Journal of Heredity 2014:105(2):188–202 doi:10.1093/jhered/est095 Advance Access publication December 31, 2013
© The American Genetic Association 2013. All rights reserved. For permissions, please e-mail: [email protected]
Characterization of Class I– and Class II–Like Major Histocompatibility Complex Loci in Pedigrees of North Atlantic Right Whales Roxanne M. Gillett, Brent W. Murray, and Bradley N. White
Address correspondence to Roxanne M. Gillett at the address above, or e-mail: [email protected]. Data deposited at Dryad: http://dx.doi.org/doi:10.5061/dryad.4d789
Abstract North Atlantic right whales have one of the lowest levels of genetic variation at minisatellite loci, microsatellite loci, and mitochondrial control region haplotypes among mammals. Here, adaptive variation at the peptide binding region of class I and class II DRB-like genes of the major histocompatibility complex was assessed. Amplification of a duplicated region in 222 individuals revealed at least 11 class II alleles. Six alleles were assigned to the locus Eugl-DRB1 and 5 alleles were assigned to the locus Eugl-DRB2 by assessing segregation patterns of alleles from 81 parent/offspring pedigrees. Pedigree analysis indicated that these alleles segregated into 12 distinct haplotypes. Genotyping a smaller subset of unrelated individuals (n = 5 and 10, respectively) using different primer sets revealed at least 2 class II pseudogenes (with ≥ 4 alleles) and at least 3 class I loci (with ≥ 6 alleles). Class II sequences were significantly different from neutrality at peptide binding sites suggesting loci may be under the influence of balancing selection. Trans-species sharing of alleles was apparent for class I and class II sequences. Characterization of class II loci represents the first step in determining the relationship between major histocompatibility complex variability and factors affecting health and reproduction in this species. Key words: DRB like, Eubalaena glacialis, haplotype, MHC, North Atlantic right whale, pedigree analysis
The North Atlantic (Eubalaena glacialis), North Pacific (Eubalaena japonica), and southern right whales (Eubalaena australis) were hunted extensively (Aguilar 1986; Reeves and Mitchell 1986; Ellis 1991; Reeves 2001; Reeves et al. 2007) until granted international protection from whaling in 1935 (Brownell et al. 1986). Currently, the North Atlantic right whale population is increasing at a rate of ~2.5% per year (Knowlton et al. 1994) and is estimated to number ~500 individuals (Pettis 2012). Despite numerous conservation and recovery efforts (Kraus and Rolland 2007), the population growth rate is significantly lower than their southern counterparts (~7% per year; Brandão A, Best P, Butterworth D, unpublished data; Carroll et al. 2013). The slow growth rate has been partially attributed to increased levels of humanassociated mortality resulting from ship strikes and entanglements in fishing gear (Kraus 1990; Knowlton and Kraus 2001; Kraus et al. 2005; Moore et al. 2005, 2007). 188
In addition to the direct anthropogenic threats, some degree of reproductive dysfunction is suggested by a reproductive rate that is significantly lower than expected when compared with the southern right whale (Frasier, Hamilton, et al. 2007; Kraus et al. 2007). This low reproductive rate has been attributed in part to this species extreme variability in female reproductive performance (Kraus et al. 2001, 2007). Between 1989 and 2003, 17 known/presumed calf mortalities in 208 live births were documented, and additional 28 calves were assumed to be lost based off of the sightings histories of reproductive females (Browning et al. 2010). Additionally, several signs of poor health are evident, which may be playing a role in the reduced reproductive performance. These include a notable decline in body condition, an increase in skin lesions, high parasite loads, and exposure to environmental neurotoxins (Pettis et al. 2004; Hamilton and Marx 2005; Hughes-Hanks et al. 2005; Doucette et al. 2012).
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
From the Natural Resources DNA Profiling and Forensic Centre, Department of Biology, Trent University, 2140 East Bank Drive, Peterborough, Ontario K9J 7B8, Canada (Gillett and White); and the Natural Resources and Environmental Studies Institute, University of Northern British Columbia, Prince George, British Columbia, Canada (Murray).
Gillett et al. • North Atlantic Right Whale MHC Characterization
This suggests that fertilization patterns are not random and may be partially responsible for unsuccessful pregnancies (Frasier 2005; Frasier, McLeod, et al. 2007; Frasier et al. 2013). It also suggests that there may be a selective advantage for offspring that are genetically dissimilar from their parents. To determine the amount of adaptive genetic variability in North Atlantic right whales and to test whether there is a correlation between adaptive genetic variability, reproductive success, and health, we first characterized alleles of class I– and class II–like loci of the MHC. The right whale samples used in this study represented 81 pedigrees consisting of a mother, father, and calf, allowing us to determine the transmission patterns of the alleles at these loci.
Materials and Methods Sample Collection and Amplification of MHC Loci Skin samples have been collected from photo-identified individuals since the 1980s using a crossbow with a modified bolt and tip following Brown et al. (1991). DNA was extracted from these samples following Shaw et al. (2003). Two hundred and twenty-two samples, representing 81 right whale pedigrees, were used in this study. Pedigrees consisted of a mother, father, and calf. Individual right whales are identifiable based on a combination of callosity patterns and other markings present on their bodies (Kraus et al. 1986; Hamilton et al. 2007). As right whale calves stay with their mother throughout most of their first year of life (Hamilton et al. 1995), mother–calf relationships were determined behaviorally from these associations (Knowlton et al. 1994; Kraus et al. 2001). Maternity was confirmed and paternity inferred through genetic exclusions using 28 microsatellite loci as described by Frasier, Hamilton, et al. (2007). MHC class I and class II sequences were amplified from genomic DNA using 4 primer sets (Table 1). Three primer sets were used to amplify class II beta chain sequences. The first primer set (DRB-5c; Allen 2000 and DRB-3c; Murray and White 1998) was used to survey all 222 samples. These primers amplified a 185-bp fragment of MHC class II exon 2. DRB-5c is located on the 5′ end of exon 2, just within the intron/exon boundary, whereas DRB-3c is located on the 3′ end of exon 2 (see Supplementary Material online). The
Table 1 Conditions for amplification of the MHC class I–like and class II–like loci Primer
Sequence (5′–3′)
n
Size (bp)
Ta (°C)
Concentration (µM)
Reference
DRB-5c DRB-3c DRB-5b DRB-3b DQB1 DQB2 MHCIex2F MHCIex2R
TCAATGGGACGGAGCGGGTGC CCGCTGCACAGTGAAACTCTC CCCACAGCACGTTTCTTG CTCGCCGCTGCACAGTGAAAC CTGGTAGTTGTGTCTGCACAC CATGTGCTACTTCACCAACGG TACGTGGMCGACACGSAGTTC CTCGCTCTGGTTGTAGTAGCS
222
185
56
0.45
5
240
60
0.45
11
172
52
0.45
10
147
55
1.00
Allen (2000) Murray and White (1998) Tsuji et al. (1992) Ammer et al. (1992) Tsuji et al. (1992) Tsuji et al. (1992) Flores-Ramirez et al. (2000) Flores-Ramirez et al. (2000)
Included are primer names, primer sequence, the number of individuals screened (n), the size of the amplified product in base pairs (bp), the annealing temperature (Ta), the primer concentration used (µM), and the original reference for the primer.
