ht. J. Biochem. Vol. 24, No. 1 I, pp. 1763-1771, Printed in Great Britain

1992

0020-71 IX/92 $5.00 + 0.00 Pergamon Press Ltd

CHARACTERIZATION OF RAT LIVER NUCLEAR PROTEINS WHICH RECOGNIZE THE CAMP RESPONSIVE ELEMENT GUIHUALu,‘* DORISSCHLICHTER* and WESLEY D. WIcrcs2t ‘Department of Biology, Lanzhou University, Lanzhou, Gansu 730000, P.R.China and *Department of Biochemistry, University of Tennesee, Knoxville, TN 37996-0840,U.S.A. (Received 30 March 1992) Abstract-l.

The data herein reveal the existence of CAMP-responsive element (CRE)-binding factors (CRF) in the nuclear extracts from CAMP-treated rat liver. 2. DNAase I and DMS footprinting analysis showed that the CRFs protected the CRE (- 77 to - 92)

in the phosphoenolpyruvate carboxykinase (PEPCK) promoter and the TGACGTCA motif in a consensus oligodeoxynucleotide based on the sequence of the CRE’s of 6 CAMP-regulated genes (C32mer). 3. Competition assays indicate that the CRF(s) is a CGTCA-specific, ATF/CREB-like factor(s). 4. Southwestern (SW) blot analysis detected 2 apparent CRFs which have molecular weights of about 30 and 32 kDa, respectively. 5. Based on the comparision of the size and binding specificity of the CRFs with the CREBs reported to date, the CRFs appear to be novel CRE-binding nuclear factors.

INTRODUCTION

The octameric CAMP response element (CRE 5’-TGACGTCA-3’) has been shown to mediate the response to CAMP through a CRE-binding protein (CREB) (Deutsch et al. 1988a,b; Hoeffler et al., 1989; Silver et al., 1987). Recently, a number of nuclear factors ranging in M, from 34,000-120,000 have been isolated or characeterized by virtue of sequencespecific binding to a CRE or related motif (Andrisani et al., 1990; Gonzalez et al., 1989; Hoeffler et al., 1988; Kara et al., 1990; Kwast-Welfeld et al., 1991; Maekawa et al., 1989; Montminy and Bilezikjian, 1987; Zhu et al., 1989). These apparent discrepancies in the sizes of the CREBs may be due to species variations, proteolytic artifacts, posttranscriptional modification or the presence of distinct proteins which comprise a family of CREB proteins or some combination of all of these (Hoeffler et al., 1988). In fact, recent evidence has shown that multiple CREBs do co-exist in eukaryotic cells (Andrisani et al., 1990; Kwast-Welfeld et al., 1991; Hoeffler et al., 1990). The phosphoenolpyruvate carboxykinase (PEPCK) gene contains a functional CRE in its promoter (Short et al., 1986). The CRE can confer CAMP responsiveness to a neutral promoter after transfection of reporter constructs into cells in culture (Boker et al., 1988; Short et al., 1986). In the search for the molecular mechanism by which CAMP *Present address: Vegetable Crops Department, University of Florida, Gainesville, FL 32611, U.S.A. tTo whom correspondence should be addressed.

controls the expression of the PEPCK gene, we have found a CAMP-dependent nuclear factor capable of interacting with the CRE of the PEPCK gene promoter (Lee et al., 1988). The factor binds to the CRE cooperatively with an NF-l-like protein which binds to a site just upstream (URE) of the PEPCK CRE (Lu et al., 1992). The cooperative binding of the two proteins may account for the influence of the URE on both basal and CAMP-induced transcription of the PEPCK gene (Short et al., 1988) and the dual role of the CRE as a CAMP responsive and a basal promoter element (Quinn et al., 1988; Roesler et al., 1989). To better understand the mechanism responsible for CAMP regulation of PEPCK gene transcription, we have further characterized the CRE-binding factor (CRF) using gel-retardation, DNAase I and DMS footprinting, ion-exchange chromatography, and Southwestern blot analysis. Herein we present evidence to show that the CRF is a novel nuclear CRE-binding factor which has a molecular mass of approx. 30-32 kDa. MATERIALS AND METHODS

