YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 Protein Expression and Purification xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep 5 6

Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3)

3 4 7 8 9 10 11 1 2 3 4 14 15 16 17 18 19 20 21 22 23

Q1

Sandeep Kumar a, Kavish Kumar Jain a, Anupam Singh b, Amulya K. Panda b, Ramesh Chander Kuhad a,⇑ a b

Lignocellulose Biotechnology Lab, Department of Microbiology, University of Delhi South Campus, New Delhi 110021, India Product Development Cell, National Institute of Immunology, New Delhi 110067, India

a r t i c l e

i n f o

Article history: Received 4 November 2014 and in revised form 3 December 2014 Available online xxxx Keywords: Recombinant pectate lyase Inclusion bodies Refolding CD spectra

a b s t r a c t Pectate lyase (EC 4.2.2.2) gene from Bacillus subtilis RCK was cloned and expressed in Escherichia coli to maximize its production. In addition to soluble fraction, bioactive pectate lyase was also obtained from inclusion body aggregates by urea solubilization and refolding under in vitro conditions. Enzyme with specific activity 3194 IU/mg and 1493 IU/mg were obtained from soluble and inclusion bodies (IBs) fraction with recovery of 56% and 74% in terms of activity, respectively. The recombinant enzyme was moderately thermostable (t1/2 60 min at 50 °C) and optimally active in wider alkaline pH range (7.0– 10.5). Interaction of protein with its cofactor CaCl2 was found to stimulate the change in tertiary structure as revealed by near UV CD spectra. Intrinsic tryptophan fluorescence spectra indicated that tryptophan is involved in substrate binding and there might be independent binding of Ca2+ and polygalacturonic acid to the active site. The recombinant enzyme was found to be capable of degrading pectin and polygalacturonic acid. The work reports novel conditions for refolding to obtain active recombinant pectate lyase from inclusion bodies and elucidates the effect of ligand and substrate binding on protein conformation by circular dichroism (CD) and fluorescence spectrofluorometry. Ó 2014 Published by Elsevier Inc.

25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

41 42

Introduction

43

Pectinesterases and depolymerases are two major groups of enzymes responsible for pectin degradation. Pectinesterases catalyze removal of methoxyl groups, whereas depolymerases, which include hydrolases and lyases, cause degradation of polymer backbone [1]. Pectate lyase facilitates breaking of glycosidic bonds in unmethylated pectates by b-elimination reaction. Generally, pectate lyases are considered to be more specific for the degradation of unmethylated polygalacturonate, however, they have also been observed to act on esterified pectin [1]. Pectate lyases have varied applications due to variation of their pH optima. Pectate lyases having pH optima in acidic range are used in food and juice industries, whereas, alkaline pectate lyases are used in beverages fermentation, oil extraction, plant fiber processing and pulp and paper industries [2–4]. There are several reports on cloning, expression and purification of pectate lyase from various microorganisms [5–12]. However, recovery of the recombinant protein has been poor due to losses during purification. Moreover, high-level expression of recombinant proteins in Escherichia coli is known to lead to aggregation

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61

⇑ Corresponding author. Tel.: +91 11 24112062; fax: +91 11 24115270. E-mail address: [email protected] (R.C. Kuhad).

and formation of inclusion bodies (IBs)1 [13]. Pectate lyase from Bacillus subtilis possesses 15 proline residues. It has been reported that slow cis–trans isomerization around X-Pro bonds play a critical role in protein refolding process that subsequently affects the recovery of bioactive protein [14]. Recovery of active protein from IBs by in vitro refolding is a complex process and requires optimization at various steps [15]. The formation of IBs can be minimized if low temperature conditions are provided to the microorganism during incubation after induction. The formation of IBs also provides some advantages such as resistance of protein to proteolytic degradation, retaining of the native secondary structures of the protein and finally, aggregation makes the protein purification process more convenient and efficient. If the protein from IBs can be refolded into active form, this would provide a viable process for large-scale production of active enzymes [16,17]. In our laboratory, we have been studying various parameters for optimization of pectinase production from the wild type B. subtilis strain RCK [18]. Invariably, these studies have shown that pectate lyase is produced along with other pectin degrading and cellulolytic enzymes. However, specific industrial applications of pectate 1 Abbreviations used: IBs, inclusion bodies; CD, circular dichroism; EDTA, ethylenediaminetetracetic acid; PMSF, phenylmethanesulfonylfluoride; OFAT, one factor at a time.

http://dx.doi.org/10.1016/j.pep.2014.12.003 1046-5928/Ó 2014 Published by Elsevier Inc.

