Fish & Shellfish Immunology 45 (2015) 260e267

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short communication

Characterization of MMP-9 gene from a normalized cDNA library of kidney tissue of yellow catfish (Pelteobagrus fulvidraco) Fei Ke, Yun Wang*, Jun Hong, Chen Xu, Huan Chen, Shuai-Bang Zhou College of Life Sciences and Engineering, Henan University of Urban Construction, Pingdingshan 467036, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 October 2014 Received in revised form 11 April 2015 Accepted 14 April 2015 Available online 22 April 2015

Matrix metalloproteinase-9 (MMP-9), one of members of the MMP family, is important for the cleaving of structural extracellular matrix (ECM) molecules and involved in inflammatory processes. In this study, MMP-9 cDNA was isolated and characterized from a normalized cDNA library of kidney tissue of yellow catfish (designated as YcMMP-9). The complete sequence of YcMMP-9 cDNA consisted of 2561 nucleotides. The open reading frame potentially encoded a protein of 685 amino acids with a calculated molecular mass of approximately 77.182 kDa. Amino acid sequence of YcMMP-9 have typical characteristics of MMP-9 family and showed highest identity (85.3%) to channel catfish MMP-9. The YcMMP-9 genomic DNA contains 13 exons and 12 introns. Quantitative RT-PCR (qRT-PCR) analysis showed that YcMMP-9 mRNA was constitutively expressed in all examined tissues in normal fish with high expression in head kidney, trunk kidney, blood, and spleen. However, expression of YcMMP-9 mRNA was induced by Aeromonas hydrophila stimulation, especially in these four tissues mentioned above. It indicated that YcMMP-9 was involved in innate immune responses against bacterial infection. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Normalized cDNA library MMP-9 Yellow catfish Immune response

Matrix metalloproteinases (MMPs) constitute a family of over 25 Zn2þ-dependent enzymes that could cleave numerous structural components [1,2]. MMP substrates include not only extracellular matrix (ECM) proteins but also ligand and receptor substrates such as cytokines, chemokines, growth factors and adhesion molecules [3]. Because of the diversity of substrates, MMP has multiple functions. It has been presumed to be involved in the modulation and regulation of ECM and the liberation of biologically active proteins, so has important roles in embryogenesis and in innate immune defense and apoptosis [4e7]. In general, the multidomain structure of MMPs contains a prodomain, a catalytic domain, a hinge region, and a hemopexin domain [8]. Amino acids in the prodomain are responsible for maintaining the pro-MMP in a latent form. A Zn2þ-binding region is included in the catalytic domain, which is linked to the C-terminal hemopexin domain by the hinge region. Amino acids in the hemopexin domain determine the substrate specificity of MMPs and the interactions with endogenous inhibitors [9]. Based on substrate specificity, sequence characteristics, and domain organization, MMPs can be divided into six groups: collagenases,

* Corresponding author. Tel.: þ86 375 2089072. E-mail address: [email protected] (Y. Wang). http://dx.doi.org/10.1016/j.fsi.2015.04.012 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

gelatinases, stromelysines, matrilysins, membrane type-MMPs, and other MMPs [10]. MMP-2 and MMP-9 compose the group of gelatinases, which further contain a series of three fibronectin type II inserts in the catalytic domain [11]. MMP-2 cleaves type IV collagen, degraded collagen and some noncollagenous ECM glycoproteins [12]. It is synthesized by fibroblasts, keratinocytes, endothelial cells, chondrocytes, osteoblasts, and monocytes [6]. MMP-9 cleaves N-terminal telopeptide of type I collagen [6]. And it is produced mainly by inflammatory cells including macrophages, leukocytes, and monocytes [13]. To date, MMP-9 genes have been cloned from several fish species, such as medaka (Oryzias latipes) [14], carp (Cyprinus carpio) [15], rainbow trout (Oncorhynchus mykiss) [16], channel catfish (Ictalurus punctatus, Rafinesque 1818) [17], puffer fish (Takifugu rubripes) [18], Japanese flounder (Paralichthys olivaceus) [19,20], zebra fish (Danio rerio) [21,22], and grass carp (Ctenopharyngodon idella) [23]. It has been revealed that the expression of MMP-9 could be induced by fish bacteria pathogens, thus suggesting that MMP-9 is involved in fish immune responses [23e25]. Yellow catfish (Pelteobagrus fulvidraco Richardson) has become an important fish species farmed in China [26]. Researches on yellow catfish mainly focused on its breeding technique [27], lipid metabolism [28], toxicology [29], development [30], and so on. However, information about its immune response is rare, although