Nuclear extracts preparation Male Sprague-Dawley rats (about 200g) were injected i.p. with 2 mg of 8-Br-cAMP and 1 mg of 3-isobutyl-lmethylxanthine in phosphate-buffered saline 1.5 hr before sacrifice. The liver nuclear extracts were prepared with homogenization buffer (HB, 10 mM Hepes pH 7JO.5 mM spermidine/O.S mM spermine/5 mM EDTA/0.25 mM EGTA/ 50 mM NaF/7 mM 2-mercaptoethanol/l mM phenymethylsulfonyl fluoride) containing 0.5 M NaCl as previously described (Lee ef al., 1988; Lu ef al., 1992) except

1763

GUIHUA Lu et al.

1764

for the inclusion of additional protease inhibitors: 0.6 &ml 2-macroglobulin, 0.5 pg/ml leupeptin and 0.7 pg/ml pepstatin A (obtained from Boehringer Mannheim Biochemicals). Gel retardation assay The binding assay (20 ~1) was carried out in HB containing 0.025% NP-40, 0.125 M sucrose, 1.25 peg poly(dl:dC) (Boehringer Mannheim Biochemicals), 100 ng of linearized pUC18 DNA and the 32P-labeled DNA fragment (_ 20,000 cpm) which was end labeled with [Y-‘~P]ATPand T4 polynucleotide kinase (Sambrook et al., 1989). The various duplex DNA fragments were generated by annealing complementary strands of the synthetic oligonucleotides shown in Fig. 1. After incubation at room temperature for 30 min, samples were subjected to electrophoresis at 150 V for 2 hr in a 5% polyacrylamide gel in 50 mM Tris-borate-l mM EDTA. Radioactive bands were detected by exposure of the wet gel to Kodak XAR-5 film with an intensifying screen at -80°C from overnight to 2 days. Dimethyl surfate and DNAase I footprinting

Dimethyl sulfate (DMS) footprinting was carried out as previously described (Lu et al., 1992). For DNAase I footprinting, the gel retardation assay was carried out as above except that electrophoresis was run at 100 V for 1.5 hr in a 1.5% agarose gel. Radioactive bands were located by exposure of the wet gel to Kodak XAR-5 film at room temperature. Bands representing the bound and free probes were cut out and immersed in 10mM Tris-HCl, pH 7.5, containing 3 mM CaCl, and MgCI,. After adding DNase I to I pg/ml, the samples were incubated 12 min at RT. DNAase I activity was stopped by addition of 20mM EDTA. The digested bound and free probes were isolated by electrotransfer to DE-81 paper (Whatman Biosystems) at 4”C, then eluted from the DE81 paper by 10 mM Tris-1 mM EDTA containing 1.5 M NaCl. The probes were recovered by precipitating with ethanol before separation of fragments by electrophoresis on a 12% polyacrylamide sequencing gel containing 7 M urea.

P52mer P50mer P32me r PlSmer C32mer C32+Amer C24mer ATEAPl

Partial purification

Nuclear extracts were subjected to chromatography on phosphocellulose as described (Lu et al., 1992) except that the bound protein was eluted by 350mM NaCl-buffer A and 700 mM NaCl-buffer A, respectively. All the purification steps were performed at 4°C. Southwestern blot analysis

Southwestern blot analysis was performed essentially as described by Singh ef al. (1988) except that 200 peg nuclear protein was used for electrophoresis with 12% polyacrylamide containing 0.1% SDS. RESULTS

In previous studies, we demonstrated that a CAMPdependent factor in nuclear extracts from CAMPtreated rat liver is capable of interacting with a 46 bp CRE-containing oligonucleotide from the PEPCK gene (Lee et al., 1988). Although the core CRE from the PEPCK gene can act as a CAMP regulated enhancer when linked to a neutral promoter and introduced into heterologous cells (Bokar et al., 1988), it exhibits some dependence on the adjacent URE site both in terms of the degree of response to CAMP (Quinn et al., 1988; Roesler et al., 1989) and the affinity of CRECRF interactions in vitro (Lu et al., 1992). To determine whether the core CRE itself can specifically bind the CRF, we carried out gel retardation and competition assays with the labeled PEPCK core CRE (PlSmer) in the presence and absence of an excess of a variety of unlabeled DNA fragments. The P15mer did form a distinct complex with liver nuclear extracts which could be competed out by the PSOmer, ATF and C32mer; but not by the C32 + Amer, C24mer or API (Figs 2A and B). The C32mer contains a generic CRE whose contextual