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 2 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103

S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx

lyase require the sole action of the enzyme on its substrates, and therefore, it is imperative to produce this enzyme under regulated conditions. Homologous recombinant expression of pectate lyase in B. subtilis has been reported earlier [6]. However, secretion of a range of cellulolytic enzymes is undesirable for certain applications which make the process slightly unfavorable [9]. Keeping in view the potential application of alkaline and thermostable pectate lyase, an attempt was made to clone and express pectate lyase gene from B. subtilis RCK in E. coli BL21(DE3). The recombinant protein expressed as a bioactive soluble fraction and as an insoluble inclusion bodies (IBs) fraction. To maximize the recovery of active enzyme, it is necessary to optimize the conditions for refolding of pectate lyase from IBs. In vitro refolding of this class of enzymes is generally unexplored. In the present study, we have attempted to optimize conditions for obtaining active pectate lyase from insoluble aggregates (IBs). The recombinant protein obtained though this process was purified and its secondary and tertiary structure was characterized after binding with its substrate and cofactor using circular dichroism (CD) and fluorescence spectrometry. Moreover, action of the enzyme on polygalacturonic acid and citrus pectin was analyzed by HPLC by observing substrate degradation products.

104

Materials and methods

105

Bacterial strains, plasmids, enzymes, antibiotics and other chemicals

106

B. subtilis RCK was maintained on agar plate containing 0.5% glucose, 0.5% peptone, 0.5% yeast extract, 0.15% KH2PO4, 0.01% MgSO47H2O and 2.0% agar, pH 9.0. The gene construct in pET28a vector was maintained in E. coli DH5a and the expression was performed in E. coli BL21(DE3) [F ompT hsdSB (rB m-B) gal dcm (DE3)] (Novagen, USA). Stocks of ampicillin (100 mg/ml) (HiMedia) and kanamycin (100 mg/ml) (HiMedia) were prepared in MilliQ water and stored at 4 °C. Working concentrations of ampicillin and kanamycin were used as 100 lg/ml and 50 lg/ml, respectively. Other chemicals were used as Tris base (Sigma–Aldrich, USA) for maintaining specific pH, ethylenediaminetetracetic acid (EDTA) (Sigma–Aldrich, USA) as chelating agent, trypsin (Sigma–Aldrich, USA) for protein digestion, deoxycholic acid (DOC) (Merck, USA) as detergent, CaCl2 (Merck, USA) as catalyst ligand and Phenylmethanesulfonylfluoride (PMSF) (Sigma–Aldrich, USA) as protease inhibitor.

107 108 109 110 111 112 113 114 115 116 117 118 119 120 121

122

Cloning of pectate lyase

123

Genomic DNA from B. subtilis RCK was isolated following Murmur’s method [19]. Pectate lyase gene was amplified using genomic DNA as template and the primers: forward_ 50 CAGCACATATGAAAAAAGTGATGTTAGCTACGGC30 and, reverse_ 50 CATACTCGAGTTAATTTAATTTACCCGCACCCGC30 . The gene was amplified using PCR reaction composed of initial denaturation at 95 °C for 5 min followed by 30 cycles of amplification containing denaturation at 95 °C for 1 min, primer annealing at 52 °C for 30 s and elongation at 72 °C for 30 s. A final elongation time of 7 min at 72 °C was provided for end filling. The amplified fragment and pET28a vector were digested with NdeI and XhoI restriction enzymes and both insert and vector were ligated by T4 DNA ligase (NEB, UK) at 4 °C. E. coli DH5a competent cells were transformed with ligation mixture. Initial screening of positive transformants was carried out by providing 50 lg/ml kanamycin selections on Luria–Bertani (LB) agar plate. Final authenticity of the recombinant construct was confirmed by nucleotide sequencing analysis and the gene sequence was submitted to NCBI (accession number AFH66771.1).