189
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
Low levels of genetic diversity in threatened and endangered species can decrease their evolutionary potential, compromise their reproductive fitness, and/or increase their risk of extinction (Spielman et al. 2004). Therefore, characterizing genetic diversity in threatened and endangered species is important for assessing the probability of long-term persistence. Differential rates of recovery between North Atlantic and southern right whales have prompted several comparative studies of their genetic diversity. These studies have focused on determining the levels of genetic diversity at neutral markers and have indicated that the North Atlantic right whale exhibits significantly less variation at minisatellite loci (Schaeff et al. 1997), microsatellite loci (Waldick et al. 2002; Frasier et al. 2006), and mitochondrial control region haplotypes (Malik et al. 2000) when compared with the southern right whale. However, assessing diversity at genes that play important roles in fitness, such as those of the major histocompatibility complex (MHC) (Bernatchez and Landry 2003; Eizaguirre et al. 2009; Sepil et al. 2013), are also important as variation at these genes have a direct effect on adaptive potential. The MHC is composed of a family of genes that code for cell surface glycoproteins involved in the initiation of the body’s immune response (Klein 1986). Class I loci code for glycoproteins that are on the surface of all nucleated cells and are responsible for presenting endogenous antigens to cytotoxic T cells (Klein 1986). Comparatively, class II loci mainly code for glycoproteins that are found on the surface of antigen presenting cells of the immune system and present exogenous antigens to helper T cells to initiate an immune response (Klein 1986). The MHC is the most polymorphic coding complex in the vertebrate genome that has been identified to date (Parham et al. 1989; Bernatchez and Landry 2003; Piertney and Oliver 2006). It is thought that this high degree of polymorphism is maintained by balancing selection that is driven by pathogen/host or parasite/host interactions and/or factors intrinsic to vertebrate reproduction (Bernatchez and Landry 2003; Milinski 2006; O’Farrell et al. 2012; Oliver and Piertney 2012). Recently it has been reported that North Atlantic right whale fertilizations and/or pregnancies are more successful when the alleles inherited from a father are genetically dissimilar from alleles present in a mother (Frasier et al. 2013).
Journal of Heredity
Allele Characterization and Genotyping Alleles were characterized and samples genotyped using a combination of cloning, direct sequencing, and automated fluorescent single-stranded conformation polymorphism (SSCP; Lento et al. 2003). Cloning of the exon 2 region of class II–like alleles and cloning of the α1 domain of class I–like alleles were carried out with a TOPO TA Cloning Kit (Invitrogen) following the manufacturer’s instructions. Inserts of the proper size were sequenced using a MegaBACE™ DYEnamic™ ET dye terminator kit (Amersham). Sequenced PCR product was electrophoresed and visualized on a MegaBACE™ 1000 and analyzed with MegaBACE™ Sequence Analyzer 3.0 software. Direct sequencing of PCR product from genomic DNA was also performed in this manner. PCR products amplified with the DQB1/DQB2 primer set were cloned and sequenced following Murray et al. (1995). Edited sequences were aligned with ClustalX (Thompson et al. 1994). In order to avoid confusing cloning artifacts with true alleles, alleles were only accepted if the same sequence was identified on multiple occasions in more than 1 individual. Sequence variation and genotyping using the DRB5c/3c primer set was also assessed through automated fluorescent SSCP. Forward and reverse primers labeled with 6-FAM and HEX, respectively, were used to amplify genomic DNA with the previously indicated conditions (Table 1). Samples were prepared by mixing 1 µL of a 1:2 and 1:3 dilution of the PCR product with 3 µL of deionized formamide, 0.5 µL of 190
100 mM NaOH, and 0.5 µL of blue dextran ethylenediaminetetraacetic acid (EDTA) (50 mM EDTA and 50 mg/mL blue dextran). Samples were denatured (95 °C, 3–5 min) and immediately placed in an ice water bath (3–5 min). Before loading, 1 µL of GeneScan™ 500 ROX™ size standard (Applied Biosystems) was added to each sample. Amplified product was size separated and visualized using the ABI PRISM 377 automated DNA sequencer. Samples (2 µL) were electrophoresed through a nondenaturing acrylamide gel (40 mL gel containing 10% acrylamide [39 acrylamide: 1 bis-acrylamide], 8.5% glycerol, 1× tris-borate-EDTA; 200 µL 10% ammonium persulphate, 25 µL tetramethylethylenediamine) and run for 12–14 h (60 W). Temperature was maintained at 10 °C for the duration of the run using an external refrigerated bath circulator (Neslab Instruments Inc.; RTE-111). SSCP gels were analyzed using the ABI Prism Genotyper 2.5 software (Perkin-Elmer Corp.). Known alleles were run on all SSCP gels as mobility controls (see Supplementary Material online). Allelic Nomenclature, Locus Designation, and Data Archiving Allelic nomenclature was based on the proposed rules of Klein et al. (1990). Standard nomenclature is represented by a 4 letter species code (Eugl for the North Atlantic right whale), a locus code, an asterisk, and a 2 digit allele code. The primer sets used to characterize class II–like sequences (DRB5c/3c and DQB1/2) simultaneously amplified 2 distinct loci (see Discussion). These sequences were assigned to the locus Eugl-DRB1 or Eugl-DRB2 by visually following the transmission patterns of the alleles from parents to offspring in the 81 known right whale pedigrees available for this study. The remaining class II–like sequences amplified with the DRB5b/3b primer set and the class I–like sequences amplified with the MHCIex2F/MHCIex2R primer set were screened in 5 and 10 unrelated individuals, respectively. Although these primer sets also simultaneously amplified multiple loci (see Discussion), they could not be related to specific loci. As such, they were assigned to a MHC type and not to a specific locus (e.g., Eugl-DRB or Eugl-I). For archival purposes, all characterized alleles identified in this study were submitted to GenBank and all supplementary material has been submitted to the Dryad electronic repository (Baker 2013). Statistical and Phylogenetic Analysis Class II–like sequences (sequences with orthology to exon 2 of previously identified MHC class II sequences in other species) were initially aligned with previously identified cow (Bos taurus, Mikko et al. 1999) and beluga sequences (Delphinapterus leucas, Murray et al. 1995) using Clustal X (Thompson et al. 1994). Class I–like sequences were aligned against cow (GenBank Accession Number DQ190937) and gray whale (Eschrichtius robustus, Flores-Ramirez et al. 2000) sequences using the same program. Amino acid sequences were inferred using the translation function in MEGA 3.1 (Kumar et al. 2004). The average number of nonsynonymous (dN) and synonymous (dS) substitutions per site and the standard errors
