Accepted Manuscript Title: Characterization of expressed sequence tags from Lilium longiflorum in vernalized and non-vernalized bulbs Author: Maya Lugassi-Ben Hamo Carlos Villacorta Martin Michele Zaccai PII: DOI: Reference:
S0176-1617(14)00280-6 http://dx.doi.org/doi:10.1016/j.jplph.2014.09.015 JPLPH 52044
To appear in: Received date: Revised date: Accepted date:
22-7-2014 26-9-2014 28-9-2014
Please cite this article as: Hamo ML-B, Martin CV, Zaccai M, Characterization of expressed sequence tags from Lilium longiflorum in vernalized and non-vernalized bulbs, Journal of Plant Physiology (2014), http://dx.doi.org/10.1016/j.jplph.2014.09.015 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
*Manuscript
TITLE PAGE Characterization of expressed sequence tags from Lilium longiflorum in vernalized and non-vernalized bulbs
1
Dep. of Life Sciences, Ben Gurion University of the Negev
us
cr
P.O. Box 653, Beersheva 84105, Israel 2
ip t
Maya Lugassi-Ben Hamo1, Carlos Villacorta Martin2 and Michele Zaccai1*
Genetwister Technologies B.V
P.O. Box 193
an
6700 AD Wageningen The Netherlands
M
Telephone: +31(0)317466420 Fax: +31(0)317466421
d
Email: [email protected]
Ac ce p
te
www.genetwister.nl
Maya Lugassi-Ben Hamo, email: [email protected] Carlos Villacorta Martin, email: [email protected]
Michele Zaccai, *corresponding author Department of Life Sciences
Ben Gurion University of the Negev 84105 Beersheva, Israel Telephone: +972(0)86479196 Fax: +972(0)86479261 Email: [email protected] http://www.bgu.ac.il/~mzaccai 1 Page 1 of 34
ABSTRACT In Lilium longiflorum, vernalization is both an obligatory requirement and the major factor affecting flowering time, however, little is known about the molecular regulation
ip t
of this mechanism in Lilium and other flowering bulbs. Exposure of L. longiflorum bulbs to 9 weeks at 4oC, greatly promoted stem elongation within the bulb, floral transition
cr
and flowering. Subtraction libraries of vernalized (V) and non-vernalized (NV) bulb meristems were constructed. 671 and 479 genes were sequenced, from which 72 and
us
82 proteins were inferred for the NV-V and the V-NV libraries, respectively. Much lower transcription levels and putative gene functions were recorded in the NV-V libraries
an
compared the V-NV libraries. However, a large number of genes annotated to transposable elements (TEs), represented more than 20% of the sequenced cDNA were
M
expressed in the NV-V libraries, as opposed to less than 2% in the V-NV libraries. The expression profile of several genes potentially involved in the vernalization pathway was
d
assessed. Expression of LlSOC1, the lily homologue of SUPPRESSOR OF OVEREXPRESSION OF CO1 (SOC1), an important flowering gene in several plant species, found
te
in the V-NV library, was highly up-regulated during bulb meristem cold exposure. The
Ac ce p
subtraction libraries provided a fast tool for relevant gene isolation.
KEY WORDS
ESTs; flowering; meristem; Lilium longiflorum; subtraction libraries; vernalization.
ABBREVIATIONS
EST, expressed sequence tags; qPCR, quantitative real-time polymerase chain reaction; TE, transposable elements; V, Vernalized; NV, Non-Vernalized.
2 Page 2 of 34
INTRODUCTION
Cold periods strongly affect various aspects of the life cycle of numerous geophytes. In
ip t
Lilium longiflorum, a prominent ornamental crop (Grassotti and Gimelli, 2011), cold exposure is required to fill the vernalization requirements to allow flowering, while in
cr
other geophytes, cold exposure is required to break dormancy (Kamenetsky et al. , 2012).
us
L. longiflorum has an obligatory requirement to vernalization, which is also the major factor affecting flowering time and quality (Dole and Wilkins, 1994, Miller, 1993). The
an
plant is receptive to the vernalization signal while in a broad spectrum of physiological stages, including the bulb and shoot elongation phases until flower initiation (Miller, 1993, Roh and Willkins, 1977b).
M
The duration of lily bulbs cold storage (2-10°C) quantitatively reduces flowering time, stem length, leaf and flower counts, up to a saturation point (Dole and Wilkins, 1994;
d
Dole and Wilkins, 1999; Holcomb and Berghage, 2001; Miller, 1993; Roh and Willkins,
te
1977a, 1977b, 1977c). In the literature, optimal cold treatments refer to the duration of bulb vernalization that ensures the production of the highest quality plants in the
Ac ce p
shortest period. Both morphological and biochemical markers have been investigated to determine whether bulb cold treatment was sufficient to induce flowering (Dole, 2003), but suitable markers still need to be established that will accurately indicate the amount of vernalization needed to attain optimal flower quality and flowering time and avoid problems related de-vernalization of cold-treated bulbs, causing the delay of flowering (Miller, 1993).
Although the physiological aspects of vernalization have been studied, leading to effective manipulation in lily flowering, needed for success in the floriculture industry, the molecular regulation of this major mechanism remains almost unknown. Identification of molecular components of lily vernalization will bring about new breeding means as well as interesting data on the conservation of this mechanism
3 Page 3 of 34
across plant species. Moreover, this could lead to the isolation of vernalization markers for best flower production. Most of our understanding about the molecular basis of vernalization derives from studies performed in Arabidopsis and, more recently, in cereals (Amasino, 2010,
ip t
Distelfeld et al., 2009; Kim et al., 2009).
In Arabidopsis, FLOWERING LOCUS C (FLC), a MADS-box gene encoding a potent
cr
repressor of flowering, is active in meristems in autumn. While FLC represses genes that direct meristems to form flowers, it relies on FRIGIDA (FRI) to elevate its autumnal
us
expression to a level that prevents flowering. During winter, vernalization causes the acquisition of meristem competence to flower by repressing FLC expression. Once it has
an
been repressed by vernalization, FLC remains off for the rest of the plant’s life cycle after the return of warm conditions, i.e., the repression is epigenetic in the sense that it
M
is mitotically stable in the absence of the inducing signal (cold exposure). The mechanism of epigenetic repression of FLC involves histone modifications that convert
d
FLC into a heterochromatin-like state. A key player in the vernalization-mediated silencing of FLC is VERNALIZATION INSENSITIVE 3 (VIN3). Probably a component of a
te
chromatin-remodelling complex, VIN3 is required for all FLC chromatin modifications
Ac ce p
associated with vernalization-mediated silencing. The induction of VIN3 expression is the only known output of the system that measures cold, and only a complete winter season of cold will induce VIN3 expression (Sung and Amasino, 2004). In winter cereals requiring vernalization, a system similar to that in Arabidopsis exists. Specifically, a flowering repressor prevents flowering prior to cold exposure and the expression of this repressor is turned off by cold. In wheat, the repressor is a type of zinc-finger protein VERNALIZATION 2 (VRN2). One of the genes repressed by VRN2 is VRN1, which encodes a MADS-box protein that promotes flowering. In fact, the VRN1 gene from cereals plays a crucial and dual role in flowering, first by inducing the expression of the cereal FT homologue, through the vernalization pathway, and secondly, acting as a floral meristem identity gene (Li and Dubcovsky, 2008; Yan et al., 2006). 4 Page 4 of 34
Several homologues to vernalization and flowering-related genes, such VRN1, have been detected in EST libraries from cold-exposed axillary buds of the orchid species Dendrobium nobile (Liang et al., 2012). However, homologues of the floral repressors FLC and VRN2 were not detected in this study – either due to limitations of the
ip t
technique or to the absence of these genes from the orchid genome, hinting that a different mechanism of flowering repression would operate in this species.
cr
Previous studies performed on diverse plant species have therefore demonstrated that, although the general mechanism of vernalization is conserved among distant species,
us
the sequence of the main regulating genes, the “repressors”, is not. Different genes, regulating vernalization, are therefore expected to be isolated from geophytes, as many
an
of them have strong vernalization requirements and lily in particular (Kamenetsky et al., 2012). L. longiflorum was chosen as a model bulb plant to study the molecular events
M
regulating vernalization for the following reasons: (1) the availability of extensive physiological characterization; (2) the obligatory vernalization requirement and the
d
quantitative response to the vernalization period, which indicates that flowering time may be manipulated; (3) the similarities of the Arabidopsis and lily flowering processes;
te
(3) the relative rapidity of lily flowering compared to other important flowering bulbs
Ac ce p
(such as tulip); (4) the possibility of genetically transforming lily plants; (5) the major importance of lily cut flowers and potted plant production worldwide. Significant progress in the understanding of lily vernalization is expected from the molecular studies planned in this project. Because exposing the bulbs to low temperatures dramatically accelerates flowering, our hypothesis was that the cold induces the differential expression of genes involved in the vernalization pathway, which can be isolated by a system revealing differential gene expression.. To this end, we constructed subtraction libraries using cDNAs from the meristems of bulbs either exposed or not exposed to cold. In this study, we first investigated the physiological response of L. longiflorum cv. White Heaven to vernalization and demonstrated the quantitative effect of cold exposure on bolting and flowering. We then produced and sequenced subtraction libraries of 5 Page 5 of 34
meristems cDNA from bulbs exposed to 25oC or 4oC for 9 weeks. These libraries revealed a series of differentially expressed genes, including a group of TEs, only expressed in bulbs without cold exposure.
cr
ip t
MATERIALS AND METHODS
Plant material, meristem characterization and growth conditions
us
L. longiflorum bulbs (cultivar White Heaven) were purchased from a nursery in August. Bulbs were sanitized and stored in moist medium mixture of peat and vermiculite (1:1, v/v) at 250C or 40C for 9 weeks. Every week, shoot apical meristems were excised from
an
the bulbs, immediately frozen in liquid nitrogen and stored at -80oC until RNA extraction. Stem elongation within the bulb during cold treatment was measured every
M
week in 15 bulbs (replicates). After planting, meristems were isolated from the plants, their developmental stage was characterized under a stereo microscope (Stemi 2000C,
te
extraction.
d
Zeiss, Germany) and they were immediately stored in liquid nitrogen for further RNA
For the flowering experiment, lily bulbs were stored for 0, 1, 2, 3, 4, 5, 6, 7, 8 or 9 weeks
Ac ce p
, at 4oC and otherwise were kept at 25oC. All bulbs were planted on 26.10.10 in a greenhouse, under natural day length and monthly average temperatures fluctuating between 19.1oC (January) and 32.1oC (May). During growth, plants were sampled at intervals for meristem observation under a Stemi microscope. The floral transition stage was assessed when first flower primordia were formed in the meristem. Flowering was determined when the first flower of the inflorescence in each plant reached anthesis. For each cold treatment, mean values of the time from planting to flower transition and time from planting to flowering were based on 20 plants (replicates).
Subtraction libraries Total RNA was isolated from 27 meristems from bulbs kept at 52oC (non vernalized, NV) and 13 meristems from bulbs kept at 4oC (vernalized, V) for 9 weeks , using Tri reagent 6 Page 6 of 34
(Sigma-Aldrich), following the manufacturers protocol. Any contaminating DNA was removed by DNase digestion (DNA-free kit, Ambion). The RNA concentration was estimated spectrally (Nano Drop ND-1000; Nano Drop Technologies). mRNA was
Madison, WI) according to the manufacturer's instructions.
ip t
purified from total RNA using the PolyATtract mRNA isolation system (Promega,
The PCR-Select cDNA Subtraction kit (Clontech) was used to isolate genes of
cr
differentially expressed genes during cold exposure, following manufacturer's protocol. Basically, 5 g mRNA from meristems of NV and V bulbs was first converted into cDNA.
us
These two cDNA populations were used both as "tester" (population containing specific transcripts) and "driver" (reference cDNA) for the production of different libraries,
an
namely "NV-V" and "V-NV". This method has been successfully used in lily to isolate
M
differentially expressed genes in pollen (Wang et al., 2004).