-120 -110 -100 -90 -80 I I I I I TGACCATGGCTATGATCCAAAGGCCGGCCCCTTACGTCAGAGGCGAGC TATGATCCAAAGGCCTTACG TCAGSGCG?kGC!CTCCAGG TGCTGACCATGGCTATGATCCAAAGGCC CCCCTTACGTCAGAG TCGAGCCGGTCATTCGCTGACGTCGAGCCGGTCATT -TCGAGCCGGTCATTCGCTGA------AGAGAGAG

TCGAGGCGGCTTTCG-TGCGG TCuTTCAGATGAt?t?TCAG URE

CRE

Fig. 1. DNA fragments used in this study. Only the coding strand sequence is shown for each oligodeoxynucleotide. Distance from the cap site in the PEPCK promoter is indicated above the sequence. The C32mer was synthesized based on the consensus sequence found immediately up- and downstream of the consensus CRE motif from the genes where a functional CRE was first shown (Roesler et al. 1988). The sequences of ATF and API oligodeoxynucleotides are from the adenovirus E3 promoter.

Rat liver nuclear proteins and the CAMP responsive element sequence is based on a consensus of the sequences found just up- and downstream of the consensus TGACGTCA motif of the 6 genes where a functional CRE with this motif was first shown (Roesler ef al., 1988). This oligonucleotide supports strong complex formation with an apparent affinity much higher than that for either PlSmer or PSOmer (Lu et al., 1992); and it appears to act as a weakly functional CRE in oioo (Huang et al., 1991). The C32+Amer and C24mer are mutants of the C32mer as shown in Fig. 1. ProteinC32mer complex formation was prevented by the P52mer, C32mer and ATF, but not by the P32mer, C32 +A mer, C24mer or APl (Figs 2C and D). These results suggest that the C32mer binds to the CRF with same sequence specificity as the PlSmer. The same results have been observed with the C32mer and oligonucleotide probe from the tyrosine hydroxylase gene CRE with brain nuclear extracts (Huang et al., 1991). The results in Fig. 3 show that the P52mer, PlSmer, C32mer and ATF form similar DNAprotein complexes, whereas the C32 + Amer and C24mer have no binding activity under the condition used. Interestingly, the P52mer formed 2 complexes. The upper PS2mer-protein complex corresponded to the single complex formed with either the PlSmer or the large C32mer-protein complex whereas the lower P52mer-protein complex is similar to the single P32mer-protein complex. Additionally, the C32mer forms a small high mobility complex as well as the large low mobility complex (Figs 2D and 3). To determine the exact bindng site of the CRF on the various DNA fragments, we carried out DNAase I and DMS footprinting analysis. The PEPCK promoter fragment (PSOmer, - 111 to - 67) labeled on the noncoding strand was incubated with nuclear extracts. The bound and free probes were separated by electrophoresis in 1.5% agarose gel, then digested by DNAase I in the gel. The digested products were analyzed on a 12% sequencing gel containing 7 M urea. As shown in Fig. 4(A) the protected region extended from position -77 to -92 including the CRE. Interestingly, the T at -83 was only lightly protected by protein, and the G at -94 was hypersensitive to DNAase I. Another protected region (-70 to -76) adjacent to the main footprint was observed. The C32mer also exhibited protection of the consensus CRE from DNAase I digestion as well as a hypersensitive site at the 5’ end of the footprint (Fig. 4B). Methylation analysis was performed to identify the G residues that come into direct contact with the protein(s) forming each complex. Two G residues in the coding strand at position -82 and -86 and 1 G ( - 84) in the noncoding strand appear to be involved in the CRE-CRF interaction (Fig. 4C, lanes marked U). Thus the binding site for the CRF can be localized in the core CRE, within the area (- 77 to -92) defined by the DNAase I footprint (Fig. 4A).