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267

outbreaks of diseases associated with bacteria have caused high mortality in farmed yellow catfish [31]. cDNA library construction has been one of important strategies for discovery of interested genes, especially in species for which genomic data are unavailable [32]. Several immune related genes have been successfully characterized in fish species with this technique [33e35]. In the present study, a normalized cDNA library of head kidney of yellow catfish was constructed. The full-length cDNA of MMP-9 was cloned from this cDNA library, and the tissue-specific expression patterns of this gene under normal or challenged conditions were analyzed by qRT-PCR. In all assays, yellow catfish with an average weight of 100 g were collected from Pingxi Lake in Pingdingshan city, Henan province, China. Animals were reared in an aerated 200-L circular tank at room temperature (25  C) for one week before use. Dechlorinated tap water was replenished 80% and commercial feed was provided once a day. For cDNA library construction, the head kidney from three individuals was collected to provide enough RNA. Total RNA was extracted with TransZol reagent (TransGen biotech, Beijing, China) following the manufacturer's protocol. And then, the total RNA was treated with DNase (TaKaRa, Japan) to eliminate the genome DNA contamination and was further purified using the chloroform/ phenol extraction method. Agarose gel and A260/A280 ratio were used to determine the quality of the total RNA. The absorbance ratios of the RNA at 260/280 and 260/230 nm were 1.86 and 1.87, respectively. Double stranded (ds)-cDNA was synthesized using SMART™ cDNA Library Construction Kit (Clontech, CA, USA) following manufacturer's protocol. Briefly, 1 mg of total RNA was mixed with SMART IV Oligonucleotide (50 -AAGCAGTGGTATCAACGCA0 GAGTGGCCATTACGGCCGGG- 3 ) and CDS III/30 PCR Primer (50 -A TTCTAGAGGCCGAGGCGGCCGACATG-d(T)30Ne1N-30 ) to synthesize first-strand cDNA by PowerScript Reverse Transcriptase, followed by 18 cycles of long-distance PCR with CDS III/30 PCR Primer and 50 PCR Primer (50 -AAGCAGT GGTATCAACGCAGAGT-30 ) for the ds-cDNA synthesis. Ds-cDNA product was purified by the chloroform/phenol extraction method and then mixed with 8 ml of hybridization buffer (2  ) and incubated at 98  C for 2 min. After incubate at 68  C for 5 h, the mixture was mixed with 1 ml of duplex-specific nuclease (DSN) solution and 5 ml of DSN master buffer (Evrogen, Moscow, Russia), and then incubated at 68  C for 25 min. Reaction was stopped by adding 10 ml of 2  DSN stop buffer. The products were subsequently amplified by two rounds of PCR with the primers M1 and M2. The first round of PCR used following conditions: 95  C for 1 min, followed by 11cycles of 95  C for 15 s, 66  C for 20s, and 72  C for 3 min. The second round of PCR used following conditions: 95  C for 1 min, followed by 12cycles of 95  C for 15 s, 66  C for 20s, and 72  C for 3 min, and 1 cycles of 64  C for 20s, 72  C for 3 min. The amplified products were purified by the chloroform/phenol extraction method and then digested with SfiI. The ds-cDNA was further purified with chloroform/phenol and ligated into a modified pUC19 vector (Sangon Biotech, China). 1 ml of the ligation product was transformed into Escherichia coli (DH5a) competent cells. The titer of the cDNA library yielded 6.48  105 by determining the number of colonies on the agar plate. The recombination rate of the cDNA library was 94.5% by counting the numbers of blue and white colony on the plate. 24 clones were picked randomly and was checked the insert size by PCR amplification, which showed that most of the insert cDNA size were larger than 1000 bp. The 24 clones were sequenced in forward and these nucleotide sequences were deposited into the GenBank under accession number KM673248- KM673271, including a partial mRNA of MMP-9. In the 24 colonies, 19 had homologues based on sequence analysis.