Sequences analyses and functional annotation
d
Gene fragments generated from the libraries were cloned into the pGEM-T vector (Promega) and several hundreds of clones from each library were sequenced and built
Ac ce p
(outsourcing).
te
into contigs at the Genome Center at Washington University St. Louis, Missouri, U.S.A
Functional annotation of the clones was performed using weighted BLAST, HMMER and ARGOT2, based on their p-values (no higher than 10-10) and semantic relationship. The complexity of the resulting gene ontologies (GOs) was reduced using GOslims (http://www.geneontology.org/). Venn plots were generated using Microsoft EXCEL.
Expression analysis of selected genes Based on homology analysis to genes from other plant species involved in vernalization or flowering mechanisms or in methylation activity, four genes were selected for further expression analysis by qPCR in the meristem during bulbs cold exposure and subsequent development above the bulb. The experiment was performed in five biological 7 Page 7 of 34
replicates, which consisted of five meristems, 0.2g in total, isolated from five different plants between 1:00 pm and 03:00 pm on each harvest day. A total of 25 meristems were collected from 30 different plants on each harvest day for qPCR analyses. Meristems from non-vernalized bulbs and bulbs vernalized for 2, 5, 7 or 9 weeks were
ip t
harvested at planting. Vegetative and reproductive meristems from above-ground parts were harvested during plant growth according to the relevant developmental stage.
cr
Total RNA was isolated with the Aurum Total RNA Mini kit (Bio-Rad Laboratories). A Nano Drop ND-1000 (Nano Drop Technologies) was used to determine RNA
us
concentration. cDNA was obtained using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). A quantity of 1000 ng total RNA was used for each reaction
an
mix. The relative level of transcripts was assessed by qPCR (7300 real-time PCR system, Applied Biosystems), with primer sequences designed by Primer-Express (Version 2.0,
M
Applied Biosystems). Expression patterns of the tested genes from lily were normalized to the expression of the lily housekeeping gene polyubiquitin (UBQ from L. longiflorum,
d
Accession #:AAF21992). All amplicon length ranges were between 80 and 85 bp. Each reaction contained 100 ng cDNA, 10 ml Power SYBR Green PCR MasterMix (Applied
te
Biosystems), and 500 nM of each of the forward and reverse primers for the tested
Ac ce p
genes and 700nM for the endogenous control (UBQ). The program used was as follows: 50oC for 2 min, 95oC for 10 min, followed by 40 cycles of 95oC for 15 s and 60oC for 1min each, and a dissociation stage of 95oC for 15 s, 60oC for 1min, and 95oC for 15 s. The 7300 System SDS software (Applied Biosystems) was used to analyze RNA relative quantification. Each value represents the mean (± SE) of 5 independent samples (replicates), each performed in three technical replicates.
Primers Primers used for qPCR analyses were as follows: Llhxa102
(Histone
JZ476869.1):
acetyltransferase
complex
F-TGGCCGAAGCAAAGTTGTTT
component102,
(Forward);
GenBank
Acc:
CCCACTTTCCCTGGCTTTCT
(Reverse), with an amplicon length of 80 bp. 8 Page 8 of 34
LlRBP1 (RNA binding protein, GenBank Acc: 516677337): GGCCAAGCACCTCCTGCTA (Forward); CCAGGCCTCATTCCAGGAA (Reverse), with an amplicon length of 80 bp. LlSOC1
(GenBank
Acc:
JZ476871):
TGTGAATCTGCGGATCTCATG
(Forward);
CAGATTTTCACACAACCGTATCCT (Reverse), with an amplicon length of 80 bp.
ip t
LlAt4g26220-like (Genebank Acc: JZ476870): CCTTACAACGGCTCTTGCATT (Forward); (Reverse), with an amplicon length of 85 bp.
cr
UBQ: GGGAGCATTTGCCTTGACAT (Forward); AGTCAGGAGCGAGCAGATTGA (Reverse),
us
with an amplicon length of 85 bp.
Phylogenetic analysis
an
For each of the selected genes, the deduced amino acid sequence was aligned to the sequence of homologous genes from other plant species using the CLUSTALW program.
M
A phylogenetic tree was constructed for each gene using the neighbor-joining method
d
(MEGA) (Tamura et al., 2011).
te
RESULTS
Ac ce p
Effect of vernalization on stem elongation and flowering Stem elongation within the bulb during cold treatment Stem elongation within the bulb (Fig. 1A) was measured at intervals during cold exposure (4°C). Bulbs stored for 8 weeks at 4oC developed significantly longer stems (about 40% increase) than bulbs kept at 25oC for the same period (Fig.1B). In average, stem length within the bulb after 9 weeks vernalization was about 5mm and stem elongation occurred during cold treatment. The effect of cold exposure on stem elongation within the bulb showed a quantitative pattern, with increasing period of cold resulting in a decrease in the time until stem reached 5 mm (Fig. 1C). Two weeks cold exposure induced a significant decrease of about 12%, while additional two weeks reduced the time by an impressive 62%. Floral transition and flowering 9 Page 9 of 34
Bulb vernalization markedly decreased the time from planting to floral transition and to flowering (Fig. 2). Similarly to stem elongation within the bulb, the quantitative character of the effect of vernalization was noticeable. The effect of the first week of vernalization led to a decrease of about 20% in the time to floral transition and to
ip t
flowering. This was the highest effect of a single week for flowering (meaning – the effect of additional single week of cold led to lower decrease). However, for flower
cr
transition the highest effect of a single week of cold exposure was recorded between week 8 and week 9 (33%). Overall, cold exposure of the bulbs for 9 weeks at 4oC induced
us
a reduction of ca. 80% and 55% in the time to floral transition and flowering,
Subtracted libraries
M
Functional annotation of sequenced genes
an
respectively, compared to bulbs which were not exposed to cold before planting (Fig. 2).
cDNA libraries were constructed from meristematic tissues (Fig. 3A) isolated from bulbs
d
after 9 weeks at 25oC (NV) or 4oC (V). A period of 9 weeks exposure to cold was selected on the basis of physiological data demonstrating that, after 9 weeks saturation or near-
te
saturation of vernalization has been reached and a significant decrease in the time to
Ac ce p
the transition to flowering and flowering itself is observed. We therefore assumed that at this time, potential flowering inhibitors are not expressed anymore in the bulb. Subtraction libraries were made in both directions to detect differentially expressed genes in V and NV bulbs. We The overall transcription level (amount of mRNA from total RNA), was three times higher in V than in NV meristems. A total of 671 and 479 clones were sequenced from the NV-V and the V-NV libraries, respectively. From these clones, 72 and 82 proteins were inferred from the NV-V and the V-NV libraries, respectively. Functional annotation revealed definite differences between both libraries. First, the lower transcription level of the NV-V libraries was reflected by a much lower amount of putative functions, at the biological, cellular and molecular levels compared to genes the V-NV libraries (Fig. 3B, C and D). Similarly, only few functions were specific to the NV-V, while most function were also present in the V-NV libraries. 10 Page 10 of 34
Specific functional annotation of the proteins at the biological level is presented in Fig. 4. In the NV-V libraries, only a few biological functions were inferred and most of them belonged to DNA integration (Fig. 4A). On the other hand, a large number of diverse functions were assigned to the ESTs from the V-VN library (Fig. 4B), including
ip t
transcription and translation, protein folding, response to stress and auxin signalling.
vernalization, i.e., from resting to actively growing tissues.
cr
These results are totally in line with the bulb developmental state before and after
us
Putative vernalization, flowering, dormancy and cold response functions of ESTs Our primary goal was to find genes related to the control of the vernalization pathway
an
and to the flowering mechanism in lily. A gene showing homology with SUPPRESSOR OF OVER-EXPRESSION OF CO 1 (SOC1), a MADS-box transcription factor playing a major role
M
in the flowering pathway in Arabidopsis was found in the V-NV libraries (#1, Table 1). This gene was particularly interesting, since in Arabidopsis, its expression is induced by
d
vernalization in a quantitative manner, inversely correlated to the expression of the flowering inhibitor FLC, but is also strongly directly induced by cold exposure (Sheldon et
te
al., 2006). LlSOC1 was further characterized and its expression during cold exposure and
Ac ce p
plant development was analyzed (see below). Gene #2 (Table 1) was also included in the group of genes with a putative function in the vernalization pathway, since it comprises a SWIRM domain, found in several proteins involved in chromatin remodeling and chromatin modification complexes (Da et al. , 2006). This gene was isolated from the V-NV library. Specifically, the SWIRM domain found in the histone demethylase (FLD) enables interactions with proteins in other complexes involved in the silencing process of FLC (Yu et al., 2011). Like LlSOC1, Llhxa102 was further analyzed (see below). A homolog of a DNAj protein-like gene was also detected in the V-NV library (# 3, Table 1). DNAj proteins play important roles in major post-translational process, through interaction with the chaperone heat shock protein 70 (Hsp70). In Arabidopsis, DNAj, type I was found to play a role in the integration of the flowering signals, specifically by 11 Page 11 of 34
its interaction with the flowering repressor SHORT VEGETATIVE PHASE (SVP), which inhibits its binding to the FT promoter (Shen et al., 2011). Therefore this protein has an enhancing effect on flowering time and it was detected in the V-NV library. Similarly, a soybean DNAj protein was found to be upregulated by a series of stresses, including cold
ip t
(So et al., 2013).
Another gene which might be related to flowering was detected from the NV-V library
cr
(#4, Table 1) and showed homology to a ripening regulated protein in tomato (Giovannoni et al. , 1999), which contains an AP2/EREB domain , found in transcription
us
factors involved in the regulation of developmental mechanisms like flower development, stress and cold response and freezing tolerance in plants only (Gilmour et
an
al., 1998; Lin et al., 2007; Ouyang et al., 2007; Riechmann and Meyerowitz, 1998). This domain is also found in sevral Arabidopsis flowering repressors (Immink et al., 2012;
M
Schmid et al., 2003).
Vacuolar-processing enzymes (VPE) (#5, Table 1) are involved in proteolytic
d
mechanisms, for example recycling of amino acids from degraded proteins in the cell. VPEs are also involved in programmed cell death
(PCD) in the context of plant
te
developmental mechanisms and response to pathogens (Muntz, 2007).VPE is involved
Ac ce p
in the early stages of seed germination by causing CPD of the outer layers of the embryo sac, thereby enabling seed coat production (Nakaune et al., 2005). We found a VPE homologue in the NV-V library.