1765

The C32mer formed a modest high mobility complex and a more substantial low mobility complex with the extract (Figs 2D and 3). To test whether these C32mer-protein complexes resulted from different CRFs or interactions between 1 CRF and different associated factors, we partially purifed the extracts by phosphocellulose chromatography. The 0.35 M NaCl eluate fraction from the phosphocellulose column formed mainly a single low mobility complex with the C32mer. However, the 0.7 M NaCl eluate fraction formed 2 complexes (low and high mobility) with the C32mer (Figs 5A and B). The binding was prevented by the P52mer, but not by the P32mer. This may indicate that there are two isoforms of CRF in the extracts. To examine this possibility and to determine the size of the possible isoforms of the CRF, we carried out southwestern blot (SW) analysis. Proteins were subjected to SDSpolyacrylamide gel electrophoresis, transferred to nitrocellulose and hybridized with labeled C32mer, P52mer or P32mer. As shown in Fig. 6, the C32mer generated 2 complexes with molecular masses of approx. 30-32 kDa. The P52mer detected 3 peptides, and two of them were located in same position as the peptides bound to the C32mer. The third band revealed by the P52mer probe was located at the same position as one of those seen with the P32mer. DISCUSSION

We report here the characterization of CRFs which exhibit sequence-specific binding to the PEPCK CRE in nuclear extracts of CAMP-treated rat liver. The DNA binding site is localized in a region from -77 to -92 of the PEPCK promoter which includes the TTACGTCA CRE motif. In addition, the CRF can bind to an artificial consensus oligonucleotide bearing a perfect CRE palindromic motif. It has an apparent molecular weight of about 30-32 kDa. The gel retardation assays showed that the CRFs in the nuclear extract bind to the PEPCK core CRE with the same specificity as with the consensus C32mer. Thus, only oligonucleotides bearing a wild type CRE are able to compete for the complex formed with the Pl Smer or C32mer which contain no known additional binding elements (Fig. 2). The CRE-CRF complex could also be competed by an adenovirus E3 promoter fragment, the ATF oligonucleotide, but not by APl, further indicating that the CRFs are CGTCA-specific factors belonging to the ATF/CREB family (Hai and Curran, 1991). This conclusion is supported by the lack of binding activity with the C32 + Amer (Fig. 3) where the CGTCA motif is mutated (AGTCA, Fig. 1). Roesler et al. (1989) have purified a CREBPErcK from rat liver by a PEPCK CRE affinity column. The size of the CREBPEPCKis 43 kDa, the same as the CREB, isolated from PC12 cells and rat brain which binds to the somatostatin gene CRE (Montminy

1766

&JIHLJA Lu el a/.

et al., 1988; Zhu et al., 1989. This may indicate that same protein binds the CREs in both PEPCK and somatostatin promoters, and, thus is present in both brain and liver (Berkowitz and Gilman, 1990). However, our DNAase I footprinting results showed that the region in PEPCK promoter bound by the CRF extends from - 77 to - 92 (Fig. 3A). The size of the protected region is smaller than the footprints observed by Roesler et al. (1989) and Zhu et al. (1989) (Fig. 4D). The CRF directly contacted three G residues in the PEPCK CRE (Fig. 4B) and required an intact CGTCA motif to bind specifically to the CRE (Fig. 2). Importantly, the CGTCA motif is critical for biological responsiveness of the CRE to CAMP regulation in the PEPCK promoter (Quinn et al., 1988) and other CAMP-inducible promoters (Andrisani et al., 1989; Fink et al., 1988, Lee et al., 1989). With the CREBi a single mutation of any G or C residues in the TGACGTCA motif result in a total loss of binding activity (Andrisani et al., 1988; Zhu et al., 1989). Roesler et al. (1989) reported that the purified CREB PErcKfrom rat liver can bind to the so-called CREZ, P3 and P4 sites in the PEPCK gene promoter in addition to CREl (the normal CRE, at -83 to -90). Each of these 3 sites contains a G or C residue mutation compared to the TTACGTCA motif at CREl. These results indicate that the binding specificity of the CRF is different from the CREBs found by Roesler et al. (1989) and Zhu et al. (1989). Apparently C/EBP may function as the CREBPErcK since it can bind to the PEPCK CRE and activates the transcription of the PEPCK gene (Park et al., 1990). To this date, the CREB-like proteins have been found to exhibit molecular weights between 34 and 120 kDa (Kwast-Welfeld et al., 1991; Andrisani et al., 1990). However, the CRFs we have detected have molecular masses of about 30-32 kDa (Fig. 6). From all of these results it would appear that the CRF’s we have detected may well be novel CAMP-response element-binding nuclear factors. Proteolytic breakdown of a large molecular weight CREB during preparation of the nuclear extracts seems unlikely because extra precautions were taken to prevent it (see Materials and Methods) and we have never seen higher molecular weight SW blot activity with any liver extracts. The CRF’s have sizes similar to the low molecular weight CREB (34 and 36 kDa) found by Kwast-Welfeld et af. (1991) in rat liver. It is interest-