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
second primer set (DRB-5b; Tsuji et al. 1992 and DRB-3b; Ammer et al. 1992) was used to screen 5 unrelated individuals to determine if additional MHC variation could be captured. These primers amplified a 240-bp fragment of MHC class II exon 2. DRB-5b is located at the 5′ end of the DRB-5c primer covering the intron/exon boundary, whereas DRB-3b is located at the 3′ end of exon 2. The third primer set (DQB1 and DQB2, Tsuji et al. 1992) was screened using 11 individuals, representing 2 right whale pedigrees (consisting of a mother and 3 calves) and 3 unrelated individuals. These primers amplified a 172-bp fragment of MHC class II exon 2 and were both located within exon 2. A final primer set (MHCIex2F and MHCIex2R; Flores-Ramirez et al. 2000) was used to survey for variation of class I sequences in 10 unrelated individuals. These primers amplified a 147-bp fragment of the α1 domain of the class I MHC. Amplifications for the DQB1/DQB2 primer set followed Murray et al. (1995) using an annealing temperature of 53 °C. Amplifications for the remaining primer sets consisted of a 15 µL reaction (1× Q-solution [Qiagen], 1× polymerase chain reaction [PCR] buffer (200 mM Tris–HCl (pH 8.4), 500 mM KCl), 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.45–1 µM of each primer (Table 1), 0.05 U/µL Taq DNA polymerase, and 20 ng of DNA) with the following cycling conditions: 94 °C for 5 min; 35 cycles of 94 °C for 30 s, Ta for 1 min (Table 1), 72 °C for 1 min; followed by a final extension of 60 °C for 45 min. Q-solution was not included for class I MHC amplifications.
Gillett et al. • North Atlantic Right Whale MHC Characterization
Results Characterization of MHC-II-Like Alleles Ten sequences corresponding to codons 26–86 relative to exon 2 of cow DRB3-like genes were characterized in 222 samples using the DRB5c/3c primer set (Figure 1; Eugl-DRB1*01 to Eugl-DRB1*06 and Eugl-DRB2*01 to Eugl-DRB2*04; GenBank Accession Numbers: KF137593–KF137605). Up to 4 sequences were identified in each individual indicating the primers were amplifying 2 loci. By following transmission patterns from known pedigrees (Figure 2), 6 alleles were assigned to the locus Eugl-DRB1. The remaining 4 alleles were assigned to a second locus (Eugl-DRB2). Alleles at these loci were characterized by a single base pair change at codon 51 from ACC, coding for threonine in Eugl-DRB1 to AGC, coding for serine in Eugl-DRB2 (Figure 1). The genotypes at Eugl-DRB1 were resolved for all 222 samples. Eugl-DRB1 was in HWE and had 1 common allele (Eugl-DRB1*01) that was found in 86% of the individuals (Table 2; see Supplementary Material online). Due to the similarity in some of the Eugl-DRB2 sequences, several of the alleles had very similar SSCP mobility patterns. This made it more difficult to resolve genotypes for this locus. Because of this, clear genotypes were only resolved for 45 of the 222 samples and genotypes could not be resolved for 136 samples. No amplification for EuglDRB2 was apparent for the remaining 41 samples, indicating the presence of a null allele(s) at this locus. All 41 samples
Figure 1. Inferred amino acid sequences of the North Atlantic right whale (Eugl) MHC class II–like sequences (GenBank Accession Numbers: KF137593–KF137605) based on an alignment to previously published cow (BoLA; U77067.1, NM_001034668) and beluga (Dele; AF012931, U16990) DRB and DQB sequences. Translations inferred from nucleotide sequences in reading frame with the cow. Translations of pseudogenes are shown for comparative purposes. Stop codons of pseudogenes are indicated (▲). Amino acid sequences start at position 9 relative to the cow DRB exon 2. Codons that face the peptide binding groove or are implicated in the recognition of foreign peptides are indicated with an asterisk (*) following Brown et al. (1993) and Stern et al. (1994). Note: Eugl-DRB*03 and Eugl-DRB*04 remain tentative until confirmed across additional individuals. 191
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
were calculated using the modified Nei and Gojobori (1986) model for the Eugl-DRB1 and Eugl-DRB2 locus as well as the 3 identified class-I MHC alleles. The Jukes–Cantor correction was used to correct for multiple substitutions at the same site. The ratio of nonsynonymous to synonymous substitutions (dN/dS) was tested for departure from neutral expectations using the z-statistic in MEGA 3.1. Standard errors were computed using 1000 bootstrap replicates. Nucleotide diversity (π; Nei 1987) was calculated for each locus using the program DnaSP 4.5 (Rozsa et al. 2003). Genepop 3.1 (Raymond and Rousset 1995) was used to calculate allele and haplotype frequencies, observed (Ho) and expected heterozygosity (He), and deviations from Hardy–Weinberg Equilibrium (HWE) from identified class II DRB-like loci (Eugl-DRB1 and EuglDRB2). Genepop 3.1 was also used to detect evidence of linkage disequilibrium between Eugl-DRB1 and Eugl-DRB2 using the log likelihood ratio statistic (dememorization number of 10 000, 1000 batches, 10 000 iterations per batch). Maximum-likelihood phylogenies of all identified class I and class II variants were performed. Phylogenies were reconstructed using PhyML 3.0.1 (Guindon and Gascuel 2003; Guindon et al. 2010) and contained representative primate, ungulate, and cetacean sequences. Genetic distances were adjusted using the best-fit model of nucleotide substitution indicated by the Bayesian Information Criterion using the program jModelTest 0.1.1 (Guindon and Gascuel 2003; Posada 2008). Phylogenetic trees were visualized using Dendroscope 3 (Huson and Scornavacca 2012).