Gene #6, detected in the V-NV libraries, encodes for Glutathione – S transferase (GST), which is overexpressed during endo-dormancy in oak buds (Ueno et al. , 2013) and upregulated during dormancy release in raspberry, probably in the context of response to oxidative stress (Mazzitelli et al., 2007). In addition, gluthatione increased biosynthesis can partially replace the vernalization requirements of Arabidopsis seeds and enhance faster flowering (Hatano-Iwasaki and Ogawa, 2012). Gene #7 (Table 1) showing homology to GTP-binding proteins from glycine, was detected from the NV-V library. Among other tasks, these genes are involved in abscisic acid (ABA) signalling and in the regulation of seed germination and dormancy in 12 Page 12 of 34
Arabidopsis and in Fagus sylvatica (Nicolas et al., 1998; Pandey et al., 2006). These proteins have been suggested to be involved in major developmental processes, as well as in response to stress (Shan et al., 2005). Plant ABC transporters (#8, Table 1) belong to a large family of genes involved in many
ip t
functions including growth, development and response to stress. Interestingly, ABC transporters were fund to be related to the transport of ABA (Kang et al., 2011), which is
cr
more abundant in dormant and resting bulbs than in more metabolically active bulbs (Djilianov et al., 1994).
us
Both #7 and #8 genes, with putative functions related to ABA signalling and transport were isolated from the NV-V libraries.
an
Finally, we examined genes which may be involved in the plant’s response to cold. Expectedly, such genes were detected in the V-NV libraries and may be involved in the
M
long-term, rather than the short-term response of the plant to cold, since they were expressed after 9 weeks at 4oC.
d
It was reported that sucrose synthase (#9, Table 1) was up-regulated by cold, both in lily bulblets (Shin et al., 2002) and in barley grains (Barrero-Sicilia et al., 2011). Sucrose
te
synthase activity is considered a major component of sink strength in potatoes (Zrenner
Ac ce p
et al., 1995). Lily bulb exposure to low temperatures also induces a reduction in the amount of starch, the main storage substance in scales, into soluble carbohydrates (Miller and Langhans, 1990).
A component of the 19S lid of the 26S proteasome was expressed at the 9 th week of vernalization (#10, Table 1). Ubiquitination is known to play a major role in plant adaptation to abiotic stress, including cold stress and is also related to ABA signaling (Lyzenga and Stone, 2012).
Gene # 11 (Table 1) showed homology to a helicase, belonging to the DEAD-box protein superfamily, involved in essential processes in the cell (such as DNA replication and RNA transcription), but also in the regulation of plant development during stress exposure, including cold (Ambrosone et al., 2012; Vashisht and Tuteja, 2006).
13 Page 13 of 34
Similarly, gene #12 (Table 1) shared homology to methyltransferases, whose activity is highly implicated in the vernalization process of several plant species (Woods et al., 2014), as well as in other important developmental processes, including germination and in gene expression in general (Meng et al., 2012; Paszkowski and Whitham, 2001).
ip t
The RNA binding proteins (# 13, Table 1) function to perform post-transcriptional modifications including changes caused by the plant’s response to external conditions
cr
(Ambrosone et al., 2012). In Arabidopsis, several RNA-binding proteins have been linked to the regulation of FLC, thereby affecting flowering regulation (Rataj and Simpson,
us
2014). Therefore, the lily homologues of both methyltransferase and RNA binding proteins (# 12 and 13, respectively, Table 1) were further analyzed (see below).
an
Proton pumps (#14, Table 1) play crucial roles in many physiological processes in plants (Serrano, 1989). In grape, activity of the proton pump H+-ATPase has clearly been
M
associated with chilling resistance as a result of chilling pre-treatments, in the process of acclimation (Zhang et al., 2006).
d
Gene #15 encodes a putative translation elongation factor (Table 1), which may be related to cold-induced expression of several genes and to freezing tolerance. This gene
te
may be involved in the response of the plant to the cold rather than in vernalization
Ac ce p
itself, as shown by one of the studied mutations, which wasn’t impaired in vernalization (Guo et al., 2002).
TEs
In addition to the selected sequences mentioned in Table 1, we observed that a large number of genes were annotated to TEs. These sequences amounted to more than 20% of the total cDNA sequenced in the NV-V libraries, as opposed to less than 2% in the VNV libraries (Table 2), clearly demonstrating differential expression of this group of genes. Most TEs belonged to the class 1 LTR retrotransposons (Feschotte et al., 2002), with the vast majority of the Gypsy type, which has been previously isolated from L. henryi (Smyth et al., 1989). This was also the only type of retrotransposons found in the V-NV cDNA. Another LTR element, Ty1/Copia, accounted from 3.65% of the NV-V 14 Page 14 of 34
sequenced cDNA (Table 2). This type of retrotransposons constitute more than 5% of the genomes of Frittillaria species, including the Liliaceae family (Ambrozova et al., 2011), and was recently isolated from L. longiflorum (Lee et al., 2013). Other TE types
ip t
accounted for a small portion of the sequenced ESTs.
Expression pattern of selected genes potentially related to the vernalization process in
cr
lily during bulb cold exposure and plant development
According to their putative involvement in vernalization/flowering or cold response in
upregulation
by
cold:
we
selected
two
us
other organisms, several genes were selected for further verification of their genes
from
the
first
category
an
(vernalization/flowering), LlSOC1 (#1, Table 1), and histone acetyltransferase complex component containing a SWIRM motif (#2, Table 1), and two genes from the last
M
category (cold response), namely a methyltransferase (#12, Table 1) and an RNA binding protein (#13, Table 1), hereby, LlSOC1, Llhxa102, LlAt4g26220-like and LlRBP1,
d
respectively, where Ll stands for Lilium longiflorum. The expression of these genes was assessed in lily bulb meristems during cold exposure
te
as well as in the apical meristem at later stages of above-ground plant development. All
Ac ce p
the selected genes were found to be up-regulated during bulb exposure to cold to various extends, compared to the control (0 weeks vernalization) (Fig. 5). The highest level of up-regulation was observed either after 9 weeks (Fig. 5A, B) or after 5 weeks of cold exposure (Fig. 5C, D), with utmost values (more than 20 fold) recorded for LlSOC1 (Fig. 5C). Expression of all four genes was lower in the meristem during development of the above-ground parts of the plant. Phylogenic analyses showed that the four validated genes from L. longiflorum were closer to other monocotyledons to than dicotyledonous species (Fig. 6).
DISCUSSION Response of L. longiflorum to vernalization
15 Page 15 of 34
Results of our experiments on the response of L. longiflorum, cv. White Heaven to vernalization were in agreement with previously published results from other L. longiflorum cultivars (Ishimori and Niimi, 2005; Ishimori et al., 2007; Miller, 1993; Roh and Willkins, 1977a). Cold exposure induced stem elongation within the bulb (Fig. 1) and
ip t
reduced the time from planting to floral transition and to flowering in an inverse relationship and in a quantitative manner (Fig. 2). To our knowledge, this is the first
cr
report on the detailed analysis of the effect bulb cold exposure on floral transition, assessed by microscopic observation. The effect of cold exposure was more pronounced
us
on the time from planting to floral transition, reflecting the actual vernalization pathway, than on the time from planting to flowering itself, which was also affected by
an
the duration of flower development, from meristematic stage to fully open flowers. From our experiments, it could not be undoubtedly inferred that the plant’s response to
M
vernalization had indeed reached its saturation point after 9 weeks, as reported for other lily cultivars after 6 weeks of exposure of the bulbs to cold (Miller, 1993).
d
Nevertheless, the response of lily plants to bulb cold exposure was strong, quantitative and expected. Therefore, it provided the physiological base to the performance of
Ac ce p
te
subtraction libraries from non-vernalized and vernalized bulbs.
Analysis of subtraction libraries and validation of gene expression The amount of mRNA isolated from total RNA was strikingly higher in the V-NV than in the counterpart NV-V libraries. This feature is most probably due to the higher metabolic activity of bulb meristems after cold exposure, as compared to meristems from non-vernalized bulbs. From experiments performed in the past, we reached the conclusion that lily bulbs never actually undergo dormancy during the summer, since, when grown under suitable conditions of irrigation, they were still producing leaves (A. Ram and M. Zaccai, in preparation). Although non-vernalized bulbs are not dormant, they are at a resting state, during which the meristem is almost not active. On the opposite, meristems of bulbs exposed to cold are actively growing (Fig. 1 B, C) and
16 Page 16 of 34
undergo metabolic activity, such as carbohydrates degradation for sugar production (Shin et al., 2002; Xu et al., 2006). Analysis of subtraction libraries from vernalized and non-vernalized lily meristems enabled the detection of several groups of genes potentially involved in lily response to
ip t
cold, in the regulation of flowering and in the vernalization pathway. Such genes include for example an AP2-gene, from the non-vernalized library, as a potential repressor of
cr
flowering and LlSOC1, from the vernalized-meristems library, which was greatly upregulated during lily bulb vernalization (Fig. 5C). In other species, SOC1 is the target of
us
AP2-genes (Immink et al., 2012; Papaefthimiou et al., 2012) and the present results hint that this could be the case also in lily.
an
The massive expression of TEs found in the NV-V library, i.e., expressed when the bulbs are at a resting period, as opposed to being more metabolically active during and after
M
vernalization (V-NV) was quite surprising. Indeed, general acknowledged models and data imply that transposon activity is linked to gene regulation and specifically to the
d
response to cold stress (Naito et al., 2009) and references therein) and to genotypic vernalization response (Laudencia-Chingcuanco and Fowler, 2012). Transposon
te
expression during lily bulbs rest period could have a specific task in the maintenance of
Ac ce p
this state. Additional analyses are currently being performed to further explore the regulation of TEs expression during cold exposure of lily bulbs. Genes whose expression was validated by qPCR were selected from the V-NV library and indeed showed up-regulation during cold exposure, showing that the libraries were basically a useful tool for the detection of differentially expressed gene in lily meristems.
CONCLUSION
The subtraction libraries led to the isolation of a substantial amount of genes differentially expressed in V and NV lily bulb meristems. Based on sequence homology with other plant species, we were able to identify several candidate genes, potentially involved in the regulation of the lily flowering mechanism in general and the vernalization pathway in particular. This study provides the basis for further functional 17 Page 17 of 34
analyses of selected genes, which would ultimately lead to the elucidation and possible manipulation of lily flowering.
ACKNOWLEDGEMENTS
ip t
The authors thank Assael Ram for advice and help with the experiments, Shlomit Hellman for her help in measurements and Prof. Ofer Ovadia for valuable help with the
cr
MEGA program. This study was funded by a grant from the Chief Scientist of the Israeli
Ac ce p
te
d
M
an
us
Ministry of Agriculture (#857-0535-07).