124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141

Expression of pectate lyase

142

E. coli BL21(DE3) competent cells were transformed with recombinant pectate lyase plasmid construct and transformed BL21(DE3) cells were cultivated in 100 ml Erlenmeyer flask containing 15 ml LB medium at 37 °C up to absorbance 0.8 at 600 nm. The culture was induced with 0.7 mM IPTG and postinduction growth was monitored by sampling at regular intervals. OD was measured by diluting the culture up to 10 times after attaining OD beyond 1.0. Uninduced culture was used as control. The expression of recombinant pectate lyase was confirmed by SDS–PAGE and western blotting (Semidry transfer, Bio-Rad system). The cell mass from 50 ml induced culture was spin down and resuspended in 50 mM Tris HCl buffer (pH 8.5). This cell suspension was sonicated by 10 cycles of sonication programmed as 10 s pulse on and 20 s pulse off at 4 °C. Sonicated culture was centrifuged at 17,000g, 4 °C for 20 min and the supernatant was evaluated for pectate lyase activity. Enzyme activity was determined by measuring the change in absorption at 235 nm in 100 mM glycine NaOH buffer (pH 9.0) containing 0.2% polygalacturonic acid (w/v) (e = 4600 M1cm1) and 0.44 mM CaCl2. One unit of enzyme activity was defined as the amount of enzyme required to produce 1 lmol of unsaturated oligogalacturonide per minute at 235 nm [5]. The amount of protein was measured by Bradford’s method using BSA as standard.

143

Enzyme production

166

Recombinant pectate lyase was purified from cells harvested from 1 L culture media. Transformed E. coli BL21(DE3) cells were cultivated in 2 L Erlenmeyer flasks, each containing 500 ml LB medium, at 37 °C up to absorbance 0.8 at 600 nm. The culture was induced with 0.7 mM IPTG and grown at 25 °C. Induced cell mass was harvested at OD600 nm 3.27 after 6 h of induction by centrifugation at 8000g for 15 min at 4 °C. Cell mass having total wet weight of 3.017 g (from 1 L culture broth) was washed with 50 mM Tris buffer at pH 8.5 and resuspended in 40 ml of buffer A (50 mM Tris buffer, pH 8.5, 1 mM PMSF and 5 mM EDTA). The cells were sonicated as described earlier and sonicated culture was centrifuged at 17,000g, 4 °C for 20 min. Culture supernatant was analyzed for enzyme activity, while the remaining pellet was resonicated in the same buffer except replacing 5 mM EDTA with 1% (w/v) sodium deoxycholate. Thereafter, the supernatant was analyzed for enzyme activity and IBs in the form of pellet were washed twice with 25 mM Tris HCl, pH 8.5. Finally, pellet was resuspended in 2 ml of MilliQ water and quantified for protein concentration. The soluble fraction from crude lysate was directly purified using Ni–NTA affinity column chromatography. The insoluble fraction in the form of IBs was solubilized and refolded as described in refolding of inclusion bodies further.

167

Purification of pectate lyase from soluble fraction

189

Soluble fraction of the enzyme in the lysate supernatant was purified by Ni–NTA affinity column chromatography. Empty spin column (Bio-Rad, USA) of 5 cm length having 1.2 ml bed volume was packed with Ni–NTA resin. Column was equilibrated with 4 column volume of 50 mM Tris HCl buffer, pH 8.5, containing 1 mM PMSF and 100 mM NaCl. The elution buffer containing different concentrations of imidazole were used to optimize the efficient elution of the pure pectate lyase. Different elution fractions were assayed for enzyme activity and quantification of protein content. The homogenous fraction was concentrated by 10 kDa cutoff Amicon tube (Pall Life Sci., USA) and dialyzed at 4 °C against 25 mM Tris HCl buffer, pH 8.5 to remove imidazole.