261

Sequences of 13 of the 19 colonies are predicted full or mayfull. It indicated that construction of this library was successful. The putative 50 -end and 30 -end of MMP-9 was obtained by 50 RACE and 30 -RACE with gene specific primer (For 50 -RACE: 50 CTTTTATAACCGAAGCGCTCCAGAT -30 ; For 30 -RACE: 50 -A TGGAGACCCCTACCCATTTGATGG-30 ). SMART RACE cDNA Amplification Kit (Clontech, USA) was used in this step. The PCR used following conditions: 5 cycles of 94  C for 30 s, 70  C for 30 s, 72  C for 3 min; followed by 25 cycles of 94  C for 30 s, 68  C for 30 s, 72  C for 3 min. PCR products were ligated into pMD18-T vector (TaKaRa, Japan) and sequenced. The open reading frame (ORF) of MMP-9 cDNA was determined using the program EditSeq in DNAStar. Nucleotide and amino acid sequence identity were performed using the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Signal peptides and conserved domains were analyzed by SignalP 4.1 [36] and the SMART (http://smart.embl-heidelberg.de/). The complete sequence of MMP-9 cDNA consisted of 2561 nucleotides (nt). It contains a 50 untranslated region (UTR) of 111 nt, a complete open reading frame (ORF) of 2058 nt, and a 30 UTR of 392 nt. The deduced protein was composed of 685 amino acids with a calculated molecular weight of 77.182 kDa and a theoretical isoelectric point of 5.78. Complete cDNA sequence and deduced amino acid sequence have been deposited to GenBank under accession number KM673247 (Yellow catfish MMP-9, YcMMP-9). Nucleotides sequence analysis showed that mRNA instability motifs (attta) and polyadenylation signal sequence (aataaa) were located in the 30 -UTR. Amino acids sequence analysis showed that YcMMP-9 consisted of several domains, including a signal peptide, a propeptide, three fibronectin type 2 domains, a Zn2þ binding region, an O-glycosylated domain and four hemopexin like repeats. In addition, a PG_binding_1 domain was predicted to locate from amino acids 36 to 94. To determine the amino acid sequence similarity of the predicted YcMMP-9 to known MMP-9 sequences, the ClustalW [37] and MegAlign program were used for sequence alignment and similarity analysis. Amino acid sequence of YcMMP-9 was homologous to those from other teleost or vertebrates (Fig. 1). Overall, high identity was obtained to those of other teleost fish, including channel catfish (85.3%), mexican tetra (74.9%), grass carp (74.4%), common carp (73.5%), zebrafish (72.6%), Atlantic salmon (71.8%), rainbow trout (69.8%), Japanese flounder (69.4%), and Japanese medaka (67.8%). The identities between YcMMP-9 and MMP-9 from mouse and human were 57.1% and 56.3%, respectively. Typical domains of MMP-9 family, including signal peptide, propeptide, three fibronectin type II repeats, Zinc-binding region, and four hemopexin-like domains, were found in YcMMP-9 (Fig. 1). Interestingly, the O-glycosylated domain (or hinge domain) which located between Zinc-binding region and hemopexin-like domain is much shorter than its mouse and human counterparts. This phenomenon is common in aligned sequences that from teleost and xenopus. However, the O-glycosylated domain in aligned sequences all possessed abundant proline, serine, and threonine residues. MMP-9 belongs to gelatinase. The other member of this MMP group is MMP-2. The two MMPs have structure similarities. They all possess a signal peptide, a propeptide, three fibronectin repeats, a Zn2þ binding region, and several hemopexin domains. The difference between MMP-9 and MMP-2 is that MMP-9 has an O-glycosylated domain located before hemopexin domain [2]. The signal peptide (aa 1-19 in YcMMP-9) directs secretion of MMP-9 from the cell. The propeptide (aa 20-109 in YcMMP-9) is essential for keeping the enzyme inactive [38]. The consensus sequence “PRCXXPD” which is pivotal to the propeptide was also found in YcMMP-9 (aa 97-103). The fibronectin repeats (aa 223-387 in

262

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267

Fig. 1. Multiple amino acid sequence alignment of MMP-9. Signal peptide, propeptide, fibronectin type II repeat, Zinc-binding region, and hemopexin-like domain are marked with overlines. The conserved cysteines that form intramolecular disulfide bonds were indicated with black triangle. GenBank accession numbers of the sequences used in this figure were collected in Table 1.

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267

YcMMP-9) are important for large substrates affinity [39e41]. Sequence alignment showed that twelve conserved cysteine residues located in this region (Fig. 1), which forms two intramolecular disulfide bonds in each repeat [42]. The hemopexin domains (aa 503-682 in YcMMP-9) are responsible for interaction with substrates, binding to inhibitors and cell surface receptors, and induction of auto-activation [2]. The O-glycosylated domain (aa 444502 in YcMMP-9), which was rich in proline, serine, and threonine residues, is indispensable for enzyme flexibility and correct MMP-9 function [2,43,44]. It has been reported that glycosylation made its contributions to the molecular weight of MMP-9 [45,46]. A phylogenetic tree was constructed using the neighbor-joining (NJ) algorithm in MEGA 6 with 1000 bootstrap replications [47] to determine evolutionary relatedness among MMP-9s (Table 1, Fig. 2). As shown in Fig. 2, MMP-9 from various fishes formed a clade and YcMMP-9 was clustered more closely with channel catfish MMP-9, which indicated the genetic relationship between this two species. All MMP-9s from fish, amphibians, reptile, birds, and mammals were clustered as a clade compared to MMP-2 (Fig. 2). It revealed that YcMMP-9 was a member of MMP-9 family. To obtain the genomic sequence of YcMMP-9, primers were designed based on the obtained cDNA sequence to amplify genomic DNA (primers sequences were collected in Supplementary Table 1). The genomic sequence of YcMMP-9 from the transcriptional start site to the transcriptional end site consisted of 4098 bp, containing thirteen exons (132, 239, 149, 129, 174, 174, 174, 156, 229, 140, 151, 104, 107 bp, respectively) and twelve introns (226, 291, 162, 228, 92, 145, 130, 139, 268, 88, 122, 149 bp, respectively) (GenBank accession number KP410263). The other known genomic sequence for fish MMP-9 was from channel catfish [17]. Comparison of the two sequences showed that they had high similarity in genomic organization. They have the same number of exons and introns. The sizes of MMP-9 exons were nearly identical between yellow catfish and channel catfish, except exon 1 (Supplementary Table 2). Further