18 Page 18 of 34
REFERENCES
Ac ce p
te
d
M
an
us
cr
ip t
Amasino R. Seasonal and developmental timing of flowering. Plant J 2010;61:1001-13. Ambrosone A, Costa A, Leone A, Grillo S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Sci 2012;182:12-8. Ambrozova K, Mandakova T, Bures P, Neumann P, Leitch IJ, Koblizkova A, et al. Diverse retrotransposon families and an AT-rich satellite DNA revealed in giant genomes of Fritillaria lilies. Ann Bot 2011;107:255-68. Barrero-Sicilia C, Hernando-Amado S, Gonzalez-Melendi P, Carbonero P. Structure, expression profile and subcellular localisation of four different sucrose synthase genes from barley. Planta 2011;234:391-403. Da GP, Lenkart J, Zhao KH, Shiekhattar R, Cairns BR, Marmorstein R. Structure and function of the SWIRM domain, a conserved protein module found in chromatin regulatory complexes. Proc Natl Acad Sci USA 2006;103:2057-62. Distelfeld A, Li C, Dubcovsky J. Regulation of flowering in temperate cereals. Curr Opin Plant Biol 2009;12:178-84. Djilianov D, Gerrits MM, Ivanova A, Vanonckelen HA, Deklerk GJM. ABA content and sensitivity during the development of dormancy in lily bulblets regenerated in-vitro. Physiol Plant 1994;91:639-44. Dole JM. Research approaches for determining cold requirements for forcing and flowering of geophytes. HortScience 2003;38:341-46. Dole JM, Wilkins HF. Interaction of bulb vernalilzation and shoot photoperiod on "Nellie White" Esater lilly. HortScience 1994;29:143-45. Dole JM, Wilkins HF. Lilium, Easter, in Floriculture. Principles and Species. 1999. Feschotte C, Jiang N, Wessler SR. Plant transposable elements: Where genetics meets genomics. Nat Rev Gen 2002;3:329-41. Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF. Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 1998;16:433-42. Giovannoni J, Yen H, Shelton B, Miller S, Vrebalov J, Kannan P, et al. Genetic mapping of ripening and ethylene-related loci in tomato. Theor Appl Genet 1999;98:1005-13. Grassotti A, Gimelli F. Bulb and Cut Flower Production in the Genus Lilium: Current Status and the Future. In: Grassotti A, Burchi G, editors. II International Symposium on the Genus Lilium 2011. p. 21-35. Guo Y, Xiong L, Ishitani M, Zhu J-K. An Arabidopsis mutation in translation elongation factor 2 causes superinduction of CBF/DREB1 transcription factor genes but blocks the induction of their downstream targets under low temperatures. P Natl Acad Sci USA 2002;99:7786-91. Hatano-Iwasaki A, Ogawa K. Overexpression of GSH1 gene mimics transcriptional response to low temperature during seed vernalization treatment of Arabidopsis. Plant Cell Physiol 2012;53:1195-203. 19 Page 19 of 34
Ac ce p
te
d
M
an
us
cr
ip t
Holcomb EJ, Berghage R. Photoperiod, chilling, and light quality during daylight extension affect growth and flowering of tissue-cultured easter lily plants. Hortscience 2001;36:53-55. Immink R, Pose D, Ferrario S, Ott F, Kaufmann K, Leal Valentim F, et al. Characterisation of SOC1’s central role in flowering by the identification of its up- and downstream regulators. Plant Physiol 2012;160: 433-49. Ishimori T, Niimi Y. Similar effects of colchicine and low temperature on initiation and elongation of stems in bulblets developed on scales of ‘White Aga’ (Lilium x formolongi) cultured in vitro. Acta Hort (ISHS). 2005;673:395-400. Ishimori T, Niimi Y, Han DS. Benzyladenine and low temperature promote phase transition from juvenile to vegetative adult in bulblets of Lilium x formolongi 'White Aga' cultured in vitro. Plant Cell Tiss Org 2007;88:313-18. Kamenetsky R, Zaccai M, Flaishman M. Florogenesis. In: Kamenetsky RaO, Hiroshi, editor. Ornamental Geophytes: From Basic Science to Sustainable Production. Boca Raton, FL: CRC Press Taylor and Francis Group; 2012. p. 197-232. Kang J, Park J, Choi H, Burla B, Kretzschmar T, Lee Y, et al. Plant ABC Transporters. The Arabidopsis book / American Society of Plant Biologists. 2011;9:e0153. Kim DH, Doyle MR, Sung S, Amasino RM. Vernalization: Winter and the Timing of Flowering in Plants. Annu Rev Cell Dev Biol 2009. p. 277-99. Laudencia-Chingcuanco D, Fowler DB. Genotype-dependent Burst of Transposable Element Expression in Crowns of Hexaploid Wheat (Triticum aestivum L.) during Cold Acclimation. Compar Funct Genom 2012, http://www.hindawi.com/journals/ijg/2012/232530/, DOI 10.1155/2012/232530. Lee SI, Park KC, Son JH, Hwang YJ, Lim KB, Song YS, et al. Isolation and characterization of novel Ty1-copia-like retrotransposons from lily. Genome 2013;56:495-503. Li C, Dubcovsky J. Wheat FT protein regulates VRN1 transcription through interactions with FDL2. Plant J 2008;55:543-54. Liang S, Ye Q-S, Li R-H, Leng J-Y, Li M-R, Wang X-J, et al. Transcriptional regulations on the low-temperature-induced floral transition in an Orchidaceae Species, Dendrobium nobile: an Expressed Sequence Tags analysis. Compar Funct Genom 2012;2012:757801. Lin R, Zhao W, Meng X, Peng Y-L. Molecular cloning and characterization of a rice gene encoding AP2/EREBP-type transcription factor and its expression in response to infection with blast fungus and abiotic stresses. Physiol Mol Plant P 2007;70:60-68. Lyzenga WJ, Stone SL. Abiotic stress tolerance mediated by protein ubiquitination. J Exp Bot 2012;63:599-616. Mazzitelli L, Hancock RD, Haupt S, Walker PG, Pont SDA, McNicol J, et al. Co-ordinated gene expression during phases of dormancy release in raspberry (Rubus idaeus L.) buds. J Exp Bot 2007;58:1035-45. Meng FR, Li YC, Yin J, Liu H, Chen XJ, Ni ZF, et al. Analysis of DNA methylation during the germination of wheat seeds. Biolog Plant 2012;56:269-75. Miller WB. Lilium longiflorum. In: Nard DHaL, editor. The Physiology of Flower Bulbs. Amsterdam, London, New York, Tokyo: Elsevier; 1993. p. 391-422. Miller WB, Langhans RW. Low Temperature Alters Carbohydrate Metabolism in Easter Lily Bulbs. HortScience 1990;25:463-65. 20 Page 20 of 34
Ac ce p
te
d
M
an
us
cr
ip t
Muntz K. Protein dynamics and proteolysis in plant vacuoles. J Exp Bot. 2007;58:2391407. Naito K, Zhang F, Tsukiyama T, Saito H, Hancock CN, Richardson AO, et al. Unexpected consequences of a sudden and massive transposon amplification on rice gene expression. Nature 2009;461:1130-U232. Nakaune S, Yamada K, Kondo M, Tomohiko K, Tabata S, Nishimura M, et al. A vacuolar processing enzyme, δvpe, is involved in seed coat formation at the early stage of seed development. Plant Cell 2005;17:876-87. Nicolas C, Nicolas G, Rodriguez D. Transcripts of a gene, encoding a small GTP-binding protein from Fagus sylvatica, are induced by ABA and accumulated in the embryonic axis of dormant seeds. Plant Mol Biol 1998;36:487-91. Ouyang B, Yang T, Li H, Zhang L, Zhang Y, Zhang J, et al. Identification of early salt stress response genes in tomato root by suppression subtractive hybridization and microarray analysis. J Exp Bot 2007;58:507-20. Pandey S, Chen JG, Jones AM, Assmann SM. G-protein complex mutants are hypersensitive to abscisic acid regulation of germination and postgermination development. Plant Physiol 2006;141:243-56. Papaefthimiou D, Kapazoglou A, Tsaftaris AS. Cloning and characterization of SOC1 homologs in barley (Hordeum vulgare) and their expression during seed development and in response to vernalization. Physiol Plant 2012;146:71-85. Paszkowski J, Whitham SA. Gene silencing and DNA methylation processes. Curr Opin Plant Biol 2001;4:123-29. Rataj K, Simpson GG. Message ends: RNA 3′ processing and flowering time control. J Exp Bot 2014;65:353-63. Renaut J, Hausman J-F, Bassett C, Artlip T, Cauchie H-M, Witters E, et al. Quantitative proteomic analysis of short photoperiod and low-temperature responses in bark tissues of peach (Prunus persica L. Batsch). Tree Genet Genomes 2008;4:589-600. Riechmann JL, Meyerowitz E. The AP2/EREBP family of plant transcription factors. Biol Chem 1998;379:633-46. Roh SM, Willkins HF. The effects of bulb vernalization and shoot photoperiod treatments on growth and flowering in Lilium longiflorum Thunb. cv. Nellie White. J Amer Soc Hort Sci 1977a;102:229-35. Roh SM, Willkins HF. Temperature and photoperiod effect on flower numbers in Lilium longiflorum Thunb. J Amer Soc Hort Sci 1977b;102:235-42. Roh SM, Willkins HF. Comparison of continuous and alternating bulb temperature treatments on growth and flowering in Lilium longiflorum Thunb. J Amer Soc Hort Sci 1977c;102:242-47. Schmid M, Uhlenhaut NH, Godard F, Demar M, Bressan R, Weigel D, et al. Dissection of floral induction pathways using global expression analysis. Development 2003;130:6001-12. Serrano R. Structure and Function of Plasma Membrane ATPase. Annu Rev Plant Phys 1989;40:61-94. Shan L, Zhao SY, Xia GM. Cloning of the full-length cDNA of the wheat involved in salt stress: Root hair defective 3 gene (RHD3). J Integrat Plant Biol 2005;47:881-91. 21 Page 21 of 34
Ac ce p
te
d
M
an
us
cr
ip t
Sheldon CC, Finnegan EJ, Dennis ES, Peacock WJ. Quantitative effects of vernalization on FLC and SOC1 expression. Plant J 2006;45:871-83. Shen LS, Kang YGG, Liu L, Yu H. The J-Domain Protein J3 Mediates the Integration of Flowering Signals in Arabidopsis. Plant Cell 2011;23:499-514. Shin KS, Chakrabarty D, Paek KY. Sprouting rate, change of carbohydrate contents and related enzymes during cold treatment of lily bulblets regenerated in vitro. Sci HorticAmsterdam 2002;96:195-204. Smyth DR, Kalitsis P, Joseph JL, Sentry JW. Plant retrotransposon from Lilium henryi is related to Ty3 of yeast and gypsy group of Drosophila. Proc Natl Acad Sci U S A. 1989;86:5015-19. So H-A, Chung E, Lee J-H. Molecular characterization of soybean GmDjp1 encoding a type III J-protein induced by abiotic stress. Genes & Genomics 2013;35:247-56. Tammen JF. Quantifying the cooling period for flowering of "Nellie White" Easter lily. HortScience 2003;38:21-25. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731-39. Ueno S, Klopp C, Leple JC, Derory J, Noirot C, Leger V, et al. Transcriptional profiling of bud dormancy induction and release in oak by next-generation sequencing. BMC Genomics 2013;14. Vashisht AA, Tuteja N. Stress responsive DEAD - box helicases : A new pathway to engineer plant stress tolerance. J Photoch Photobio B 2006;84:150. Wang LL, Pang JL, Jiang HM, Zhu MY. Expression of CFL gene during differentiation of floral and vegetative buds in cucumber cotyledonary nodes cultured in vitro. Zhi Wu Sheng Li Yu Fen Zi Sheng Wu Xue Xue Bao J Plant Physiol Mol Biol 2004;30:644-50. Woods DP, Ream TS, Amasino RM. Memory of the vernalized state in plants including the model grass Brachypodium distachyon. Frontiers in Plant Science 2014;5, http://journal.frontiersin.org/Journal/10.3389/fpls.2014.00099/abstract, DOI 10.3389/fpls.2014.00099. Xu R-Y, Niimi Y, Han D-S. Changes in endogenous abscisic acid and soluble sugars levels during dormancy-release in bulbs of Lilium rubellum. Sci Hortic-Amsterdam 2006;111:68-72. Yan L, Fu D, Li C, Blechl A, Tranquilli G, Bonafede M, et al. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc Natl Acad Sci USA 2006;103:19581-86. Yu C-W, Liu X, Luo M, Chen C, Lin X, Tian G, et al. HISTONE DEACETYLASE6 Interacts with FLOWERING LOCUS D and Regulates Flowering in Arabidopsis. Plant Physiol 2011;156:173-84. Zhang JH, Liu YP, Pan QH, Zhan JC, Wang XQ, Huang WD. Changes in membraneassociated H+-ATPase activities and amounts in young grape plants during the cross adaptation to temperature stresses. Plant Sci 2006;170:768-77. Zrenner R, Salanoubat M, Willmitzer L, Sonnewald U. Evidence of the crucial role of sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum L). Plant J 1995;7:97-107. 22 Page 22 of 34
Figure captions Figure 1. Effect of cold exposure on stem elongation within the bulb. A. Stem within a
ip t
bulb following removal of external scales. Bracket indicates stem elongation: from the basis of the bulb up to the basis of the meristem. Bar= 5 mm. B. Stem length within the bulb after 9 weeks at 25oC or 4oC. C. Effect of the duration of cold exposure on stem
us
cr
elongation up to 5 mm. Values with different letters are significantly different (p
S0176-1617(14)00280-6 http://dx.doi.org/doi:10.1016/j.jplph.2014.09.015 JPLPH 52044
To appear in: Received date: Revised date: Accepted date:
22-7-2014 26-9-2014 28-9-2014
Please cite this article as: Hamo ML-B, Martin CV, Zaccai M, Characterization of expressed sequence tags from Lilium longiflorum in vernalized and non-vernalized bulbs, Journal of Plant Physiology (2014), http://dx.doi.org/10.1016/j.jplph.2014.09.015 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
*Manuscript
TITLE PAGE Characterization of expressed sequence tags from Lilium longiflorum in vernalized and non-vernalized bulbs
1
Dep. of Life Sciences, Ben Gurion University of the Negev
us
cr
P.O. Box 653, Beersheva 84105, Israel 2
ip t
Maya Lugassi-Ben Hamo1, Carlos Villacorta Martin2 and Michele Zaccai1*
Genetwister Technologies B.V
P.O. Box 193
an
6700 AD Wageningen The Netherlands
M
Telephone: +31(0)317466420 Fax: +31(0)317466421
d
Email: [email protected]
Ac ce p
te
www.genetwister.nl
Maya Lugassi-Ben Hamo, email: [email protected] Carlos Villacorta Martin, email: [email protected]
Michele Zaccai, *corresponding author Department of Life Sciences
Ben Gurion University of the Negev 84105 Beersheva, Israel Telephone: +972(0)86479196 Fax: +972(0)86479261 Email: [email protected] http://www.bgu.ac.il/~mzaccai 1 Page 1 of 34
ABSTRACT In Lilium longiflorum, vernalization is both an obligatory requirement and the major factor affecting flowering time, however, little is known about the molecular regulation
ip t
of this mechanism in Lilium and other flowering bulbs. Exposure of L. longiflorum bulbs to 9 weeks at 4oC, greatly promoted stem elongation within the bulb, floral transition
cr
and flowering. Subtraction libraries of vernalized (V) and non-vernalized (NV) bulb meristems were constructed. 671 and 479 genes were sequenced, from which 72 and
us
82 proteins were inferred for the NV-V and the V-NV libraries, respectively. Much lower transcription levels and putative gene functions were recorded in the NV-V libraries
an
compared the V-NV libraries. However, a large number of genes annotated to transposable elements (TEs), represented more than 20% of the sequenced cDNA were
M
expressed in the NV-V libraries, as opposed to less than 2% in the V-NV libraries. The expression profile of several genes potentially involved in the vernalization pathway was
d
assessed. Expression of LlSOC1, the lily homologue of SUPPRESSOR OF OVEREXPRESSION OF CO1 (SOC1), an important flowering gene in several plant species, found
te
in the V-NV library, was highly up-regulated during bulb meristem cold exposure. The
Ac ce p
subtraction libraries provided a fast tool for relevant gene isolation.