190

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188

191 192 193 194 195 196 197 198 199 200 201

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx 202

Refolding and purification of pectate lyase from inclusion bodies

203

Pectate lyase from IB aggregates was solubilized by 7 M urea and refolded into bioactive form. pH of the solubilizing buffer, concentration of urea and concentration of n-propanol for efficient solubilization of IBs were optimized from pH 7.5 to 12.5, 2 M to 8 M and 2 M to 6 M, respectively. 70 ll aliquot of IB suspension was solubilized in optimized buffer to makeup final volume of 1 ml. IB suspension was kept at room temperature for 2 h to achieve complete solubilization. The IB suspension was centrifuged for 10 min at 17,000g and the supernatant was used for refolding. Refolding was carried out using pulsatile dilution method [14], which involves the addition of solubilized protein in the refolding buffer at very slow rate (100 ll/min), while keeping the buffer in ice bath at constant slow stirring. Solubilized pectate lyase was initially refolded in three different refolding buffers as (1) 10% (v/v) glycerol + 50 mM Tris pH 8.5 + 5 mM CaCl2; (2) 0.25 mM L-arginine + 5% (v/v) glycerol + 50 mM Tris pH 8.5 + 5 mM CaCl2 and (3) 10% (w/v) sucrose + 50 mM Tris pH 8.5 + 5 mM CaCl2. The concentration of sucrose and CaCl2 in the refolding buffer was also optimized ranging from 2% to 14% (w/v) and 0.2 mM to 5 mM, respectively. Refolded protein in each buffer was analyzed for activity and the buffer promoting maximum activity was used for refolding of 700 ll IBs. Refolded protein was concentrated by 10 kDa emicon tube and analyzed for total protein concentration and enzyme activity. The protein was purified using Ni–NTA affinity column chromatography by the same column which was used for the purification of soluble fraction. Column was equilibrated with 4 column volume of 50 mM Tris pH 8.5 containing 10% sucrose, 100 mM NaCl and 2 mM CaCl2. Refolded protein was loaded to the column at a consistent concentration of 3.3 mg/ml. The protein was eluted using different concentrations of imidazole in equilibration buffer. Purified pectate lyase was dialyzed against buffers having successively decreasing concentrations of sucrose and imidazole. Enzyme activity and the protein content in different fractions were determined as described earlier.

204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237

Characterization of purified pectate lyase

238

Purified pectate lyase was digested with trypsin and its molecular weight was determined using MALDI-TOF and peptide mass fingerprinting. The effect of different temperature (30 °C to 70 °C), pH (4.0–10.0) and CaCl2 (0.2 mM–2.0 mM) concentration on activity of pectate lyase was evaluated following one factor at a time (OFAT) method and their optimal levels for maximum enzyme activity was determined. Purified pectate lyase was preincubated at different temperatures for 2 h while taking samples intermittently and residual activity was calculated under standard assay conditions. Similarly, pH stability was also calculated by preincubating enzyme in different buffers (50 mM) in pH range 3.0– 11.0 for 2 h and residual activity was calculated. The kinetic constants for the enzyme were investigated using 0.01–0.2% (w/v) of polygalacturonic acid as substrate in 100 mM glycine NaOH buffer (pH 9.0). Km and Vmax were calculated according to Lineweaver and Burk plot.

239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262

Estimation of change in enzyme structure by CD spectroscopy and spectrofluorometry Circular dichroism (CD) spectroscopy of purified pectate lyase was carried out in far UV (190–260 nm) and near UV (250– 300 nm) range of the electromagnetic spectrum with CD polarimeter (JASCO J-720). Spectra were obtained in a cuvette of 1 mm path length with a scan rate 20 nm/min. The effect of CaCl2 on the secondary conformations and tertiary structure of pectate lyase was analyzed by measuring the change in spectra before and after

3

the addition of CaCl2. Protein at concentrations 80 lg/ml and 700 lg/ml was used for far UV and near UV CD spectroscopy, respectively. To study the interaction of the protein with Ca2+ and polygalacturonic acid, spectrofluorometry analysis was carried out using Varian Cary Eclipse (Agilent Technology, USA) fluorescence spectrophotometer in a cuvette of path length 5 mm. First analysis was composed of three observations viz. pectate lyase at a concentration of 80 lg/ml followed by addition of 1 mM CaCl2 and 0.4% polygalacturonic acid. In the second experiment, spectrum analysis of purified pectate lyase was followed by 0.2% and 0.4% polygalacturonic acid without adding CaCl2. Samples were excited at a wavelength of 292 nm using a 650 W Xenon Flash lamp and the emission spectrum was obtained in the range of 300–400 nm.