Journal of Heredity
Table 2 Summary of allele frequencies, haplotype frequencies, observed heterozygosity (Ho), and expected heterozygosity (He) of MHC class II–like loci characterized in the North Atlantic right whale Locus/ haplotype Eugl -DRB1 Eugl -DRB1 Eugl -DRB2 DRB1/ DRB2
n
He (Ho)
Alleles/haplotypes
222 01 0.589 57 01 0.781 57 01 0.105 57 A (01-02) 0.01
02 0.048 02 0.009 02 0.026 B (01-03) 0.04
03 0.057 03 0.070 03 0.123 C (01-04) 0.08
04 0.021 04 0.018 04 0.099 D (01-05) 0.66
05 0.112 05 0.000 05 0.659 E (02-01) 0.01
06 0.174 06 0.123
0.60 (0.59)
0.54 (0.54)
F G H I J K L 0.54 (0.54) (03-01) (03-03) (04-01) (06-01) (06-02) (06-03) (06-04) 0.06 0.01 0.02 0.02 0.02 0.08 0.01
Allele and haplotype designations are indicated in bold. Eugl-DRB2*05 represents the allele(s) that was not amplifying using the DRB5c/3c primer set. Genotypes for the Eugl-DRB1 locus are available for all 222 profiled individuals. Eugl-DRB2*05 was inferred through transmission analysis of known family groups. Due to the inability to differentiate between some of the alleles at the DRB2 locus and the fact that this locus did not amplify in 41 of the samples, only frequencies for Eugl-DRB1 for all 222 individuals are presented. The frequencies for Eugl-DRB2 and the DRB1/DRB2 haplotypes (and for comparative purposes, Eugl-DRB1) were calculated using 57 individuals (45 individuals with clear genotypes and an additional 12 individuals with the inferred Eugl-DRB2*05 allele).
192
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
Figure 2. Representative transmission patterns of DRB1 and DRB2 alleles for 2 North Atlantic right whale matrilines. Inferred haplotypes of offspring indicated by a dash (-) and alleles of parents by an ampersand (&). Haplotypes in the offspring that were inherited from the mother are in bold and haplotypes in the offspring that were inherited from the sire are underlined. Double lines indicate mating pairs. Diamonds indicate an animal of unknown sex. Alleles 2*01 and 2*02 had similar SSCP mobilities and only differed by 1 bp, making differentiation through direct sequencing difficult. Unresolved alleles are separated by a backslash (/). Panel A: Matriline of Eg#1135: individuals profiled using DRB3c/5c and DQB1/2 primer sets. Transmission patterns of Eg#1406 could not be determined because this individual contained the same alleles as the mother. Panel B: Matriline of Eg#1001: individuals profiled using the DRB3c/5c primer set that were used to infer DRB1-DRB2 haplotypes. The Eugl-DRB2 allele(s) that did not amplify is represented by the 2*05 allele. In this matriline, 3 calves Eg#1301, Eg#1603, and Eg#1911 were sired by 3 different males (Eg#1033, Eg#1156, and Eg#1279, respectively). In the second generation, two of these half-sibs (Eg#1603 and Eg#1911) successfully mated.
Gillett et al. • North Atlantic Right Whale MHC Characterization
in 2 clones from the same individual and therefore remain tentative until confirmed in additional individuals. Haplotype Analysis Alleles at locus Eugl-DRB1 and Eugl-DRB2 were in tight linkage disequilibrium (P = 0.001), suggesting the genotypes at Eugl-DRB1 are not independent from the genotypes at EuglDRB2 and are being inherited en bloc. EuglDRB1-DRB2 haplotypes were inferred based on the segregation of Eugl-DRB1 and Eugl-DRB2 genotypes from parents to their calves (see Figure 2 for examples of two of the pedigrees representing multiple generations that were used in the transmission analysis). The individuals used for this analysis represented 4 matrilines and 6 patrilines, which contained multiple calves across 1 or 2 generations. Analysis of 64 parental chromosomes revealed 9 haplotypes (Table 2). Three additional haplotypes were identified in 2 family groups not contained within these matrilines or patrilines. Over half of the haplotypes identified were EuglDRB1*01-DRB2*05 (haplotype D; Table 2), representing the most common Eugl-DRB1 allele and the null Eugl-DRB2 allele(s) that was not amplifying with the DRB5c/3c primer set. One matriline and 4 patrilines, where the mother and father were heterozygous at both loci, were informative for recombination analysis. However, no evidence of recombination between Eugl-DRB1 and EuglDRB2 was observed. Evidence of Selection Eugl-DRB1 and Eugl-DRB2 alleles were in open reading frame when aligned with previously characterized cow DRB3 and beluga alleles (Figure 1). A BLAST search in GenBank indicated that the alleles had high similarity to previously identified DRB and DQB alleles of other cetaceans and even-toed ungulates. Eugl-DRB1 alleles contained the highest number of variable sites, in both the total sequence and in the codons thought to be involved in the recognition of foreign peptides (Table 3). Pairwise comparisons of both the total sequence and codons thought to be involved in the recognition of foreign peptides of Eugl-DRB1 and Eugl-DRB2 indicated that dN was greater than dS. These were significantly different
Table 3 Allelic richness (k) and nucleotide diversity (π) across the whole MHC class II–like and α1 MHC class I–like sequences and across only those sites implicated in the peptide binding region (PBR) that have been implicated in peptide binding k Eugl-DRB1 Overall PBR Eugl-DRB2 Overall PBR Eugl-I Overall PBR
6 5 3
var.
a.a.