263

analysis showed that exon sizes but not intron sizes were also conserved among yellow catfish, mouse [48], and human [49]. For the bacterial challenge, 15 fish were intraperitoneal injected with Aeromonas hydrophila (GIM1.172, Guangdong Microbiology Culture Center) at a dose of 1  107 cells diluted in 200 ml PBS per fish. A. hydrophia was cultured in LB medium at 30  C to 0.6 (OD600), and then centrifuged, suspended in PBS. Number of bacteria was counted with a bacteria counting plate (Helber Bacteria counting chamber, Thoma ruling, 5  105 mm3 chamber volume, Hawksley, UK) under microscope. The fishes used in challenge test were collected simultaneously with these described above and cultured under same conditions. Tissue samples were collected at 6 h, 24 h, 72 h, and 120 h as described above. The other 15 fish that injected with 200 ml PBS per fish were used as control. For real time RT-PCR, the head kidney, trunk kidney, liver, spleen, heart, intestine, gill, brain, skin, muscle, fin, and blood were collected from normal or challenged fish. Each sample was collected from three fish. Total RNA were isolated as described above and stored at 80  C. The RNA concentration and purity was determined by measuring the absorbance at 280 nm and 260 nm with the DU730 spectrophotometer (Beckman, USA). The real-time quantitative RT-PCR (qRT-PCR) was performed on an ECO Real-Time PCR system (Illumina, USA) with primers MMP-9RT-F (50 GGTGAGCTGGACCAACCAACAAT 30 ) and MMP-9-RT-R (50 GATCCCACTTCAGGTCTCCGTCA 30 ). Total RNA (1 mg) of each sample was reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan) following the manufacturer's instructions. The first-strand cDNA were stored at 80  C and used as template for qRT-PCR. The beta actin gene (GenBank accession number: KM673246) obtained in the cDNA library was used as internal standard (Primers: Actin-RT-F: 50 GGCTCAGAGCAAAAG AGGTATCC 30 /Actin-RT-R: 50 ACACGC AGCTCGTTGTAGAAGGT 30 ). Each qRT-PCR mixture contains 1 ml of cDNA, 5 ml of SYBR Premix DimerEraser (2  ), 0.3 ml of forward and reverse primers (3 mM each), 0.2 ml of Rox

Table 1 GenBank accession numbers of the MMPs used in this study. Gene

Species

GenBank accession number

MMP-9

Channel catfish (Ictalurus punctatus, Rafinesque 1818) Mexican tetra (Astyanax mexicanus) Zebrafish (Danio rerio) Grass carp (Ctenopharyngodon idella) Common carp (Cyprinus carpio) Atlantic salmon (Salmo salar) rainbow trout (Oncorhynchus mykiss) Nile tilapia (Oreochromis niloticus) Bicolor damselfish (Stegastes partitus) Zebra mbuna (Maylandia zebra) Southern platyfish (Xiphophorus maculatus) Pundamilia nyererei Neolamprologus brichardi Burton's mouthbrooder (Haplochromis burtoni) Japanese medaka (Oryzias latipes) Fugu rubripes (Takifugu rubripes) Coelacanth (Latimeria chalumnae) Japanese flounder (Paralichthys olivaceus) Amazon molly (Poecilia formosa) Guppy (Poecilia reticulata) Green sea turtle (Chelonia mydas) Tongue sole (Cynoglossus semilaevis) Eastern newt (Notophthalmus viridescens) African clawed frog (Xenopus laevis) Chicken (Gallus gallus) Rabbit (Oryctolagus cuniculus) Rhesus monkey (Macaca mulatta) House mouse (Mus musculus) Human (Homo sapiens) House mouse Human

NP_001187157 XP_007231993 NP_998288.1 ADU34085.1 BAB39390.1 NP_001133929 NP_001117842 XP_003448187 XP_008294599 XP_004558717 XP_005801450 XP_005732734 XP_006785641 XP_005914935 NP_001098350 NP_001032959 XP_006002447 BAB68366 XP_007540912 XP_008411742 XP_007067811 XP_008316390 AAX14805 AAI28677 NP_989998 NP_001075672 NP_001253834 AAX90605 AAA51539.1 EDL11089.1 AAH02576.1

MMP-2

264

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267

Fig. 2. Phylogenetic analysis of MMP-9 from teleost and other vertebrates. Amino acid sequence of house mouse MMP-2 and human MMP-2 were used as out-group. The phylogenetic tree was constructed using the neighbor-joining method in MEGA 6.0. The numbers given are frequencies (%) at which a given branch appeared in 1000 bootstrap replications. The MMP-9 of yellow catfish is indicated with asterisk. GenBank accession numbers were collected in Table 1.