KEY WORDS
ESTs; flowering; meristem; Lilium longiflorum; subtraction libraries; vernalization.
ABBREVIATIONS
EST, expressed sequence tags; qPCR, quantitative real-time polymerase chain reaction; TE, transposable elements; V, Vernalized; NV, Non-Vernalized.
2 Page 2 of 34
INTRODUCTION
Cold periods strongly affect various aspects of the life cycle of numerous geophytes. In
ip t
Lilium longiflorum, a prominent ornamental crop (Grassotti and Gimelli, 2011), cold exposure is required to fill the vernalization requirements to allow flowering, while in
cr
other geophytes, cold exposure is required to break dormancy (Kamenetsky et al. , 2012).
us
L. longiflorum has an obligatory requirement to vernalization, which is also the major factor affecting flowering time and quality (Dole and Wilkins, 1994, Miller, 1993). The
an
plant is receptive to the vernalization signal while in a broad spectrum of physiological stages, including the bulb and shoot elongation phases until flower initiation (Miller, 1993, Roh and Willkins, 1977b).
M
The duration of lily bulbs cold storage (2-10°C) quantitatively reduces flowering time, stem length, leaf and flower counts, up to a saturation point (Dole and Wilkins, 1994;
d
Dole and Wilkins, 1999; Holcomb and Berghage, 2001; Miller, 1993; Roh and Willkins,
te
1977a, 1977b, 1977c). In the literature, optimal cold treatments refer to the duration of bulb vernalization that ensures the production of the highest quality plants in the
Ac ce p
shortest period. Both morphological and biochemical markers have been investigated to determine whether bulb cold treatment was sufficient to induce flowering (Dole, 2003), but suitable markers still need to be established that will accurately indicate the amount of vernalization needed to attain optimal flower quality and flowering time and avoid problems related de-vernalization of cold-treated bulbs, causing the delay of flowering (Miller, 1993).
Although the physiological aspects of vernalization have been studied, leading to effective manipulation in lily flowering, needed for success in the floriculture industry, the molecular regulation of this major mechanism remains almost unknown. Identification of molecular components of lily vernalization will bring about new breeding means as well as interesting data on the conservation of this mechanism
3 Page 3 of 34
across plant species. Moreover, this could lead to the isolation of vernalization markers for best flower production. Most of our understanding about the molecular basis of vernalization derives from studies performed in Arabidopsis and, more recently, in cereals (Amasino, 2010,
ip t
Distelfeld et al., 2009; Kim et al., 2009).
In Arabidopsis, FLOWERING LOCUS C (FLC), a MADS-box gene encoding a potent
cr
repressor of flowering, is active in meristems in autumn. While FLC represses genes that direct meristems to form flowers, it relies on FRIGIDA (FRI) to elevate its autumnal
us
expression to a level that prevents flowering. During winter, vernalization causes the acquisition of meristem competence to flower by repressing FLC expression. Once it has
an
been repressed by vernalization, FLC remains off for the rest of the plant’s life cycle after the return of warm conditions, i.e., the repression is epigenetic in the sense that it
M
is mitotically stable in the absence of the inducing signal (cold exposure). The mechanism of epigenetic repression of FLC involves histone modifications that convert
d
FLC into a heterochromatin-like state. A key player in the vernalization-mediated silencing of FLC is VERNALIZATION INSENSITIVE 3 (VIN3). Probably a component of a
te
chromatin-remodelling complex, VIN3 is required for all FLC chromatin modifications
Ac ce p
associated with vernalization-mediated silencing. The induction of VIN3 expression is the only known output of the system that measures cold, and only a complete winter season of cold will induce VIN3 expression (Sung and Amasino, 2004). In winter cereals requiring vernalization, a system similar to that in Arabidopsis exists. Specifically, a flowering repressor prevents flowering prior to cold exposure and the expression of this repressor is turned off by cold. In wheat, the repressor is a type of zinc-finger protein VERNALIZATION 2 (VRN2). One of the genes repressed by VRN2 is VRN1, which encodes a MADS-box protein that promotes flowering. In fact, the VRN1 gene from cereals plays a crucial and dual role in flowering, first by inducing the expression of the cereal FT homologue, through the vernalization pathway, and secondly, acting as a floral meristem identity gene (Li and Dubcovsky, 2008; Yan et al., 2006). 4 Page 4 of 34
Several homologues to vernalization and flowering-related genes, such VRN1, have been detected in EST libraries from cold-exposed axillary buds of the orchid species Dendrobium nobile (Liang et al., 2012). However, homologues of the floral repressors FLC and VRN2 were not detected in this study – either due to limitations of the
ip t
technique or to the absence of these genes from the orchid genome, hinting that a different mechanism of flowering repression would operate in this species.
cr
Previous studies performed on diverse plant species have therefore demonstrated that, although the general mechanism of vernalization is conserved among distant species,
us
the sequence of the main regulating genes, the “repressors”, is not. Different genes, regulating vernalization, are therefore expected to be isolated from geophytes, as many
an
of them have strong vernalization requirements and lily in particular (Kamenetsky et al., 2012). L. longiflorum was chosen as a model bulb plant to study the molecular events
M
regulating vernalization for the following reasons: (1) the availability of extensive physiological characterization; (2) the obligatory vernalization requirement and the
d
quantitative response to the vernalization period, which indicates that flowering time may be manipulated; (3) the similarities of the Arabidopsis and lily flowering processes;
te
(3) the relative rapidity of lily flowering compared to other important flowering bulbs
Ac ce p
(such as tulip); (4) the possibility of genetically transforming lily plants; (5) the major importance of lily cut flowers and potted plant production worldwide. Significant progress in the understanding of lily vernalization is expected from the molecular studies planned in this project. Because exposing the bulbs to low temperatures dramatically accelerates flowering, our hypothesis was that the cold induces the differential expression of genes involved in the vernalization pathway, which can be isolated by a system revealing differential gene expression.. To this end, we constructed subtraction libraries using cDNAs from the meristems of bulbs either exposed or not exposed to cold. In this study, we first investigated the physiological response of L. longiflorum cv. White Heaven to vernalization and demonstrated the quantitative effect of cold exposure on bolting and flowering. We then produced and sequenced subtraction libraries of 5 Page 5 of 34
meristems cDNA from bulbs exposed to 25oC or 4oC for 9 weeks. These libraries revealed a series of differentially expressed genes, including a group of TEs, only expressed in bulbs without cold exposure.
cr
ip t
MATERIALS AND METHODS
Plant material, meristem characterization and growth conditions
us
L. longiflorum bulbs (cultivar White Heaven) were purchased from a nursery in August. Bulbs were sanitized and stored in moist medium mixture of peat and vermiculite (1:1, v/v) at 250C or 40C for 9 weeks. Every week, shoot apical meristems were excised from
an
the bulbs, immediately frozen in liquid nitrogen and stored at -80oC until RNA extraction. Stem elongation within the bulb during cold treatment was measured every
M
week in 15 bulbs (replicates). After planting, meristems were isolated from the plants, their developmental stage was characterized under a stereo microscope (Stemi 2000C,
te
extraction.
d
Zeiss, Germany) and they were immediately stored in liquid nitrogen for further RNA
For the flowering experiment, lily bulbs were stored for 0, 1, 2, 3, 4, 5, 6, 7, 8 or 9 weeks
Ac ce p
, at 4oC and otherwise were kept at 25oC. All bulbs were planted on 26.10.10 in a greenhouse, under natural day length and monthly average temperatures fluctuating between 19.1oC (January) and 32.1oC (May). During growth, plants were sampled at intervals for meristem observation under a Stemi microscope. The floral transition stage was assessed when first flower primordia were formed in the meristem. Flowering was determined when the first flower of the inflorescence in each plant reached anthesis. For each cold treatment, mean values of the time from planting to flower transition and time from planting to flowering were based on 20 plants (replicates).
Subtraction libraries Total RNA was isolated from 27 meristems from bulbs kept at 52oC (non vernalized, NV) and 13 meristems from bulbs kept at 4oC (vernalized, V) for 9 weeks , using Tri reagent 6 Page 6 of 34
(Sigma-Aldrich), following the manufacturers protocol. Any contaminating DNA was removed by DNase digestion (DNA-free kit, Ambion). The RNA concentration was estimated spectrally (Nano Drop ND-1000; Nano Drop Technologies). mRNA was
Madison, WI) according to the manufacturer's instructions.
ip t
purified from total RNA using the PolyATtract mRNA isolation system (Promega,
The PCR-Select cDNA Subtraction kit (Clontech) was used to isolate genes of
cr
differentially expressed genes during cold exposure, following manufacturer's protocol. Basically, 5 g mRNA from meristems of NV and V bulbs was first converted into cDNA.
us
These two cDNA populations were used both as "tester" (population containing specific transcripts) and "driver" (reference cDNA) for the production of different libraries,
an
namely "NV-V" and "V-NV". This method has been successfully used in lily to isolate
M
differentially expressed genes in pollen (Wang et al., 2004).