π
dN (SE)
dS (SE)
29/185 23/69
15/62 11/23
0.075 0.166
0.09 (0.02) 0.22 (0.07)**
0.05 (0.02) 0.11 (0.06)
15/185 13/69
12/62 10/23
0.052 0.133
0.07 (0.02)*** 0.18 (0.05)***
0.00 (0.00) 0.00 (0.00)
3/147 3/66
3/49 3/22
0.009 0.020
0.01 (0.01) 0.03 (0.02)
0.00 (0.00) 0.00 (0.00)
The number of variable sites (var.), amino acid (a.a.) changes, and average number of nonsynonymous (dN) and synonymous substitutions (dS) per site are indicated. Identified pseudogenes are not included in these analyses. Significant differences between dN and dS are indicated; **P
© The American Genetic Association 2013. All rights reserved. For permissions, please e-mail: [email protected]
Characterization of Class I– and Class II–Like Major Histocompatibility Complex Loci in Pedigrees of North Atlantic Right Whales Roxanne M. Gillett, Brent W. Murray, and Bradley N. White
Address correspondence to Roxanne M. Gillett at the address above, or e-mail: [email protected]. Data deposited at Dryad: http://dx.doi.org/doi:10.5061/dryad.4d789
Abstract North Atlantic right whales have one of the lowest levels of genetic variation at minisatellite loci, microsatellite loci, and mitochondrial control region haplotypes among mammals. Here, adaptive variation at the peptide binding region of class I and class II DRB-like genes of the major histocompatibility complex was assessed. Amplification of a duplicated region in 222 individuals revealed at least 11 class II alleles. Six alleles were assigned to the locus Eugl-DRB1 and 5 alleles were assigned to the locus Eugl-DRB2 by assessing segregation patterns of alleles from 81 parent/offspring pedigrees. Pedigree analysis indicated that these alleles segregated into 12 distinct haplotypes. Genotyping a smaller subset of unrelated individuals (n = 5 and 10, respectively) using different primer sets revealed at least 2 class II pseudogenes (with ≥ 4 alleles) and at least 3 class I loci (with ≥ 6 alleles). Class II sequences were significantly different from neutrality at peptide binding sites suggesting loci may be under the influence of balancing selection. Trans-species sharing of alleles was apparent for class I and class II sequences. Characterization of class II loci represents the first step in determining the relationship between major histocompatibility complex variability and factors affecting health and reproduction in this species. Key words: DRB like, Eubalaena glacialis, haplotype, MHC, North Atlantic right whale, pedigree analysis
The North Atlantic (Eubalaena glacialis), North Pacific (Eubalaena japonica), and southern right whales (Eubalaena australis) were hunted extensively (Aguilar 1986; Reeves and Mitchell 1986; Ellis 1991; Reeves 2001; Reeves et al. 2007) until granted international protection from whaling in 1935 (Brownell et al. 1986). Currently, the North Atlantic right whale population is increasing at a rate of ~2.5% per year (Knowlton et al. 1994) and is estimated to number ~500 individuals (Pettis 2012). Despite numerous conservation and recovery efforts (Kraus and Rolland 2007), the population growth rate is significantly lower than their southern counterparts (~7% per year; Brandão A, Best P, Butterworth D, unpublished data; Carroll et al. 2013). The slow growth rate has been partially attributed to increased levels of humanassociated mortality resulting from ship strikes and entanglements in fishing gear (Kraus 1990; Knowlton and Kraus 2001; Kraus et al. 2005; Moore et al. 2005, 2007). 188
In addition to the direct anthropogenic threats, some degree of reproductive dysfunction is suggested by a reproductive rate that is significantly lower than expected when compared with the southern right whale (Frasier, Hamilton, et al. 2007; Kraus et al. 2007). This low reproductive rate has been attributed in part to this species extreme variability in female reproductive performance (Kraus et al. 2001, 2007). Between 1989 and 2003, 17 known/presumed calf mortalities in 208 live births were documented, and additional 28 calves were assumed to be lost based off of the sightings histories of reproductive females (Browning et al. 2010). Additionally, several signs of poor health are evident, which may be playing a role in the reduced reproductive performance. These include a notable decline in body condition, an increase in skin lesions, high parasite loads, and exposure to environmental neurotoxins (Pettis et al. 2004; Hamilton and Marx 2005; Hughes-Hanks et al. 2005; Doucette et al. 2012).
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
From the Natural Resources DNA Profiling and Forensic Centre, Department of Biology, Trent University, 2140 East Bank Drive, Peterborough, Ontario K9J 7B8, Canada (Gillett and White); and the Natural Resources and Environmental Studies Institute, University of Northern British Columbia, Prince George, British Columbia, Canada (Murray).
Gillett et al. • North Atlantic Right Whale MHC Characterization
This suggests that fertilization patterns are not random and may be partially responsible for unsuccessful pregnancies (Frasier 2005; Frasier, McLeod, et al. 2007; Frasier et al. 2013). It also suggests that there may be a selective advantage for offspring that are genetically dissimilar from their parents. To determine the amount of adaptive genetic variability in North Atlantic right whales and to test whether there is a correlation between adaptive genetic variability, reproductive success, and health, we first characterized alleles of class I– and class II–like loci of the MHC. The right whale samples used in this study represented 81 pedigrees consisting of a mother, father, and calf, allowing us to determine the transmission patterns of the alleles at these loci.
Materials and Methods Sample Collection and Amplification of MHC Loci Skin samples have been collected from photo-identified individuals since the 1980s using a crossbow with a modified bolt and tip following Brown et al. (1991). DNA was extracted from these samples following Shaw et al. (2003). Two hundred and twenty-two samples, representing 81 right whale pedigrees, were used in this study. Pedigrees consisted of a mother, father, and calf. Individual right whales are identifiable based on a combination of callosity patterns and other markings present on their bodies (Kraus et al. 1986; Hamilton et al. 2007). As right whale calves stay with their mother throughout most of their first year of life (Hamilton et al. 1995), mother–calf relationships were determined behaviorally from these associations (Knowlton et al. 1994; Kraus et al. 2001). Maternity was confirmed and paternity inferred through genetic exclusions using 28 microsatellite loci as described by Frasier, Hamilton, et al. (2007). MHC class I and class II sequences were amplified from genomic DNA using 4 primer sets (Table 1). Three primer sets were used to amplify class II beta chain sequences. The first primer set (DRB-5c; Allen 2000 and DRB-3c; Murray and White 1998) was used to survey all 222 samples. These primers amplified a 185-bp fragment of MHC class II exon 2. DRB-5c is located on the 5′ end of exon 2, just within the intron/exon boundary, whereas DRB-3c is located on the 3′ end of exon 2 (see Supplementary Material online). The
Table 1 Conditions for amplification of the MHC class I–like and class II–like loci Primer
Sequence (5′–3′)
n
Size (bp)
Ta (°C)
Concentration (µM)
Reference
DRB-5c DRB-3c DRB-5b DRB-3b DQB1 DQB2 MHCIex2F MHCIex2R
TCAATGGGACGGAGCGGGTGC CCGCTGCACAGTGAAACTCTC CCCACAGCACGTTTCTTG CTCGCCGCTGCACAGTGAAAC CTGGTAGTTGTGTCTGCACAC CATGTGCTACTTCACCAACGG TACGTGGMCGACACGSAGTTC CTCGCTCTGGTTGTAGTAGCS
222
185
56
0.45
5
240
60
0.45
11
172
52
0.45
10
147
55
1.00
Allen (2000) Murray and White (1998) Tsuji et al. (1992) Ammer et al. (1992) Tsuji et al. (1992) Tsuji et al. (1992) Flores-Ramirez et al. (2000) Flores-Ramirez et al. (2000)
Included are primer names, primer sequence, the number of individuals screened (n), the size of the amplified product in base pairs (bp), the annealing temperature (Ta), the primer concentration used (µM), and the original reference for the primer.