Reference Dye, and 3.2 ml ultrapure water. The qRT-PCR reaction conditions were 95  C for 1 min, 40 cycles of 95  C for 10 s, 55  C for 30 s, and 72  C for 30 s, followed by melt curve analysis at 95  C for 15 s, 55  C for 15 min, and 95  C for 15 s. The threshold cycle (CT) value was obtained on the ECO software and the data were exported into a Microsoft Excel Sheet for subsequent analysis. The relative expression ratios of target genes in the treated group versus that in the control group were calculated by the 2DDCT method [50]. Data were expressed as mean ± standard deviation (SD). Differences between groups were analyzed by a one-way ANOVA with post hoc Tukey's test. Significance was accepted at the level of P < 0.05.

As shown in Fig. 3, YcMMP-9 was detected in all examined tissues of normal fish. High YcMMP-9 gene expression was detected in the head kidney, trunk kidney, spleen, and blood, with weak signal was found in intestine, brain, skin, fin, and muscle. The MMP-9 gene has been identified from Channel catfish [17]. Its expression was detected in spleen, gill, head kidney by RT-PCR in normal conditions. In our study, expression of YcMMP-9 was detected in all the examined tissues with high levels in spleen, head kidney, trunk kidney, and blood by qRT-PCR in unchallenged fish. Head kidney, trunk kidney, blood, and spleen are immune organs of fish. It was consistent with the observations in grass carp [23].

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267

265

Fig. 3. Constitutive expression of the YcMMP-9 mRNA in various yellow catfish tissues. Relatively mRNA levels were determined by real-time quantitative polymerase chain reaction (qRT-PCR) and normalized to the b-actin mRNA level. Data were expressed as mean ± standard deviation (SD).

As shown in Fig. 4, expression of YcMMP-9 increased 6 h after A. hydrophila injection and then declined in most of tissues. Significant up-regulation of YcMMP-9 expression was observed in head kidney, trunk kidney, and blood. By using carp as inflammation model, Chadzinska et al. [25] showed that MMP-9 was most expressed in immune organs and blood leucocytes. Under inflammation state, expression of carp MMP-9 mRNA increased during the initial phase of inflammation and the later phase of tissue remodeling. This phenomenon was observed in grass carp. When

challenged with A. hydrophila, expression of grass carp MMP-9 mRNA was up-regulated at 4 h post injection, reduced at days 1 and 4, and up-regulated again at day 7 post injection [23]. In the present study, expression of YcMMP-9 mRNA was significantly upregulated at 6 h post injection in most tissues. After then, its expression reduced to a low level at 24 h and 72 h post injection. At 120 h post injection, the YcMMP-9 expression had a slight recovery although lower than at 6 h. During the challenge test, no obviously clinical symptom was observed in yellow catfish after bacteria

Fig. 4. Expression of the YcMMP-9 mRNA in various yellow catfish tissues after infected by A. hydrophila. Challenged samples were collected 6 h, 24 h, 72 h, and 120 h after injection, respectively. Fishes that injected with PBS were used as control. Relatively mRNA levels were determined by real-time quantitative polymerase chain reaction (qRT-PCR) and normalized to the b-actin mRNA level. Data were expressed as mean ± standard deviation (SD); *P < 0.05.