ing to note that ATFl has been reported to be an active CREB and it has a molecular weight close to the CRF’s size (Hai et al., 1989). The 2 peptides detected on SW blots by the C32mer and P52mer (Fig. 6, peptide 1 and 2) suggest either that multiple proteins with closely related molecular sizes and/or different degrees of covalent modification (e.g. phosphorylation) of a single protein can bind to the CRE. The comparable degree of binding of two such forms of a single CREB would fit with reports that phosphorylation does not affect the affinity or specificity of CREB binding to a CRE (Gonzalez and Montminy 1989; Kwast-Welfeld et al., 1991). It is also possible that the 2 peptides represent isoforms generated by alternative splicing of the same CREB gene as has been seen with some of the CREB’s (Hoeffler et al., 1990; Foulkes et al., 1992). Chromatography on a phosphocellulose column separated the CRF into two fractions which formed qualitatively different complexes with the C32mer, confirming that there is more than one form of CRF in our extracts (Figs 5A and B). Based on the facts that the C32mer and the core PEPCK CRE (e.g. PSOmer) have functional CRE activity in a variety of cell lines when inserted in front of a CAT reporter construct (Huang et al., 1991; Bokar et al.,

1989) and the CRF exhibits a requirement for an intact CGTCA motif for in vitro, we suggest that the CRFs we have detected will be found to have functional significance in rat liver. The P52mer contains both a CRE and a URE (Fig. 1) and the DMS interference (Fig. 4C) and gel retardation assays (Fig. 3) clearly showed that the P52mer binds both CRF and URF in the liver extracts. The upper (lower mobility) complex contained both CRF and URF whereas the lower complex (higher mobility) contained apparently only the URF (Fig. 4C). Therefore, the the band detected with both the P52mer and the C32mer (band 1, Fig. 6) is the CRF while the band 3 (Fig. 6) detected by both the P52mer and the P32mer is most likely the URF. The P52mer has comparable affinity with the C32mer to bind the CRF and has comparable affinity with P32mer to bind the URF (Lu et al., 1992). The strength of the band 2 as revealed by the labeled P52mer seems equal to that of the band 2 seen with the C32mer probe plus the P32mer probe (Fig. 6). This suggests that the P52mer-detected wide middle band(s) could contain both another CRF and

(Figs 2 and 3 opposire)

Fig. 2. Analysis of specificity of complex formation by gel retardation. Binding reactions were carried out with 20 fig protein (A and B) or 5 pg of nuclear extract (C and D) from CAMP-treated rat liver as described in Materials and Methods. The formation of protein-P15mer (A and B) and labeled proteinC32mer (C and D) complexes was assayed in the presence ( + ) or absence ( - ) of increasing amounts of different unlabeled DNA fragments as shown above the figure. Fig. 3. Gel retardation assay with different DNA fragments. Binding reactions were carried out with 10 pg protein and different labeled DNA fragments as indicated on the top of the figure, except that the Pl Smer was incubated with 2Opg protein.

[2(A)1*~15mer

[2(B)]

Competitor

C32mar 0

Fold x

50

100

C32 + Amsr 200

50

100

200

C24 50

mer

100

*P15mer

Compethr

200

Fold

ATF

PSOmer 50

100

200

x

0

C2(

II)1 lC32mer

50

100

API 200

50

100

I

[2(c)]

*C32mer P52mer

Competitor Fold

i

0

50

100

P32mer 200

50

100

ATF 200

50

100

API 200

50

100

Competitor 200

Probe

Figs 2 and 3-legends

opposite.