189
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
Low levels of genetic diversity in threatened and endangered species can decrease their evolutionary potential, compromise their reproductive fitness, and/or increase their risk of extinction (Spielman et al. 2004). Therefore, characterizing genetic diversity in threatened and endangered species is important for assessing the probability of long-term persistence. Differential rates of recovery between North Atlantic and southern right whales have prompted several comparative studies of their genetic diversity. These studies have focused on determining the levels of genetic diversity at neutral markers and have indicated that the North Atlantic right whale exhibits significantly less variation at minisatellite loci (Schaeff et al. 1997), microsatellite loci (Waldick et al. 2002; Frasier et al. 2006), and mitochondrial control region haplotypes (Malik et al. 2000) when compared with the southern right whale. However, assessing diversity at genes that play important roles in fitness, such as those of the major histocompatibility complex (MHC) (Bernatchez and Landry 2003; Eizaguirre et al. 2009; Sepil et al. 2013), are also important as variation at these genes have a direct effect on adaptive potential. The MHC is composed of a family of genes that code for cell surface glycoproteins involved in the initiation of the body’s immune response (Klein 1986). Class I loci code for glycoproteins that are on the surface of all nucleated cells and are responsible for presenting endogenous antigens to cytotoxic T cells (Klein 1986). Comparatively, class II loci mainly code for glycoproteins that are found on the surface of antigen presenting cells of the immune system and present exogenous antigens to helper T cells to initiate an immune response (Klein 1986). The MHC is the most polymorphic coding complex in the vertebrate genome that has been identified to date (Parham et al. 1989; Bernatchez and Landry 2003; Piertney and Oliver 2006). It is thought that this high degree of polymorphism is maintained by balancing selection that is driven by pathogen/host or parasite/host interactions and/or factors intrinsic to vertebrate reproduction (Bernatchez and Landry 2003; Milinski 2006; O’Farrell et al. 2012; Oliver and Piertney 2012). Recently it has been reported that North Atlantic right whale fertilizations and/or pregnancies are more successful when the alleles inherited from a father are genetically dissimilar from alleles present in a mother (Frasier et al. 2013).
Journal of Heredity
Allele Characterization and Genotyping Alleles were characterized and samples genotyped using a combination of cloning, direct sequencing, and automated fluorescent single-stranded conformation polymorphism (SSCP; Lento et al. 2003). Cloning of the exon 2 region of class II–like alleles and cloning of the α1 domain of class I–like alleles were carried out with a TOPO TA Cloning Kit (Invitrogen) following the manufacturer’s instructions. Inserts of the proper size were sequenced using a MegaBACE™ DYEnamic™ ET dye terminator kit (Amersham). Sequenced PCR product was electrophoresed and visualized on a MegaBACE™ 1000 and analyzed with MegaBACE™ Sequence Analyzer 3.0 software. Direct sequencing of PCR product from genomic DNA was also performed in this manner. PCR products amplified with the DQB1/DQB2 primer set were cloned and sequenced following Murray et al. (1995). Edited sequences were aligned with ClustalX (Thompson et al. 1994). In order to avoid confusing cloning artifacts with true alleles, alleles were only accepted if the same sequence was identified on multiple occasions in more than 1 individual. Sequence variation and genotyping using the DRB5c/3c primer set was also assessed through automated fluorescent SSCP. Forward and reverse primers labeled with 6-FAM and HEX, respectively, were used to amplify genomic DNA with the previously indicated conditions (Table 1). Samples were prepared by mixing 1 µL of a 1:2 and 1:3 dilution of the PCR product with 3 µL of deionized formamide, 0.5 µL of 190
100 mM NaOH, and 0.5 µL of blue dextran ethylenediaminetetraacetic acid (EDTA) (50 mM EDTA and 50 mg/mL blue dextran). Samples were denatured (95 °C, 3–5 min) and immediately placed in an ice water bath (3–5 min). Before loading, 1 µL of GeneScan™ 500 ROX™ size standard (Applied Biosystems) was added to each sample. Amplified product was size separated and visualized using the ABI PRISM 377 automated DNA sequencer. Samples (2 µL) were electrophoresed through a nondenaturing acrylamide gel (40 mL gel containing 10% acrylamide [39 acrylamide: 1 bis-acrylamide], 8.5% glycerol, 1× tris-borate-EDTA; 200 µL 10% ammonium persulphate, 25 µL tetramethylethylenediamine) and run for 12–14 h (60 W). Temperature was maintained at 10 °C for the duration of the run using an external refrigerated bath circulator (Neslab Instruments Inc.; RTE-111). SSCP gels were analyzed using the ABI Prism Genotyper 2.5 software (Perkin-Elmer Corp.). Known alleles were run on all SSCP gels as mobility controls (see Supplementary Material online). Allelic Nomenclature, Locus Designation, and Data Archiving Allelic nomenclature was based on the proposed rules of Klein et al. (1990). Standard nomenclature is represented by a 4 letter species code (Eugl for the North Atlantic right whale), a locus code, an asterisk, and a 2 digit allele code. The primer sets used to characterize class II–like sequences (DRB5c/3c and DQB1/2) simultaneously amplified 2 distinct loci (see Discussion). These sequences were assigned to the locus Eugl-DRB1 or Eugl-DRB2 by visually following the transmission patterns of the alleles from parents to offspring in the 81 known right whale pedigrees available for this study. The remaining class II–like sequences amplified with the DRB5b/3b primer set and the class I–like sequences amplified with the MHCIex2F/MHCIex2R primer set were screened in 5 and 10 unrelated individuals, respectively. Although these primer sets also simultaneously amplified multiple loci (see Discussion), they could not be related to specific loci. As such, they were assigned to a MHC type and not to a specific locus (e.g., Eugl-DRB or Eugl-I). For archival purposes, all characterized alleles identified in this study were submitted to GenBank and all supplementary material has been submitted to the Dryad electronic repository (Baker 2013). Statistical and Phylogenetic Analysis Class II–like sequences (sequences with orthology to exon 2 of previously identified MHC class II sequences in other species) were initially aligned with previously identified cow (Bos taurus, Mikko et al. 1999) and beluga sequences (Delphinapterus leucas, Murray et al. 1995) using Clustal X (Thompson et al. 1994). Class I–like sequences were aligned against cow (GenBank Accession Number DQ190937) and gray whale (Eschrichtius robustus, Flores-Ramirez et al. 2000) sequences using the same program. Amino acid sequences were inferred using the translation function in MEGA 3.1 (Kumar et al. 2004). The average number of nonsynonymous (dN) and synonymous (dS) substitutions per site and the standard errors