266

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267

injection, which indicated that the A. hydrophila isolate was a low virulent strain to yellow catfish. Number of A. hydrophila in kidney, liver, and spleen after injection were counted by plate counting method. Results showed that number of A. hydrophila in kidney was greater than in liver and spleen. On the whole, the number of A. hydrophila reached highest at 24 h post injection, and then reduced with time. Very few bacteria were detected in tissues at 120 h post injection (Supplementary Fig. 1). It suggested the low virulence of this bacterium to yellow catfish. Up-regulation of YcMMP-9 expression was consistent with the change of bacterium number, which hinted that it could participate in immune response. The down regulation of YcMMP-9 since 24 h post injection could attribute to MMP inhibitors or the instability of MMP mRNA. The expression of MMP-9 could be regulated in different levels [2]. It has been reported that microRNAs could regulate MMP-9 gene expression [51]. MMP-9 activity was inhibited by TIMPs to maintain the TIMP/MMP balance [2]. Previous study in carp and grass carp observed the significantly up-regulation of MMP-9 at 7 days. A slight rise of YcMMP-9 was observed at 5 days post injection. The expression of YcMMP-9 gene at 7days or longer after stimulation needs further research. In conclusion, a normalized cDNA library of head kidney of Yellow catfish was constructed and YcMMP-9 gene was identified in this library. It has similar domain/motif organizations with other vertebrate MMPs. YcMMP-9 expressed in all checked tissues although mainly expressed in fish immune organs. Its expression was regulated by bacteria infection, indicating its potential roles in fish immune response. Acknowledgments This work was supported by the doctoral program of Henan University of Urban Construction to Fei Ke and Yun Wang and by the grant from the National Natural Science Foundation of China (31302227). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.04.012. References [1] N.D. Rawlings, A.J. Barrett, A. Bateman, MEROPS: the peptidase database, Nucleic Acids Res. 38 (2010) D227eD233. [2] J. Vandooren, P.E. Van den Steen, G. Opdenakker, Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9): the next decade, Crit. Rev. Biochem. Mol. Biol. 48 (3) (2013) 222e272. [3] A. Yabluchanskiy, Y. Ma, R.P. Iyer, M.E. Hall, M.L. Lindsey, Matrix metalloproteinase-9: many shades of function in cardiovascular disease, Physiol. (Bethesda) 28 (6) (2013) 391e403. [4] T.E. Curry Jr., K.G. Osteen, The matrix metalloproteinase system: changes, regulation, and impact throughout the ovarian and uterine reproductive cycle, Endocr. Rev. 24 (4) (2003) 428e465. [5] K.G. Osteen, T.M. Igarashi, K.L. Bruner-Tran, Progesterone action in the human endometrium: induction of a unique tissue environment which limits matrix metalloproteinase (MMP) expression, Front. Biosci. 8 (2003) d78e86.
linei, I.D. C

lan, Biology of metalloproteinases, Rom. J. [6] C. Ama aruntu, R.A. Ba Morphol. Embryol. 48 (4) (2007) 323e334. [7] M.J. Meijer, M.A. Mieremet-Ooms, A.M. van der Zon, W. van Duijn, R.A. van Hogezand, C.F. Sier, D.W. Hommes, C.B. Lamers, H.W. Verspaget, Increased mucosal matrix metalloproteinase-1, -2, -3 and -9 activity in patients with inflammatory bowel disease and the relation with Crohn's disease phenotype, Dig. Liver Dis. 39 (8) (2007) 733e739. [8] R. Visse, H. Nagase, Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function and biochemistry, Circ. Res. 92 (8) (2003) 827e839. [9] C.M. Overall, Molecular determinants of metalloproteinase substrate specificity: matrix metalloproteinase substrate binding domains, modules, and exosites, Mol. Biotechnol. 22 (1) (2002) 51e86.