Sequences analyses and functional annotation
d
Gene fragments generated from the libraries were cloned into the pGEM-T vector (Promega) and several hundreds of clones from each library were sequenced and built
Ac ce p
(outsourcing).
te
into contigs at the Genome Center at Washington University St. Louis, Missouri, U.S.A
Functional annotation of the clones was performed using weighted BLAST, HMMER and ARGOT2, based on their p-values (no higher than 10-10) and semantic relationship. The complexity of the resulting gene ontologies (GOs) was reduced using GOslims (http://www.geneontology.org/). Venn plots were generated using Microsoft EXCEL.
Expression analysis of selected genes Based on homology analysis to genes from other plant species involved in vernalization or flowering mechanisms or in methylation activity, four genes were selected for further expression analysis by qPCR in the meristem during bulbs cold exposure and subsequent development above the bulb. The experiment was performed in five biological 7 Page 7 of 34
replicates, which consisted of five meristems, 0.2g in total, isolated from five different plants between 1:00 pm and 03:00 pm on each harvest day. A total of 25 meristems were collected from 30 different plants on each harvest day for qPCR analyses. Meristems from non-vernalized bulbs and bulbs vernalized for 2, 5, 7 or 9 weeks were
ip t
harvested at planting. Vegetative and reproductive meristems from above-ground parts were harvested during plant growth according to the relevant developmental stage.
cr
Total RNA was isolated with the Aurum Total RNA Mini kit (Bio-Rad Laboratories). A Nano Drop ND-1000 (Nano Drop Technologies) was used to determine RNA
us
concentration. cDNA was obtained using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). A quantity of 1000 ng total RNA was used for each reaction
an
mix. The relative level of transcripts was assessed by qPCR (7300 real-time PCR system, Applied Biosystems), with primer sequences designed by Primer-Express (Version 2.0,
M
Applied Biosystems). Expression patterns of the tested genes from lily were normalized to the expression of the lily housekeeping gene polyubiquitin (UBQ from L. longiflorum,
d
Accession #:AAF21992). All amplicon length ranges were between 80 and 85 bp. Each reaction contained 100 ng cDNA, 10 ml Power SYBR Green PCR MasterMix (Applied
te
Biosystems), and 500 nM of each of the forward and reverse primers for the tested
Ac ce p
genes and 700nM for the endogenous control (UBQ). The program used was as follows: 50oC for 2 min, 95oC for 10 min, followed by 40 cycles of 95oC for 15 s and 60oC for 1min each, and a dissociation stage of 95oC for 15 s, 60oC for 1min, and 95oC for 15 s. The 7300 System SDS software (Applied Biosystems) was used to analyze RNA relative quantification. Each value represents the mean (± SE) of 5 independent samples (replicates), each performed in three technical replicates.
Primers Primers used for qPCR analyses were as follows: Llhxa102
(Histone
JZ476869.1):
acetyltransferase
complex
F-TGGCCGAAGCAAAGTTGTTT
component102,
(Forward);
GenBank
Acc:
CCCACTTTCCCTGGCTTTCT
(Reverse), with an amplicon length of 80 bp. 8 Page 8 of 34
LlRBP1 (RNA binding protein, GenBank Acc: 516677337): GGCCAAGCACCTCCTGCTA (Forward); CCAGGCCTCATTCCAGGAA (Reverse), with an amplicon length of 80 bp. LlSOC1
(GenBank
Acc:
JZ476871):
TGTGAATCTGCGGATCTCATG
(Forward);
CAGATTTTCACACAACCGTATCCT (Reverse), with an amplicon length of 80 bp.
ip t
LlAt4g26220-like (Genebank Acc: JZ476870): CCTTACAACGGCTCTTGCATT (Forward); (Reverse), with an amplicon length of 85 bp.
cr
UBQ: GGGAGCATTTGCCTTGACAT (Forward); AGTCAGGAGCGAGCAGATTGA (Reverse),
us
with an amplicon length of 85 bp.
Phylogenetic analysis
an
For each of the selected genes, the deduced amino acid sequence was aligned to the sequence of homologous genes from other plant species using the CLUSTALW program.
M
A phylogenetic tree was constructed for each gene using the neighbor-joining method
d
(MEGA) (Tamura et al., 2011).
te
RESULTS
Ac ce p
Effect of vernalization on stem elongation and flowering Stem elongation within the bulb during cold treatment Stem elongation within the bulb (Fig. 1A) was measured at intervals during cold exposure (4°C). Bulbs stored for 8 weeks at 4oC developed significantly longer stems (about 40% increase) than bulbs kept at 25oC for the same period (Fig.1B). In average, stem length within the bulb after 9 weeks vernalization was about 5mm and stem elongation occurred during cold treatment. The effect of cold exposure on stem elongation within the bulb showed a quantitative pattern, with increasing period of cold resulting in a decrease in the time until stem reached 5 mm (Fig. 1C). Two weeks cold exposure induced a significant decrease of about 12%, while additional two weeks reduced the time by an impressive 62%. Floral transition and flowering 9 Page 9 of 34
Bulb vernalization markedly decreased the time from planting to floral transition and to flowering (Fig. 2). Similarly to stem elongation within the bulb, the quantitative character of the effect of vernalization was noticeable. The effect of the first week of vernalization led to a decrease of about 20% in the time to floral transition and to
ip t
flowering. This was the highest effect of a single week for flowering (meaning – the effect of additional single week of cold led to lower decrease). However, for flower
cr
transition the highest effect of a single week of cold exposure was recorded between week 8 and week 9 (33%). Overall, cold exposure of the bulbs for 9 weeks at 4oC induced
us
a reduction of ca. 80% and 55% in the time to floral transition and flowering,
Subtracted libraries
M
Functional annotation of sequenced genes
an
respectively, compared to bulbs which were not exposed to cold before planting (Fig. 2).
cDNA libraries were constructed from meristematic tissues (Fig. 3A) isolated from bulbs
d
after 9 weeks at 25oC (NV) or 4oC (V). A period of 9 weeks exposure to cold was selected on the basis of physiological data demonstrating that, after 9 weeks saturation or near-
te
saturation of vernalization has been reached and a significant decrease in the time to
Ac ce p
the transition to flowering and flowering itself is observed. We therefore assumed that at this time, potential flowering inhibitors are not expressed anymore in the bulb. Subtraction libraries were made in both directions to detect differentially expressed genes in V and NV bulbs. We The overall transcription level (amount of mRNA from total RNA), was three times higher in V than in NV meristems. A total of 671 and 479 clones were sequenced from the NV-V and the V-NV libraries, respectively. From these clones, 72 and 82 proteins were inferred from the NV-V and the V-NV libraries, respectively. Functional annotation revealed definite differences between both libraries. First, the lower transcription level of the NV-V libraries was reflected by a much lower amount of putative functions, at the biological, cellular and molecular levels compared to genes the V-NV libraries (Fig. 3B, C and D). Similarly, only few functions were specific to the NV-V, while most function were also present in the V-NV libraries. 10 Page 10 of 34
Specific functional annotation of the proteins at the biological level is presented in Fig. 4. In the NV-V libraries, only a few biological functions were inferred and most of them belonged to DNA integration (Fig. 4A). On the other hand, a large number of diverse functions were assigned to the ESTs from the V-VN library (Fig. 4B), including
ip t
transcription and translation, protein folding, response to stress and auxin signalling.
vernalization, i.e., from resting to actively growing tissues.
cr
These results are totally in line with the bulb developmental state before and after
us
Putative vernalization, flowering, dormancy and cold response functions of ESTs Our primary goal was to find genes related to the control of the vernalization pathway
an
and to the flowering mechanism in lily. A gene showing homology with SUPPRESSOR OF OVER-EXPRESSION OF CO 1 (SOC1), a MADS-box transcription factor playing a major role
M
in the flowering pathway in Arabidopsis was found in the V-NV libraries (#1, Table 1). This gene was particularly interesting, since in Arabidopsis, its expression is induced by
d
vernalization in a quantitative manner, inversely correlated to the expression of the flowering inhibitor FLC, but is also strongly directly induced by cold exposure (Sheldon et
te
al., 2006). LlSOC1 was further characterized and its expression during cold exposure and
Ac ce p
plant development was analyzed (see below). Gene #2 (Table 1) was also included in the group of genes with a putative function in the vernalization pathway, since it comprises a SWIRM domain, found in several proteins involved in chromatin remodeling and chromatin modification complexes (Da et al. , 2006). This gene was isolated from the V-NV library. Specifically, the SWIRM domain found in the histone demethylase (FLD) enables interactions with proteins in other complexes involved in the silencing process of FLC (Yu et al., 2011). Like LlSOC1, Llhxa102 was further analyzed (see below). A homolog of a DNAj protein-like gene was also detected in the V-NV library (# 3, Table 1). DNAj proteins play important roles in major post-translational process, through interaction with the chaperone heat shock protein 70 (Hsp70). In Arabidopsis, DNAj, type I was found to play a role in the integration of the flowering signals, specifically by 11 Page 11 of 34
its interaction with the flowering repressor SHORT VEGETATIVE PHASE (SVP), which inhibits its binding to the FT promoter (Shen et al., 2011). Therefore this protein has an enhancing effect on flowering time and it was detected in the V-NV library. Similarly, a soybean DNAj protein was found to be upregulated by a series of stresses, including cold
ip t
(So et al., 2013).
Another gene which might be related to flowering was detected from the NV-V library
cr
(#4, Table 1) and showed homology to a ripening regulated protein in tomato (Giovannoni et al. , 1999), which contains an AP2/EREB domain , found in transcription
us
factors involved in the regulation of developmental mechanisms like flower development, stress and cold response and freezing tolerance in plants only (Gilmour et
an
al., 1998; Lin et al., 2007; Ouyang et al., 2007; Riechmann and Meyerowitz, 1998). This domain is also found in sevral Arabidopsis flowering repressors (Immink et al., 2012;
M
Schmid et al., 2003).
Vacuolar-processing enzymes (VPE) (#5, Table 1) are involved in proteolytic
d
mechanisms, for example recycling of amino acids from degraded proteins in the cell. VPEs are also involved in programmed cell death
(PCD) in the context of plant
te
developmental mechanisms and response to pathogens (Muntz, 2007).VPE is involved
Ac ce p
in the early stages of seed germination by causing CPD of the outer layers of the embryo sac, thereby enabling seed coat production (Nakaune et al., 2005). We found a VPE homologue in the NV-V library.
Gene #6, detected in the V-NV libraries, encodes for Glutathione – S transferase (GST), which is overexpressed during endo-dormancy in oak buds (Ueno et al. , 2013) and upregulated during dormancy release in raspberry, probably in the context of response to oxidative stress (Mazzitelli et al., 2007). In addition, gluthatione increased biosynthesis can partially replace the vernalization requirements of Arabidopsis seeds and enhance faster flowering (Hatano-Iwasaki and Ogawa, 2012). Gene #7 (Table 1) showing homology to GTP-binding proteins from glycine, was detected from the NV-V library. Among other tasks, these genes are involved in abscisic acid (ABA) signalling and in the regulation of seed germination and dormancy in 12 Page 12 of 34
Arabidopsis and in Fagus sylvatica (Nicolas et al., 1998; Pandey et al., 2006). These proteins have been suggested to be involved in major developmental processes, as well as in response to stress (Shan et al., 2005). Plant ABC transporters (#8, Table 1) belong to a large family of genes involved in many
ip t
functions including growth, development and response to stress. Interestingly, ABC transporters were fund to be related to the transport of ABA (Kang et al., 2011), which is
cr
more abundant in dormant and resting bulbs than in more metabolically active bulbs (Djilianov et al., 1994).
us
Both #7 and #8 genes, with putative functions related to ABA signalling and transport were isolated from the NV-V libraries.
an
Finally, we examined genes which may be involved in the plant’s response to cold. Expectedly, such genes were detected in the V-NV libraries and may be involved in the
M
long-term, rather than the short-term response of the plant to cold, since they were expressed after 9 weeks at 4oC.
d
It was reported that sucrose synthase (#9, Table 1) was up-regulated by cold, both in lily bulblets (Shin et al., 2002) and in barley grains (Barrero-Sicilia et al., 2011). Sucrose
te
synthase activity is considered a major component of sink strength in potatoes (Zrenner
Ac ce p
et al., 1995). Lily bulb exposure to low temperatures also induces a reduction in the amount of starch, the main storage substance in scales, into soluble carbohydrates (Miller and Langhans, 1990).