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
second primer set (DRB-5b; Tsuji et al. 1992 and DRB-3b; Ammer et al. 1992) was used to screen 5 unrelated individuals to determine if additional MHC variation could be captured. These primers amplified a 240-bp fragment of MHC class II exon 2. DRB-5b is located at the 5′ end of the DRB-5c primer covering the intron/exon boundary, whereas DRB-3b is located at the 3′ end of exon 2. The third primer set (DQB1 and DQB2, Tsuji et al. 1992) was screened using 11 individuals, representing 2 right whale pedigrees (consisting of a mother and 3 calves) and 3 unrelated individuals. These primers amplified a 172-bp fragment of MHC class II exon 2 and were both located within exon 2. A final primer set (MHCIex2F and MHCIex2R; Flores-Ramirez et al. 2000) was used to survey for variation of class I sequences in 10 unrelated individuals. These primers amplified a 147-bp fragment of the α1 domain of the class I MHC. Amplifications for the DQB1/DQB2 primer set followed Murray et al. (1995) using an annealing temperature of 53 °C. Amplifications for the remaining primer sets consisted of a 15 µL reaction (1× Q-solution [Qiagen], 1× polymerase chain reaction [PCR] buffer (200 mM Tris–HCl (pH 8.4), 500 mM KCl), 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.45–1 µM of each primer (Table 1), 0.05 U/µL Taq DNA polymerase, and 20 ng of DNA) with the following cycling conditions: 94 °C for 5 min; 35 cycles of 94 °C for 30 s, Ta for 1 min (Table 1), 72 °C for 1 min; followed by a final extension of 60 °C for 45 min. Q-solution was not included for class I MHC amplifications.
Gillett et al. • North Atlantic Right Whale MHC Characterization
Results Characterization of MHC-II-Like Alleles Ten sequences corresponding to codons 26–86 relative to exon 2 of cow DRB3-like genes were characterized in 222 samples using the DRB5c/3c primer set (Figure 1; Eugl-DRB1*01 to Eugl-DRB1*06 and Eugl-DRB2*01 to Eugl-DRB2*04; GenBank Accession Numbers: KF137593–KF137605). Up to 4 sequences were identified in each individual indicating the primers were amplifying 2 loci. By following transmission patterns from known pedigrees (Figure 2), 6 alleles were assigned to the locus Eugl-DRB1. The remaining 4 alleles were assigned to a second locus (Eugl-DRB2). Alleles at these loci were characterized by a single base pair change at codon 51 from ACC, coding for threonine in Eugl-DRB1 to AGC, coding for serine in Eugl-DRB2 (Figure 1). The genotypes at Eugl-DRB1 were resolved for all 222 samples. Eugl-DRB1 was in HWE and had 1 common allele (Eugl-DRB1*01) that was found in 86% of the individuals (Table 2; see Supplementary Material online). Due to the similarity in some of the Eugl-DRB2 sequences, several of the alleles had very similar SSCP mobility patterns. This made it more difficult to resolve genotypes for this locus. Because of this, clear genotypes were only resolved for 45 of the 222 samples and genotypes could not be resolved for 136 samples. No amplification for EuglDRB2 was apparent for the remaining 41 samples, indicating the presence of a null allele(s) at this locus. All 41 samples
Figure 1. Inferred amino acid sequences of the North Atlantic right whale (Eugl) MHC class II–like sequences (GenBank Accession Numbers: KF137593–KF137605) based on an alignment to previously published cow (BoLA; U77067.1, NM_001034668) and beluga (Dele; AF012931, U16990) DRB and DQB sequences. Translations inferred from nucleotide sequences in reading frame with the cow. Translations of pseudogenes are shown for comparative purposes. Stop codons of pseudogenes are indicated (▲). Amino acid sequences start at position 9 relative to the cow DRB exon 2. Codons that face the peptide binding groove or are implicated in the recognition of foreign peptides are indicated with an asterisk (*) following Brown et al. (1993) and Stern et al. (1994). Note: Eugl-DRB*03 and Eugl-DRB*04 remain tentative until confirmed across additional individuals. 191
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
were calculated using the modified Nei and Gojobori (1986) model for the Eugl-DRB1 and Eugl-DRB2 locus as well as the 3 identified class-I MHC alleles. The Jukes–Cantor correction was used to correct for multiple substitutions at the same site. The ratio of nonsynonymous to synonymous substitutions (dN/dS) was tested for departure from neutral expectations using the z-statistic in MEGA 3.1. Standard errors were computed using 1000 bootstrap replicates. Nucleotide diversity (π; Nei 1987) was calculated for each locus using the program DnaSP 4.5 (Rozsa et al. 2003). Genepop 3.1 (Raymond and Rousset 1995) was used to calculate allele and haplotype frequencies, observed (Ho) and expected heterozygosity (He), and deviations from Hardy–Weinberg Equilibrium (HWE) from identified class II DRB-like loci (Eugl-DRB1 and EuglDRB2). Genepop 3.1 was also used to detect evidence of linkage disequilibrium between Eugl-DRB1 and Eugl-DRB2 using the log likelihood ratio statistic (dememorization number of 10 000, 1000 batches, 10 000 iterations per batch). Maximum-likelihood phylogenies of all identified class I and class II variants were performed. Phylogenies were reconstructed using PhyML 3.0.1 (Guindon and Gascuel 2003; Guindon et al. 2010) and contained representative primate, ungulate, and cetacean sequences. Genetic distances were adjusted using the best-fit model of nucleotide substitution indicated by the Bayesian Information Criterion using the program jModelTest 0.1.1 (Guindon and Gascuel 2003; Posada 2008). Phylogenetic trees were visualized using Dendroscope 3 (Huson and Scornavacca 2012).