[10] G.N. Marchenko, N.D. Marchenko, A.Y. Strongin, The structure and regulation of the human and mouse matrix metalloproteinase-21 gene and protein, Biochem. J. 372 (2) (2003) 503e515. [11] W. Bode, C. Fernandez-Catalan, H. Tschesche, F. Grams, H. Nagase, K. Maskos, Structural properties of matrix metalloproteinases, Cell. Mol. Life Sci. 55 (1999) 639e652. €uper, G. Murphy, Specific collagenolysis by [12] M.L. Patterson, S.J. Atkinson, V. Kna gelatinase A, MMPe2, is determined by the hemopexin domain and not the fibronectin-like domain, FEBS Lett. 503 (2e3) (2001) 158e162. [13] X.P. Xu, Z.H. Chen, Y. Wang, Y. Yamada, B. Steffensen, Functional basis for the overlap in ligand interactions and substrate specificities of matrix metalloproteinases-9 and-2, Biochem. J. 392 (1) (2005) 127e134. [14] H. Matsui, K. Ogiwara, R. Ohkura, M. Yamashita, T. Takahashi, Expression of gelatinases A and B in the ovary of the medaka fish Oryzias latipes, Eur. J. Biochem. 267 (15) (2000) 4658e4668. [15] K. Takeuchi, S. Kubota, M. Kinoshita, H. Toyohara, M. Sakaguchi, Cloning and characterization of cDNA for carp matrix metalloproteinase 9, Fish Sci. 68 (3) (2002) 610e617. [16] M.C. Johnson, A. Sangrador-Vegas, T.J. Smith, M.T. Cairns, Molecular cloning and expression analysis of rainbow trout (Oncorhynchus mykiss) matrix metalloproteinase-9, Fish Shellfish Immunol. 17 (5) (2004) 499e503. [17] H.Y. Yeh, P.H. Klesius, Complete structure, genomic organization, and expression of channel catfish (Ictalurus punctatus, Rafinesque 1818) matrix metalloproteinase-9 gene, Biosci. Biotechnol. Biochem. 72 (3) (2008) 702e714. [18] H. Tsukamoto, Y. Yokoyama, T. Suzuki, S. Mizuta, R. Yoshinaka, Molecular cloning and expression of gelatinases (MMP-2 and MMP-9) in the pufferfish Takifugu rubripes, Comp. Biochem. Phys. B 148 (3) (2007) 295e302. [19] M. Kinoshita, T. Yabe, M. Kubota, K. Takeuchi, S. Kubota, H. Toyohara, M. Sakaguchi, cDNA cloning and characterization of two gelatinases from Japanese flounder, Fish Sci. 68 (3) (2002) 618e626. [20] A. Murakami, N. Mano, M.H. Rahman, H. Hirose, MMP-9 is expressed during wound healing in Japanese flounder skin, Fish Sci. 72 (5) (2006) 1004e1010. [21] S. Yoong, B. O'Connell, A. Soanes, M.O. Crowhurst, G.J. Lieschke, A.C. Ward, Characterization of the zebrafish matrix metalloproteinase 9 gene and its developmental expression pattern, Gene Expr. Patterns 7 (1e2) (2007) 39e46. [22] E. de Vrieze, F. Sharif, J.R. Metz, G. Flik, M.K. Richardson, Matrix metalloproteinases in osteoclasts of ontogenetic and regenerating zebrafish scales, Bone 48 (4) (2011) 704e712. [23] X.Y. Xu, Y.B. Shen, J.J. Fu, F. Liu, S.Z. Guo, J.L. Li, Characterization of MMP-9 gene from grass carp (Ctenopharyngodon idella): an Aeromonas hydrophilainducible factor in grass carp immune system, Fish Shellfish Immunol. 35 (3) (2013) 801e807. [24] T. Matsuyama, A. Fujiwara, C. Nakayasu, T. Kamaishi, N. Oseko, N. Tsutsumi, I. Hirono, T. Aoki, Microarray analyses of gene expression in Japanese flounder Paralichthys olivaceus leucocytes during monogenean parasite Neoheterobothrium hirame infection, Dis. Aquat. Organ. 75 (1) (2007) 79e83. [25] M. Chadzinska, P. Baginski, E. Kolaczkowska, H.F. Savelkoul, B.M. Kemenade, Expression profiles of matrix metalloproteinase 9 in teleost fish provide evidence for its active role in initiation and resolution of inflammation, Immunology 125 (4) (2008) 601e610. [26] C. Dan, J. Mei, D. Wang, J.F. Gui, Genetic differentiation and efficient sexspecific marker development of a pair of Y- and X-linked markers in yellow catfish, Int. J. Biol. Sci. 9 (10) (2013) 1043e1049. [27] H. Liu, B. Guan, J. Xu, C. Hou, H. Tian, H. Chen, Genetic manipulation of sex ratio for the large-scale breeding of YY super-male and XY all-male yellow catfish (Pelteobagrus fulvidraco (Richardson)), Mar. Biotechnol. (NY) 15 (3) (2013) 321e328. [28] J.L. Zheng, Z. Luo, Q.L. Zhu, X.Y. Tan, Q.L. Chen, L.D. Sun, W. Hu, Molecular cloning and expression pattern of 11 genes involved in lipid metabolism in yellow catfish Pelteobagrus fulvidraco, Gene 531 (1) (2013) 53e63. [29] Q.L. Chen, Y. Gong, Z. Luo, J.L. Zheng, Q.L. Zhu, Differential effect of waterborne cadmium exposure on lipid metabolism in liver and muscle of yellow catfish Pelteobagrus fulvidraco, Aquat. Toxicol. 142e143 (2013) 380e386. [30] J. Jing, J. Wu, W. Liu, S. Xiong, W. Ma, J. Zhang, W. Wang, J.F. Gui, J. Mei, Sexbiased miRNAs in Gonad and their potential roles for testis development in yellow catfish, PLoS One 9 (9) (2014) e107946. [31] J. Huang, H.C. Wen, J.G. Shi, Y.H. Huang, Z.S. Liang, Y.N. Long, J.X. Qin, Isolation and identification of pathogenic bacteria from pelteobagrus fulvidraco ulcerative syndrome and its drug sensitive test, J. South. Agric. 43 (1) (2012) 107e112 (in Chinese). [32] H. Qiao, H. Fu, S. Jin, Y. Wu, S. Jiang, Y. Gong, Y. Xiong, Constructing and random sequencing analysis of normalized cDNA library of testis tissue from oriental river prawn (Macrobrachium nipponense), Comp. Biochem. Physiol. Part D Genomics Proteomics 7 (3) (2012) 268e276. [33] F. Liu, D. Wang, J. Fu, G. Sun, Y. Shen, L. Dong, B. Zhang, S. Hu, J. Li, Identification of immune-relevant genes by expressed sequence tag analysis of head kidney from grass carp (Ctenopharyngodon idella), Comp. Biochem. Physiol. Part D Genomics Proteomics 5 (2) (2010) 116e123. [34] A. Pallavicini, E. Randelli, M. Modonut, D. Casani, G. Scapigliati, F. Buonocore, Searching for immunomodulatory sequences in sea bass (Dicentrarchus labrax L.): transcripts analysis from thymus, Fish Shellfish Immunol. 29 (4) (2010) 571e578. [35] J. Chen, C. Li, R. Huang, F. Du, L. Liao, Z. Zhu, Y. Wang, Transcriptome analysis of head kidney in grass carp and discovery of immune-related genes, BMC Vet. Res. 8 (2012) 108.