I

k

=z +

2

LY

;:

200

GUIHUA Lu er al.

1768

( A)

l PSOmer

Noncodmg

strand ( B 1 *C32mer

Noncoding

strand

Protein -

+

+

-

G

Protem

_

+

-74

(C)

*P52mer Noncodmg G

FLUF

strand

Codmg G

FLU

strand F

D a

-100

-90

-80

-70

I GGccGGcccC~TnCAA C

b

GGCCGGCCCCTTZLCGTCAGAGGCGAGCCTCCA cc CGGAGGT

C

CGCCTCCTTGhWG

i60

-50

-40

-30

LT~T TCTCAAA

DNase

I footprint

in

the

CRE regions.

Fig. 4. Analysis of the DNA binding domains of CRF by DNAase I and DMS footprinting analyses. (A) and (B) DNAase I footprinting analysis was done with 20 pg nuclear protein and the PSOmer or C32mer labeled on the noncoding strand as described in Materials and Methods. (C) Methylation interference was done with both labeled coding and noncoding strands of the P52mer as described previously (Lu et al., 1992). G, G residue marker; F, free probe; L, bound probe in lower complex; U, bound probe in upper complex. (D) Comparision of DNAase I footprints. (a) CRF bound to the PEPCK CRE as shown in Fig 3(A). 1(b) CREBPErcK bound to the PEPCK CRE observed by Roesler et al. (1989); (c) CREB, bound to the somatostatin CRE found by Andrisani Ed al. (1988).

Rat liver nuclear proteins and the CAMP responsive element

Probe

*P32msr

‘C32mer

Probe

*P32mer

*C32mer

Fig, 5. Gel retardation assay with labeled C32mer or P32mer and nuclear extract partially purified by phospho~ll~o~ column. The competitor DNA was 200-fold more than the labeled DNA probe. (A) 0.35 M NaCl eluate fraction. (B) 0.7 M NaCl eluate fraction.

68

: 3

Fig. 6. Southwestern blot analysis of proteins that interact with the CRE (PS2mer and C32mer) and URE (P32mer) in crude nuclear extracts. Protein (200 pg) was subjected to 12% SDS-PAGE, transferred to nitrocellulose membrane, and hybridized with labeled P52mer, C32mer or P32mer, respectively.

1769

GUIHUA Lu et al.

1770

another URF which have very close sizes (Fig. 6). The response of the PEPCK CRE to CAMP has some dependence on the adjacent URE site (Quinn et al., 1988) and the URE site facilitates CRF binding in vitro (Lu et al., 1992). Thus, the URE has a potentially important role in the response of the PEPCK gene to CAMP. Many reports have appeared that multiple forms of CREBs co-exist in eukaryotic cells and they probably have tissue-specific distribution (Roesler et al., 1989). The CRF we have detected appears to be different from the CREBs reported by others for rat liver (Roesler et al., 1989) and may reflect the use of different protocols for extracting the nuclear proteins, the use of a different probe, or possible post-transcriptional and/or post-translational modifications. These possibilities will require further study as well as elucidation of the mechanism by which the CRF (and URF) regulate PEPCK gene transcription.

expression of the rat somatostatin gene. Molec. cell. Biol. 8, 1947-1956. Andrisani 0. M., Zhu Z., Pot D. A. and Dixon J. E. (1989) In vitro transcription directed from the somatostatin promoter is dependent upon a purified 43 kDa DNA binding protein. Proc. natn. Acad. Sci. U.S.A. 86,

2181L2185. Berkowitz L. A. and Gilman M. Z. (1990) Two distinct forms of active transcription factor CREB (CAMP response element binding protein). Proc. nafn. Acad. Sci.

