown (D) spinach seedlings were hybridized to labelled oligonucleotide 4 (100,000 cpm) for primer extension. The sequencing reaction was performed with the same primer.
indeed only related to the small sequence represented by the oligonucleotides 1 and 2. Finally, the DNA binding protein(s) were characterized by UV cross-linking to the labelled oligonucleotide hybrids and subsequent analysis by SDS-PAGE (Fig. 5). Only oligonucleotide hybrids 1/2 are covalently linked to proteins by this assay. Two
A region of about 14 bp, which is located 13 bp upstream of the transcription initiation start site of 16S rRNA, was found to be protected by a spinach chloroplast extract. In analogy to the first sequence-specific DNA binding factor which was described so far (15) we propose to name this region binding site of CDF2 (chloroplast DNA binding factor 2). Considering the position of this binding site one could imagine the binding of a repressor as well as an initiation factor. The small size of the region rather excludes that it could be RNA polymerase itself. Binding of chloroplast RNA polymerase is more likely under higher Mg++ concentrations when the larger complex is formed whose size is more comparable to the complex which is formed with E. coli RNA polymerase (see Fig. 1). A comparison of chloroplast 16S rRNA upstream regions containing this sequence is shown in Fig.7. Regions analogous to the CDF2 binding site are boxed. A computer search for the presence of this sequence upstream of chloroplast mRNA and tRNA genes was negative. Thus it seems to be specific for chloroplast rRNA genes of higher plants.
Nucleic Acids Research, Vol. 19, No. 13 3581 Transcription initiation start sites for 16S rRNA were mapped precisely in maize (24), Spirodela(22) and pea (21). It is interesting to mention that in Spirodela as in spinach, two E. colilike promoter sequences exist. However, in Spirodela, the binding site of CDF2 is located upstream of the first promoter sequence and not, as in spinach, upstream of the second promoter sequence. Transcription initiation starts in the region of the first promoter, the second promoter is not used. A detailed analysis of transcription initiation in vitro was made in pea (21). Deletion analysis of the 5' regulatory sequences of the gene have shown that 54 bp upstream of the transcription initiation start site are necessary for correct initiation. Interestingly, the first deletion which results in a complete loss of the capacity of correct initiation was located at position -45 on the pea sequence (see 21), i.e. when the first A at the 5' end of the CDF2 binding site is removed. Thus the idea emerges that the CDF2 binding site may be rather implicated in the process of correct initiation of transcription of 16S rRNA than in its repression. To know something more on a possible role of the CDF2 binding site in the regulation of transcription experiments are in progress to isolate the two proteins and to test their function in vitro.
ACKNOWLEDGEMENT We thank Dr. A.-M.Lescure for providing the 274 bp fragment of the 16S rRNA for recloning in pUC 18.
REFERENCES 1. 2. 3. 4.
5.
6. 7. 8. 9. 10. 11.
12. 13. 14. 15. 16. 17.
18. 19. 20. 21. 22. 23.
Mullet, J.E. and Klein, R.R. (1987) EMBO J. 6, 1571-1579. Klein, R.R. and Mullet, J.E. (1990) J. Biol. Chem. 265, 1895-1902. Briat, J.F., Dron, M. and Mache, R. (1983) FEBS Lett. 163, 1-5. Greenberg, B.M., Narita, J.O., De-Luca-Flaherty, C., Gruissem, W., Rushlow, K.A. and Hallick, R.B. (1984) J. Bio. Chem. 259, 14880-14887. Narita, O.J., Rushlow, E.K. and Hallick, R.B. (1985) J. Biol. Chem. 260, 11194-11199. Lerbs, S., Brautigam, E. and Mache, R (1988) Mol. Gen. Genet.211, 459-464. Gruissem, W. and Zurawski, G. (1985a) EMBO J. 4, 1637-1644. Gruissem, W. and Zurawski, G. (1985b) EMBO J. 4, 3375-3383 Link, G. (1984) EMBO J. 3, 1697-1704. Lescure, A.M., Bisanz-Seyer, C., Pesey, H. and Mache, R. (1985) Nucl. Acids Res. 13, 8787-8796. Briat, J.F., Bisanz-Seyer, C. and Lescure, A.M. (1987) Curr. Genet. 11, 259-263 Morgenthaler, J.J., Marsden, M.P.F. and Price, C.A. (1975) Arch. Biochem. Biophys. 168, 289-301. Douce, R. and Joyard, J. (1982) In Edelman et al. (eds), Methods in Chloroplast Molecular Biology, Elsevier Biomedical Press, Amsterdam. Straney, D.C. and Crothers, D.M. (1985) Cell 43, 449-459. Lam, E., Hanley-Bowdoin, L. and Chua, N.H. (1988) J. Biol. Chem. 263, 8288-8293. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Briat, J.F., Dron, M., Loiseaux, S. and Mache, R. (1982) Nucl. Acids Res. 10, 6865-6878. Todoh, N., Shinozaki, K. and Sugiura, M. (1981) Nucl. Acids Res. 9, 5399-5406. Przybyl, D., Fritzsche, E., Edwards, K., Kossel, H., Falk, H., Thompson, J.A. and Link, G. (1984) Plant Mol. Biol. 3, 147-158. Allmen von, J.M. and Stutz, E. (1988) Nucl. Acids Res. 16, 1200. Sun, E., Wu, B.W. and Tewari, K.K. (1989) Mol. Cell. Biol. 9, 5650-5659. Keus, R.J.A., Dekker, A.F., Roon van, M.A. and Groot, G.S.P. (1983) Nucl. Acids Res. 11, 6465-6474. Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T, Sano, S., Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S., Inokuchi, H. and Ozeki, H. (1986) Nature 322, 572-574.
24. Strittmatter, G., Gozdzicka-Josefiak, A. and Kossel, H. (1985) EMBO J. 4, 599-604. 25. Hiratsuka, J. Shimada, H., Whittier, R., Ishibashi, T., Sakamoto, M., Mori, M. Kondo, C., Honji, Y., Sun, C.R., Meng, B.Y., Li, Y.Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K. and Sugiura, M. (1989) Moi. Gen. Genet. 217, 185-194.