Journal of Heredity
Table 2 Summary of allele frequencies, haplotype frequencies, observed heterozygosity (Ho), and expected heterozygosity (He) of MHC class II–like loci characterized in the North Atlantic right whale Locus/ haplotype Eugl -DRB1 Eugl -DRB1 Eugl -DRB2 DRB1/ DRB2
n
He (Ho)
Alleles/haplotypes
222 01 0.589 57 01 0.781 57 01 0.105 57 A (01-02) 0.01
02 0.048 02 0.009 02 0.026 B (01-03) 0.04
03 0.057 03 0.070 03 0.123 C (01-04) 0.08
04 0.021 04 0.018 04 0.099 D (01-05) 0.66
05 0.112 05 0.000 05 0.659 E (02-01) 0.01
06 0.174 06 0.123
0.60 (0.59)
0.54 (0.54)
F G H I J K L 0.54 (0.54) (03-01) (03-03) (04-01) (06-01) (06-02) (06-03) (06-04) 0.06 0.01 0.02 0.02 0.02 0.08 0.01
Allele and haplotype designations are indicated in bold. Eugl-DRB2*05 represents the allele(s) that was not amplifying using the DRB5c/3c primer set. Genotypes for the Eugl-DRB1 locus are available for all 222 profiled individuals. Eugl-DRB2*05 was inferred through transmission analysis of known family groups. Due to the inability to differentiate between some of the alleles at the DRB2 locus and the fact that this locus did not amplify in 41 of the samples, only frequencies for Eugl-DRB1 for all 222 individuals are presented. The frequencies for Eugl-DRB2 and the DRB1/DRB2 haplotypes (and for comparative purposes, Eugl-DRB1) were calculated using 57 individuals (45 individuals with clear genotypes and an additional 12 individuals with the inferred Eugl-DRB2*05 allele).
192
Downloaded from http://jhered.oxfordjournals.org/ at Ondokuz Mayis University on November 13, 2014
Figure 2. Representative transmission patterns of DRB1 and DRB2 alleles for 2 North Atlantic right whale matrilines. Inferred haplotypes of offspring indicated by a dash (-) and alleles of parents by an ampersand (&). Haplotypes in the offspring that were inherited from the mother are in bold and haplotypes in the offspring that were inherited from the sire are underlined. Double lines indicate mating pairs. Diamonds indicate an animal of unknown sex. Alleles 2*01 and 2*02 had similar SSCP mobilities and only differed by 1 bp, making differentiation through direct sequencing difficult. Unresolved alleles are separated by a backslash (/). Panel A: Matriline of Eg#1135: individuals profiled using DRB3c/5c and DQB1/2 primer sets. Transmission patterns of Eg#1406 could not be determined because this individual contained the same alleles as the mother. Panel B: Matriline of Eg#1001: individuals profiled using the DRB3c/5c primer set that were used to infer DRB1-DRB2 haplotypes. The Eugl-DRB2 allele(s) that did not amplify is represented by the 2*05 allele. In this matriline, 3 calves Eg#1301, Eg#1603, and Eg#1911 were sired by 3 different males (Eg#1033, Eg#1156, and Eg#1279, respectively). In the second generation, two of these half-sibs (Eg#1603 and Eg#1911) successfully mated.
Gillett et al. • North Atlantic Right Whale MHC Characterization
in 2 clones from the same individual and therefore remain tentative until confirmed in additional individuals. Haplotype Analysis Alleles at locus Eugl-DRB1 and Eugl-DRB2 were in tight linkage disequilibrium (P = 0.001), suggesting the genotypes at Eugl-DRB1 are not independent from the genotypes at EuglDRB2 and are being inherited en bloc. EuglDRB1-DRB2 haplotypes were inferred based on the segregation of Eugl-DRB1 and Eugl-DRB2 genotypes from parents to their calves (see Figure 2 for examples of two of the pedigrees representing multiple generations that were used in the transmission analysis). The individuals used for this analysis represented 4 matrilines and 6 patrilines, which contained multiple calves across 1 or 2 generations. Analysis of 64 parental chromosomes revealed 9 haplotypes (Table 2). Three additional haplotypes were identified in 2 family groups not contained within these matrilines or patrilines. Over half of the haplotypes identified were EuglDRB1*01-DRB2*05 (haplotype D; Table 2), representing the most common Eugl-DRB1 allele and the null Eugl-DRB2 allele(s) that was not amplifying with the DRB5c/3c primer set. One matriline and 4 patrilines, where the mother and father were heterozygous at both loci, were informative for recombination analysis. However, no evidence of recombination between Eugl-DRB1 and EuglDRB2 was observed. Evidence of Selection Eugl-DRB1 and Eugl-DRB2 alleles were in open reading frame when aligned with previously characterized cow DRB3 and beluga alleles (Figure 1). A BLAST search in GenBank indicated that the alleles had high similarity to previously identified DRB and DQB alleles of other cetaceans and even-toed ungulates. Eugl-DRB1 alleles contained the highest number of variable sites, in both the total sequence and in the codons thought to be involved in the recognition of foreign peptides (Table 3). Pairwise comparisons of both the total sequence and codons thought to be involved in the recognition of foreign peptides of Eugl-DRB1 and Eugl-DRB2 indicated that dN was greater than dS. These were significantly different
Table 3 Allelic richness (k) and nucleotide diversity (π) across the whole MHC class II–like and α1 MHC class I–like sequences and across only those sites implicated in the peptide binding region (PBR) that have been implicated in peptide binding k Eugl-DRB1 Overall PBR Eugl-DRB2 Overall PBR Eugl-I Overall PBR
6 5 3
var.
a.a.
π
dN (SE)
dS (SE)
29/185 23/69
15/62 11/23
0.075 0.166
0.09 (0.02) 0.22 (0.07)**
0.05 (0.02) 0.11 (0.06)
15/185 13/69
12/62 10/23
0.052 0.133
0.07 (0.02)*** 0.18 (0.05)***
0.00 (0.00) 0.00 (0.00)
3/147 3/66
3/49 3/22
0.009 0.020
0.01 (0.01) 0.03 (0.02)
0.00 (0.00) 0.00 (0.00)
The number of variable sites (var.), amino acid (a.a.) changes, and average number of nonsynonymous (dN) and synonymous substitutions (dS) per site are indicated. Identified pseudogenes are not included in these analyses. Significant differences between dN and dS are indicated; **P