F. Ke et al. / Fish & Shellfish Immunology 45 (2015) 260e267 [36] T.N. Petersen, S. Brunak, G. von Heijne, H. Nielsen, SignalP 4.0: discriminating signal peptides from transmembrane regions, Nat. Methods 8 (10) (2011) 785e786. [37] F. Jeanmougin, J. Thompson, M. Gouy, D. Higgins, T. Gibson, Multiple sequence alignment with clustal X, Trends Biochem. Sci. 23 (10) (1998) 403e405. [38] P.E. Van den Steen, B. Dubois, I. Nelissen, P.M. Rudd, R.A. Dwek, G. Opdenakker, Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase9 (MMP-9), Crit. Rev. Biochem. Mol. Biol. 37 (6) (2002) 375e536. [39] J.L. Lauer-Fields, J.K. Whitehead, S. Li, R.P. Hammer, K. Brew, G.B. Fields, Selective modulation of matrix metalloproteinase 9 (MMP-9) functions via exosite inhibition, J. Biol. Chem. 283 (29) (2008) 20087e20095. [40] A. Shoji, M. Kabeya, M. Sugawara, Real-time monitoring of matrix metalloproteinase-9 collagenolytic activity with a surface plasmon resonance biosensor, Anal. Biochem. 419 (1) (2011) 53e60. [41] J. Vandooren, N. Geurts, E. Martens, P.E. Van den Steen, S.D. Jonghe, P. Herdewijn, G. Opdenakker, Gelatin degradation assay reveals MMP-9 inhibitors and function of O-glycosylated domain, World J. Biol. Chem. 2 (1) (2011) 14e24. [42] P.A. Elkins, Y.S. Ho, W.W. Smith, C.A. Janson, K.J. D'Alessio, M.S. McQueney, M.D. Cummings, A.M. Romanic, Structure of the C-terminally truncated human ProMMP9, a gelatin-binding matrix metalloproteinase, Acta Crystallogr. D Biol. Crystallogr. 58 (7) (2002) 1182e1192. [43] A. Dufour, N.S. Sampson, S. Zucker, J. Cao, Role of the hemopexin domain of matrix metalloproteinases in cell migration, J. Cell. Physiol. 217 (3) (2008) 643e651. [44] Rosenblum G, Van den Steen PE, Cohen SR, Bitler A, Brand DD, Opdenakker G, Sagi I. Direct visualization of protease action on collagen triple helical structure. PLoS One 5(6): e11043.

267

[45] P.E. Van den Steen, I. Van Aelst, V. Hvidberg, H. Piccard, P. Fiten, C. Jacobsen, S.K. Moestrup, S. Fry, L. Royle, M.R. Wormald, R. Wallis, P.M. Rudd, R.A. Dwek, G. Opdenakker, The hemopexin and O-glycosylated domains tune gelatinase B/MMP-9 bioavailability via inhibition and binding to cargo receptors, J. Biol. Chem. 281 (27) (2006) 18626e18637. [46] R. Hanania, H.S. Sun, K. Xu, S. Pustylnik, S. Jeganathan, R.E. Harrison, Classically activated macrophages use stable microtubules for matrix metalloproteinase-9 (MMP-9) secretion, J. Biol. Chem. 287 (11) (2012) 8468e8483. [47] K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis Version 6.0, Mol. Biol. Evol. 30 (12) (2013) 2725e2729. [48] S. Masure, G. Nys, P. Fiten, J. van Damme, G. Opdenakker, Mouse gelatinase B. cDNA cloning, regulation of expression and glycosylation in WEHI-3 macrophages and gene organisation, Eur. J. Biochem. 218 (1) (1993) 129e141. [49] P. Huhtala, A. Tuuttila, L.T. Chow, J. Lohi, J. Keski-Oja, K. Tryggvason, Complete structure of the human gene for 92-kDa type IV collagenase: divergent regulation of expression for the 92-and 72-kilodalton enzyme genes in HT1080 cells, J. Biol. Chem. 266 (25) (1991) 16485e16490. [50] K.J. Livaka, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method, Methods 25 (4) (2001) 402e408. [51] W. Yan, W. Zhang, L. Sun, Y. Liu, G. You, Y. Wang, C. Kang, Y. You, T. Jiang, Identification of MMP-9 specific microRNA expression profile as potential targets of anti-invasion therapy in glioblastoma multiforme, Brain Res. 1411 (2011) 108e115.