U.S.A. 87, 5258-5262. Bokar J. A., Roesler W. J., Vandenbark G. R., Kaetzel D. M., Hanson R. W. and Nilson J. H. (1988) Characterization of the CAMP responsive elements from the genes from a subunit of glycoprotein hormones and phosphoenolpyruvate carboxykinase (GTP): conserved features of nuclear protein binding between tissue and species. J. biol. Chem. 264, 19,740-19,747. Deutsch P. J., Hoeffler J., Jameson J. L. and Habener J. F. (1988a) Cyclic AMP and phorbol ester-stimulated transcription mediated by similar DNA elements that bind distinct proteins. Proc. natn. Acad. Sci. U.S.A. 85,

7922-7926. SUMMARY

Nuclear factors have been detected in rat liver extracts which are capable of interacting with the region of the PEPCK gene promoter known to contain a functional CAMP regulatory element (CRE) (Lee et al., 1988). DNAase I and methylation interference analysis combined with gel retardation and southwestern blot assays have extended analysis of the CRE binding factors (CRF) in CAMP-treated rat liver extracts. Footprinting analyses revealed that the CRF binds to the region from - 77 to - 92 of the PEPCK promoter which is known to contain a functional CRE (- 82 to -90). Competition experiments with labeled CRE-bearing fragments from the PEPCK promoter or an artificial consensus oligonucleotide and different unlabeled DNA fragments showed that the binding of the CRF to the CRE requires an intact CGTCA motif, typical of CREB/ATF-like proteins. The CRFs have a M, of about 30,000-32,000 based on southwestern blot analysis. Comparision of the size and binding specificity of the CRF with other reported CREBs in rat liver suggests that the CRFs may represent novel CRE-binding nuclear factors. Acknowledgements-The work described in ihis paper was surpported in part by a grant (GM 31538) from USPHS. The technical assistance of Kate Patton and Teresa Sobhani is gratefully acknowledged.

REFERENCES

Andrisani 0. M. and Dixon J. E. (1990) Identification and purification of a novel 120-kDa protein that recognizes the CAMP response element. J. biol. Chem. 265, 3212-3218. Andrisani 0. M., Pot D. A., Zhu Z. and Dixon J. E. (1988) Three sequence-specific DNA-protein complexes are formed with the same promoter element essential for

Deutsch P. J., Hoeffler J. P., Jameson J. L., Lin J. C. and Habcner J. F. (1988b) Structural determinants for transcriptional activation by CAMP responsive DNA elements. J. biol. Chem. 263, 18,466618,472. Fink J. S., Verhave M., Kasper S., Tsukada T., Mandel G. and Goodman R. H. (1988) The CGTCA sequence motif is essential for the biological activity of the vasoactive intestinal peptide gene CAMP-regulated enhancer. Proc.

natn. Acad. Sci. U.S.A. 85, 6662-6666. Foulkes N. S., Mellstrom B., Benusiglio E. and SassoneCorsi P. (1992) Developmental switch of CREM function during spermatogenesis: from antagonist to activator.

Nature 355, 80-84. Gonzalez G. A. and Montminy M. R. (1989) Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59, 675-680. Gonzalez G. A., Yamamoto K. K., Fischer W. H., Karr D., Menzel P., Biggs W. H. III, Vale W. W. and Montminy M. R. (1989) Cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequece. Nature 331, 7499752. Hai T. and Curran T. (1991) Cross-family dimerization of transcription factors Fos/Jun and ATFjCREB alters DNA binding specificity. Proc. natn. Acad. Sci. U.S.A. 88,

3720-3724. Hai T., Liu F., Coukos W. J. and Green M. R. (1989) Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selective form DNA-binding heterodimers. Gene Dev. 3, 2083-2090. Hoeffler J. P., Deutsch P. J., Lin J. and Habener J. F. (1989) Distinct adenosine 3’,5’-monophosphate and phorbol ester-responsive signal transduction pathways converge at the level of transcriptional activation by the interactions of DNA-binding proteins. Molec. Endow. 3, 8768-8880. Hoeffler J. P., Meyer T. E., Waeber G. and Habener J. F. (1990) Multiple adenosine 3’,5’-monophosphate response element DNA-binding proteins generated by gene diversification and alternative exon splicing. Molec. Endocr. 4,

920-930. Hoeffler J. P., Meyer T. E., Yun Y., Jameson J. E. and Habener J. F. (1988) Cyclic AMP responsive DNA-binding protein: structure based on a cloned placental cDNA clone. Science 242, 1430-1433.