A component of the 19S lid of the 26S proteasome was expressed at the 9 th week of vernalization (#10, Table 1). Ubiquitination is known to play a major role in plant adaptation to abiotic stress, including cold stress and is also related to ABA signaling (Lyzenga and Stone, 2012).
Gene # 11 (Table 1) showed homology to a helicase, belonging to the DEAD-box protein superfamily, involved in essential processes in the cell (such as DNA replication and RNA transcription), but also in the regulation of plant development during stress exposure, including cold (Ambrosone et al., 2012; Vashisht and Tuteja, 2006).
13 Page 13 of 34
Similarly, gene #12 (Table 1) shared homology to methyltransferases, whose activity is highly implicated in the vernalization process of several plant species (Woods et al., 2014), as well as in other important developmental processes, including germination and in gene expression in general (Meng et al., 2012; Paszkowski and Whitham, 2001).
ip t
The RNA binding proteins (# 13, Table 1) function to perform post-transcriptional modifications including changes caused by the plant’s response to external conditions
cr
(Ambrosone et al., 2012). In Arabidopsis, several RNA-binding proteins have been linked to the regulation of FLC, thereby affecting flowering regulation (Rataj and Simpson,
us
2014). Therefore, the lily homologues of both methyltransferase and RNA binding proteins (# 12 and 13, respectively, Table 1) were further analyzed (see below).
an
Proton pumps (#14, Table 1) play crucial roles in many physiological processes in plants (Serrano, 1989). In grape, activity of the proton pump H+-ATPase has clearly been
M
associated with chilling resistance as a result of chilling pre-treatments, in the process of acclimation (Zhang et al., 2006).
d
Gene #15 encodes a putative translation elongation factor (Table 1), which may be related to cold-induced expression of several genes and to freezing tolerance. This gene
te
may be involved in the response of the plant to the cold rather than in vernalization
Ac ce p
itself, as shown by one of the studied mutations, which wasn’t impaired in vernalization (Guo et al., 2002).
TEs
In addition to the selected sequences mentioned in Table 1, we observed that a large number of genes were annotated to TEs. These sequences amounted to more than 20% of the total cDNA sequenced in the NV-V libraries, as opposed to less than 2% in the VNV libraries (Table 2), clearly demonstrating differential expression of this group of genes. Most TEs belonged to the class 1 LTR retrotransposons (Feschotte et al., 2002), with the vast majority of the Gypsy type, which has been previously isolated from L. henryi (Smyth et al., 1989). This was also the only type of retrotransposons found in the V-NV cDNA. Another LTR element, Ty1/Copia, accounted from 3.65% of the NV-V 14 Page 14 of 34
sequenced cDNA (Table 2). This type of retrotransposons constitute more than 5% of the genomes of Frittillaria species, including the Liliaceae family (Ambrozova et al., 2011), and was recently isolated from L. longiflorum (Lee et al., 2013). Other TE types
ip t
accounted for a small portion of the sequenced ESTs.
Expression pattern of selected genes potentially related to the vernalization process in
cr
lily during bulb cold exposure and plant development
According to their putative involvement in vernalization/flowering or cold response in
upregulation
by
cold:
we
selected
two
us
other organisms, several genes were selected for further verification of their genes
from
the
first
category
an
(vernalization/flowering), LlSOC1 (#1, Table 1), and histone acetyltransferase complex component containing a SWIRM motif (#2, Table 1), and two genes from the last
M
category (cold response), namely a methyltransferase (#12, Table 1) and an RNA binding protein (#13, Table 1), hereby, LlSOC1, Llhxa102, LlAt4g26220-like and LlRBP1,
d
respectively, where Ll stands for Lilium longiflorum. The expression of these genes was assessed in lily bulb meristems during cold exposure
te
as well as in the apical meristem at later stages of above-ground plant development. All
Ac ce p
the selected genes were found to be up-regulated during bulb exposure to cold to various extends, compared to the control (0 weeks vernalization) (Fig. 5). The highest level of up-regulation was observed either after 9 weeks (Fig. 5A, B) or after 5 weeks of cold exposure (Fig. 5C, D), with utmost values (more than 20 fold) recorded for LlSOC1 (Fig. 5C). Expression of all four genes was lower in the meristem during development of the above-ground parts of the plant. Phylogenic analyses showed that the four validated genes from L. longiflorum were closer to other monocotyledons to than dicotyledonous species (Fig. 6).
DISCUSSION Response of L. longiflorum to vernalization
15 Page 15 of 34
Results of our experiments on the response of L. longiflorum, cv. White Heaven to vernalization were in agreement with previously published results from other L. longiflorum cultivars (Ishimori and Niimi, 2005; Ishimori et al., 2007; Miller, 1993; Roh and Willkins, 1977a). Cold exposure induced stem elongation within the bulb (Fig. 1) and
ip t
reduced the time from planting to floral transition and to flowering in an inverse relationship and in a quantitative manner (Fig. 2). To our knowledge, this is the first
cr
report on the detailed analysis of the effect bulb cold exposure on floral transition, assessed by microscopic observation. The effect of cold exposure was more pronounced
us
on the time from planting to floral transition, reflecting the actual vernalization pathway, than on the time from planting to flowering itself, which was also affected by
an
the duration of flower development, from meristematic stage to fully open flowers. From our experiments, it could not be undoubtedly inferred that the plant’s response to
M
vernalization had indeed reached its saturation point after 9 weeks, as reported for other lily cultivars after 6 weeks of exposure of the bulbs to cold (Miller, 1993).
d
Nevertheless, the response of lily plants to bulb cold exposure was strong, quantitative and expected. Therefore, it provided the physiological base to the performance of
Ac ce p
te
subtraction libraries from non-vernalized and vernalized bulbs.
Analysis of subtraction libraries and validation of gene expression The amount of mRNA isolated from total RNA was strikingly higher in the V-NV than in the counterpart NV-V libraries. This feature is most probably due to the higher metabolic activity of bulb meristems after cold exposure, as compared to meristems from non-vernalized bulbs. From experiments performed in the past, we reached the conclusion that lily bulbs never actually undergo dormancy during the summer, since, when grown under suitable conditions of irrigation, they were still producing leaves (A. Ram and M. Zaccai, in preparation). Although non-vernalized bulbs are not dormant, they are at a resting state, during which the meristem is almost not active. On the opposite, meristems of bulbs exposed to cold are actively growing (Fig. 1 B, C) and
16 Page 16 of 34
undergo metabolic activity, such as carbohydrates degradation for sugar production (Shin et al., 2002; Xu et al., 2006). Analysis of subtraction libraries from vernalized and non-vernalized lily meristems enabled the detection of several groups of genes potentially involved in lily response to
ip t
cold, in the regulation of flowering and in the vernalization pathway. Such genes include for example an AP2-gene, from the non-vernalized library, as a potential repressor of
cr
flowering and LlSOC1, from the vernalized-meristems library, which was greatly upregulated during lily bulb vernalization (Fig. 5C). In other species, SOC1 is the target of
us
AP2-genes (Immink et al., 2012; Papaefthimiou et al., 2012) and the present results hint that this could be the case also in lily.
an
The massive expression of TEs found in the NV-V library, i.e., expressed when the bulbs are at a resting period, as opposed to being more metabolically active during and after
M
vernalization (V-NV) was quite surprising. Indeed, general acknowledged models and data imply that transposon activity is linked to gene regulation and specifically to the
d
response to cold stress (Naito et al., 2009) and references therein) and to genotypic vernalization response (Laudencia-Chingcuanco and Fowler, 2012). Transposon
te
expression during lily bulbs rest period could have a specific task in the maintenance of
Ac ce p
this state. Additional analyses are currently being performed to further explore the regulation of TEs expression during cold exposure of lily bulbs. Genes whose expression was validated by qPCR were selected from the V-NV library and indeed showed up-regulation during cold exposure, showing that the libraries were basically a useful tool for the detection of differentially expressed gene in lily meristems.
CONCLUSION
The subtraction libraries led to the isolation of a substantial amount of genes differentially expressed in V and NV lily bulb meristems. Based on sequence homology with other plant species, we were able to identify several candidate genes, potentially involved in the regulation of the lily flowering mechanism in general and the vernalization pathway in particular. This study provides the basis for further functional 17 Page 17 of 34
analyses of selected genes, which would ultimately lead to the elucidation and possible manipulation of lily flowering.
ACKNOWLEDGEMENTS
ip t
The authors thank Assael Ram for advice and help with the experiments, Shlomit Hellman for her help in measurements and Prof. Ofer Ovadia for valuable help with the
cr
MEGA program. This study was funded by a grant from the Chief Scientist of the Israeli
Ac ce p
te
d
M
an
us
Ministry of Agriculture (#857-0535-07).