Rat liver nuclear proteins and the CAMP responsive element

1771

Huang Z.-M., Thewke D., Gong Q.-Q., Schlichter D. and Wicks W. D. (1991) Functional recognition of the neuronal tyrosine hydroxylase CAMP regulatory element in different cell types. Molec. Brain Res. 11, 309-319. Kara C. J., Liou H.-C., Ivashkiv L. D. and G1imcher.L. H. (1990) cDNA for a human CAMP response element-binding protein which is distinct from CREB and expressed preferentially in brain. Molec. cell. Biol. 10, 1347-1357. Kwast-Welfeld J., Belle Ian de., Walker P. R., Isaacs R. J., Whitfield J. F. and Sikorska M. (1991) Changes in cyclic adenosine monophosphate responsive element binding proteins in rat hepatomas. Cancer Res. 51, 528-535. Lee C. Q., Miller H. A., Schlichter D., Dong J. N. and Wicks W. D. (1988) Evidence for a CAMP-dependent nuclear factor capable of interacting with a specific region of a eukaryotic gene. Proc. natn. Acad. Sci. U.S.A. 8!S,

protein in the transcriptional regulation of the gene for phosphoenolpyruvate carboxykinase (GTP). Molec. cell. Biol. 10, 6264-6267. Quinn P. G., Wong T. W., Magnuson M. A., Shabb J. B. and Granner D. G. (1988) Identification of basal and cyclic AMP regulatory elements in the promoter of the phosphoenopyruvate carboxykinase gene. Molec. cell.

4223-4227. Lee K. A. W., Fink J. S., Goodman R. H. and Green M.

Sambrook J., Fritsch E. F. and Maniatis T. (1989) Molecular Cloning: A Luboratory Manual, Vol. 1 10. 60. Cold Spring Harbor. Short J. M. Wynshaw-Boris A., Short H. P. and Hanson R. W. (1986) Characterization of the phosphoenolpyruvate carboxykinase (GTP) promoter-regulatory region. J. biol. Chem. Ml, 9721-9727. Silver B. J., Bokar J. A., Virgin J. B., Vallen E. A., Milsted A. and Nilson J. H. (1987) Cyclic AMP regulation of the human glycoprotein hormone a-subunit gene is mediated by an 18-base pair element. Proc. natn. Acad. Sci. U.S.A.

R. (1989) Distinguishable promoter elements are involved in transcriptional activation by Ela and CAMP. Molec. cell. Biol. 9, 4390-4397.

Lu G.-H., Schlichter D. and Wicks W. D. (1992) Interaction of a nuclear factor l-like protein with a CAMP response element-binding protein in rat liver. Int. J. Biochem. 24, 455-464.

Maekawa T., Sakura H., Kanei-Ishii C., Sudo T., Yoshimura T., Fujisawa J., Yoshido M. and Ishii S. (1989) Leucine zipper structure of the CRE-BP1 binding to the cyclic AMP response element in brain. EMBO. J. 8, 2023-2028.

Montminy M. R. and Bilezikjian L. M. (1987) Binding of a nuclear protein to the cyclic-AMP responsive element of the somatostatin gene. Nature 328, 175-178. Park E. A., Roesler W. J., Liu J., Klemm D. J., Gurney A. L., Thatcher J. D., Shuman J., Friedman A. and Hanson R. W. (1990) The role of the CCAAT/enhancer-binding

Biol. 8, 3467-3475.

Roesler W. J., Vandenbark G. R. and Hanson R. W. (1988) Cyclic AMP and the induction of eukaryotic gene transcription. J. biol. Chem. 263, 9063-9066. Roesler W. J., Vandenbark G. R. and Hanson R. W. (1989) Identification of multiple protein binding domains in the promoter-regulatory region of the phosphoenolpyruvate carboxykinase (GTP) gene. J. biol. Chem. X4,9657-9664.

87,2198-2202.

Singh H., LeBowwitz J. H., Baldwin A. S. and Sharp P. A. (1988) Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a recognization site DNA. Cell 52, 415-423. Zhu Z., Andrisani 0. M., Pot D. A. and Dixon J. E. (1989) Purification and characterization of a 43 kDa transcription factor required for rat somatostatin gene expression. J. biol. Chem. 264, 6550-6556.