18 Page 18 of 34
REFERENCES
Ac ce p
te
d
M
an
us
cr
ip t
Amasino R. Seasonal and developmental timing of flowering. Plant J 2010;61:1001-13. Ambrosone A, Costa A, Leone A, Grillo S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Sci 2012;182:12-8. Ambrozova K, Mandakova T, Bures P, Neumann P, Leitch IJ, Koblizkova A, et al. Diverse retrotransposon families and an AT-rich satellite DNA revealed in giant genomes of Fritillaria lilies. Ann Bot 2011;107:255-68. Barrero-Sicilia C, Hernando-Amado S, Gonzalez-Melendi P, Carbonero P. Structure, expression profile and subcellular localisation of four different sucrose synthase genes from barley. Planta 2011;234:391-403. Da GP, Lenkart J, Zhao KH, Shiekhattar R, Cairns BR, Marmorstein R. Structure and function of the SWIRM domain, a conserved protein module found in chromatin regulatory complexes. Proc Natl Acad Sci USA 2006;103:2057-62. Distelfeld A, Li C, Dubcovsky J. Regulation of flowering in temperate cereals. Curr Opin Plant Biol 2009;12:178-84. Djilianov D, Gerrits MM, Ivanova A, Vanonckelen HA, Deklerk GJM. ABA content and sensitivity during the development of dormancy in lily bulblets regenerated in-vitro. Physiol Plant 1994;91:639-44. Dole JM. Research approaches for determining cold requirements for forcing and flowering of geophytes. HortScience 2003;38:341-46. Dole JM, Wilkins HF. Interaction of bulb vernalilzation and shoot photoperiod on "Nellie White" Esater lilly. HortScience 1994;29:143-45. Dole JM, Wilkins HF. Lilium, Easter, in Floriculture. Principles and Species. 1999. Feschotte C, Jiang N, Wessler SR. Plant transposable elements: Where genetics meets genomics. Nat Rev Gen 2002;3:329-41. Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF. Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 1998;16:433-42. Giovannoni J, Yen H, Shelton B, Miller S, Vrebalov J, Kannan P, et al. Genetic mapping of ripening and ethylene-related loci in tomato. Theor Appl Genet 1999;98:1005-13. Grassotti A, Gimelli F. Bulb and Cut Flower Production in the Genus Lilium: Current Status and the Future. In: Grassotti A, Burchi G, editors. II International Symposium on the Genus Lilium 2011. p. 21-35. Guo Y, Xiong L, Ishitani M, Zhu J-K. An Arabidopsis mutation in translation elongation factor 2 causes superinduction of CBF/DREB1 transcription factor genes but blocks the induction of their downstream targets under low temperatures. P Natl Acad Sci USA 2002;99:7786-91. Hatano-Iwasaki A, Ogawa K. Overexpression of GSH1 gene mimics transcriptional response to low temperature during seed vernalization treatment of Arabidopsis. Plant Cell Physiol 2012;53:1195-203. 19 Page 19 of 34
Ac ce p
te
d
M
an
us
cr
ip t
Holcomb EJ, Berghage R. Photoperiod, chilling, and light quality during daylight extension affect growth and flowering of tissue-cultured easter lily plants. Hortscience 2001;36:53-55. Immink R, Pose D, Ferrario S, Ott F, Kaufmann K, Leal Valentim F, et al. Characterisation of SOC1’s central role in flowering by the identification of its up- and downstream regulators. Plant Physiol 2012;160: 433-49. Ishimori T, Niimi Y. Similar effects of colchicine and low temperature on initiation and elongation of stems in bulblets developed on scales of ‘White Aga’ (Lilium x formolongi) cultured in vitro. Acta Hort (ISHS). 2005;673:395-400. Ishimori T, Niimi Y, Han DS. Benzyladenine and low temperature promote phase transition from juvenile to vegetative adult in bulblets of Lilium x formolongi 'White Aga' cultured in vitro. Plant Cell Tiss Org 2007;88:313-18. Kamenetsky R, Zaccai M, Flaishman M. Florogenesis. In: Kamenetsky RaO, Hiroshi, editor. Ornamental Geophytes: From Basic Science to Sustainable Production. Boca Raton, FL: CRC Press Taylor and Francis Group; 2012. p. 197-232. Kang J, Park J, Choi H, Burla B, Kretzschmar T, Lee Y, et al. Plant ABC Transporters. The Arabidopsis book / American Society of Plant Biologists. 2011;9:e0153. Kim DH, Doyle MR, Sung S, Amasino RM. Vernalization: Winter and the Timing of Flowering in Plants. Annu Rev Cell Dev Biol 2009. p. 277-99. Laudencia-Chingcuanco D, Fowler DB. Genotype-dependent Burst of Transposable Element Expression in Crowns of Hexaploid Wheat (Triticum aestivum L.) during Cold Acclimation. Compar Funct Genom 2012, http://www.hindawi.com/journals/ijg/2012/232530/, DOI 10.1155/2012/232530. Lee SI, Park KC, Son JH, Hwang YJ, Lim KB, Song YS, et al. Isolation and characterization of novel Ty1-copia-like retrotransposons from lily. Genome 2013;56:495-503. Li C, Dubcovsky J. Wheat FT protein regulates VRN1 transcription through interactions with FDL2. Plant J 2008;55:543-54. Liang S, Ye Q-S, Li R-H, Leng J-Y, Li M-R, Wang X-J, et al. Transcriptional regulations on the low-temperature-induced floral transition in an Orchidaceae Species, Dendrobium nobile: an Expressed Sequence Tags analysis. Compar Funct Genom 2012;2012:757801. Lin R, Zhao W, Meng X, Peng Y-L. Molecular cloning and characterization of a rice gene encoding AP2/EREBP-type transcription factor and its expression in response to infection with blast fungus and abiotic stresses. Physiol Mol Plant P 2007;70:60-68. Lyzenga WJ, Stone SL. Abiotic stress tolerance mediated by protein ubiquitination. J Exp Bot 2012;63:599-616. Mazzitelli L, Hancock RD, Haupt S, Walker PG, Pont SDA, McNicol J, et al. Co-ordinated gene expression during phases of dormancy release in raspberry (Rubus idaeus L.) buds. J Exp Bot 2007;58:1035-45. Meng FR, Li YC, Yin J, Liu H, Chen XJ, Ni ZF, et al. Analysis of DNA methylation during the germination of wheat seeds. Biolog Plant 2012;56:269-75. Miller WB. Lilium longiflorum. In: Nard DHaL, editor. The Physiology of Flower Bulbs. Amsterdam, London, New York, Tokyo: Elsevier; 1993. p. 391-422. Miller WB, Langhans RW. Low Temperature Alters Carbohydrate Metabolism in Easter Lily Bulbs. HortScience 1990;25:463-65. 20 Page 20 of 34
Ac ce p
te
d
M
an
us
cr
ip t
Muntz K. Protein dynamics and proteolysis in plant vacuoles. J Exp Bot. 2007;58:2391407. Naito K, Zhang F, Tsukiyama T, Saito H, Hancock CN, Richardson AO, et al. Unexpected consequences of a sudden and massive transposon amplification on rice gene expression. Nature 2009;461:1130-U232. Nakaune S, Yamada K, Kondo M, Tomohiko K, Tabata S, Nishimura M, et al. A vacuolar processing enzyme, δvpe, is involved in seed coat formation at the early stage of seed development. Plant Cell 2005;17:876-87. Nicolas C, Nicolas G, Rodriguez D. Transcripts of a gene, encoding a small GTP-binding protein from Fagus sylvatica, are induced by ABA and accumulated in the embryonic axis of dormant seeds. Plant Mol Biol 1998;36:487-91. Ouyang B, Yang T, Li H, Zhang L, Zhang Y, Zhang J, et al. Identification of early salt stress response genes in tomato root by suppression subtractive hybridization and microarray analysis. J Exp Bot 2007;58:507-20. Pandey S, Chen JG, Jones AM, Assmann SM. G-protein complex mutants are hypersensitive to abscisic acid regulation of germination and postgermination development. Plant Physiol 2006;141:243-56. Papaefthimiou D, Kapazoglou A, Tsaftaris AS. Cloning and characterization of SOC1 homologs in barley (Hordeum vulgare) and their expression during seed development and in response to vernalization. Physiol Plant 2012;146:71-85. Paszkowski J, Whitham SA. Gene silencing and DNA methylation processes. Curr Opin Plant Biol 2001;4:123-29. Rataj K, Simpson GG. Message ends: RNA 3′ processing and flowering time control. J Exp Bot 2014;65:353-63. Renaut J, Hausman J-F, Bassett C, Artlip T, Cauchie H-M, Witters E, et al. Quantitative proteomic analysis of short photoperiod and low-temperature responses in bark tissues of peach (Prunus persica L. Batsch). Tree Genet Genomes 2008;4:589-600. Riechmann JL, Meyerowitz E. The AP2/EREBP family of plant transcription factors. Biol Chem 1998;379:633-46. Roh SM, Willkins HF. The effects of bulb vernalization and shoot photoperiod treatments on growth and flowering in Lilium longiflorum Thunb. cv. Nellie White. J Amer Soc Hort Sci 1977a;102:229-35. Roh SM, Willkins HF. Temperature and photoperiod effect on flower numbers in Lilium longiflorum Thunb. J Amer Soc Hort Sci 1977b;102:235-42. Roh SM, Willkins HF. Comparison of continuous and alternating bulb temperature treatments on growth and flowering in Lilium longiflorum Thunb. J Amer Soc Hort Sci 1977c;102:242-47. Schmid M, Uhlenhaut NH, Godard F, Demar M, Bressan R, Weigel D, et al. Dissection of floral induction pathways using global expression analysis. Development 2003;130:6001-12. Serrano R. Structure and Function of Plasma Membrane ATPase. Annu Rev Plant Phys 1989;40:61-94. Shan L, Zhao SY, Xia GM. Cloning of the full-length cDNA of the wheat involved in salt stress: Root hair defective 3 gene (RHD3). J Integrat Plant Biol 2005;47:881-91. 21 Page 21 of 34
Ac ce p
te
d
M
an
us
cr
ip t
Sheldon CC, Finnegan EJ, Dennis ES, Peacock WJ. Quantitative effects of vernalization on FLC and SOC1 expression. Plant J 2006;45:871-83. Shen LS, Kang YGG, Liu L, Yu H. The J-Domain Protein J3 Mediates the Integration of Flowering Signals in Arabidopsis. Plant Cell 2011;23:499-514. Shin KS, Chakrabarty D, Paek KY. Sprouting rate, change of carbohydrate contents and related enzymes during cold treatment of lily bulblets regenerated in vitro. Sci HorticAmsterdam 2002;96:195-204. Smyth DR, Kalitsis P, Joseph JL, Sentry JW. Plant retrotransposon from Lilium henryi is related to Ty3 of yeast and gypsy group of Drosophila. Proc Natl Acad Sci U S A. 1989;86:5015-19. So H-A, Chung E, Lee J-H. Molecular characterization of soybean GmDjp1 encoding a type III J-protein induced by abiotic stress. Genes & Genomics 2013;35:247-56. Tammen JF. Quantifying the cooling period for flowering of "Nellie White" Easter lily. HortScience 2003;38:21-25. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731-39. Ueno S, Klopp C, Leple JC, Derory J, Noirot C, Leger V, et al. Transcriptional profiling of bud dormancy induction and release in oak by next-generation sequencing. BMC Genomics 2013;14. Vashisht AA, Tuteja N. Stress responsive DEAD - box helicases : A new pathway to engineer plant stress tolerance. J Photoch Photobio B 2006;84:150. Wang LL, Pang JL, Jiang HM, Zhu MY. Expression of CFL gene during differentiation of floral and vegetative buds in cucumber cotyledonary nodes cultured in vitro. Zhi Wu Sheng Li Yu Fen Zi Sheng Wu Xue Xue Bao J Plant Physiol Mol Biol 2004;30:644-50. Woods DP, Ream TS, Amasino RM. Memory of the vernalized state in plants including the model grass Brachypodium distachyon. Frontiers in Plant Science 2014;5, http://journal.frontiersin.org/Journal/10.3389/fpls.2014.00099/abstract, DOI 10.3389/fpls.2014.00099. Xu R-Y, Niimi Y, Han D-S. Changes in endogenous abscisic acid and soluble sugars levels during dormancy-release in bulbs of Lilium rubellum. Sci Hortic-Amsterdam 2006;111:68-72. Yan L, Fu D, Li C, Blechl A, Tranquilli G, Bonafede M, et al. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc Natl Acad Sci USA 2006;103:19581-86. Yu C-W, Liu X, Luo M, Chen C, Lin X, Tian G, et al. HISTONE DEACETYLASE6 Interacts with FLOWERING LOCUS D and Regulates Flowering in Arabidopsis. Plant Physiol 2011;156:173-84. Zhang JH, Liu YP, Pan QH, Zhan JC, Wang XQ, Huang WD. Changes in membraneassociated H+-ATPase activities and amounts in young grape plants during the cross adaptation to temperature stresses. Plant Sci 2006;170:768-77. Zrenner R, Salanoubat M, Willmitzer L, Sonnewald U. Evidence of the crucial role of sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum L). Plant J 1995;7:97-107. 22 Page 22 of 34
Figure captions Figure 1. Effect of cold exposure on stem elongation within the bulb. A. Stem within a
ip t
bulb following removal of external scales. Bracket indicates stem elongation: from the basis of the bulb up to the basis of the meristem. Bar= 5 mm. B. Stem length within the bulb after 9 weeks at 25oC or 4oC. C. Effect of the duration of cold exposure on stem
us
cr
elongation up to 5 mm. Values with different letters are significantly different (p