263

Action of pectate lyase on pectin and polygalacturonic acid

277

To study the degradation products of polygalacturonic acid and pectin by pectate lyase, 0.2% (w/v) of polygalacturonic acid from orange and 0.2% (w/v) of citrus pectin were digested with the purified recombinant enzyme separately under standard assay conditions. Reaction mixture composed of 900 ll of substrate and 100 ll of enzyme (350 IU/ml) was incubated at 50 °C for 10 min and thereafter the reaction was stopped by incubating the reaction mixture at 70 °C for 10 min. Reaction mixture was filtered through 0.2 micron syringe filter and analyzed by HPLC using Aminex HPX87H column (BioRad, USA), while taking untreated substrates as controls.

278

Results

289

Cloning and expression of pectate lyase

290

Pectate lyase gene from B. subtilis RCK was cloned in pET28a vector in NdeI-XhoI cloning sites. Restriction digestion confirmed the presence of 1.2 kb gene insert. Further, nucleotide sequencing with primers specific for T7 initiator and terminator confirmed the accuracy of the ligation of a complete reading frame of 1263 bps translating a polypeptide of 420 amino acids with calculated molecular weight of about 45 kDa. The protein was found to be a member of Pec_lyase_C superfamily. The sequence revealed 99% amino acid similarity with the B. subtilis strain 168 Pectate lyase. Single nucleotide polymorphism at 20 sites was observed in the nucleotide sequence resulting into synonymous mutations at 19 positions and 1 serine to alanine substitution at 46th amino acid position. The expression of recombinant pectate lyase in the IPTG induced cultures was observed as a distinct band of 45 kDa on SDS–PAGE as compared to the respective time samples of uninduced cultures (Fig. 1a and Fig. SI1). The presence of pectate lyase was further confirmed by western blot analysis (Fig. 1b). Total protein quantification after sonication and IB purification revealed that 189 mg/L of total soluble protein and 109 mg/L of IB fraction was obtained from 3.017 g of wet biomass. Pectate lyase in the soluble fraction was having 835 IU/mg specific activity. This was higher than the specific activity of pectate lyase from the culture supernatant of wild type B. subtilis RCK under optimized conditions. Pectate lyase in the form of IBs was found to be devoid of any activity.

291

Purification of soluble fraction

317

Recombinant pectate lyase from the soluble fraction was purified through Ni–NTA affinity column chromatography. Out of the total soluble cytoplasmic protein, approximately 33% was observed

318

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

264 265 266 267 268 269 270 271 272 273 274 275 276

279 280 281 282 283 284 285 286 287 288

292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316

319 320

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 4

S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx

1

2

3

4

1

2

3

4

5

65 kDa 50 kDa

60 kDa 50 kDa

40 kDa

40 kDa

30 kDa

30 kDa

20 kDa

a

b

Fig. 1. (a) SDS–PAGE analysis of the induced expression of recombinant pectate lyase in E. coli BL21(DE3). Lane1: Protein molecular weight marker; lane 2: pectate lyase uninduced culture after 6 h of incubation; lane 3–4: pectate lyase culture after 2 and 6 h of induction, respectively. (b) Western blot analysis of pectate lyase expression in E. coli BL21(DE3). Lane 1: multicolor marker; lane 2; pectate lyase un-induced culture. Lane 3, 4, 5: pectate lyase culture after 2 h, 4 h and 6 h of induction, respectively.

326

as pectate lyase. After purification by affinity chromatography, 16% of the total soluble protein was obtained having 58% of the total enzyme activity which further reduced to 56% of the total activity and 15% of the total soluble protein after dialysis. A 4-fold purified enzyme having specific activity 3195 IU/mg was obtained from the bioactive soluble fraction (Table 1).

327

Refolding and purification of pectate lyase from inclusion bodies

328

Solubilization Various concentrations of urea and n-propanol were tested for maximum solubilization of IBs. n-Propanol up to 6 M concentration in combination with low concentration of urea found inefficient in IBs solubilization. Whereas, 50 mM Tris buffer, pH 8.5, containing 7 M urea was found optimum for maximum solubilization of IB aggregates. Urea concentration above 7 M reduced the recovery of bioactive pectate lyase. There was a reduction in the activity of the refolded pectate lyase at pH > 9 and at pH 12.5 extensive degradation of the protein was observed.

321 322 323 324 325

329 330 331 332 333 334 335 336 337

338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354

355 356 357 358 359 360 361 362 363

Refolding Refolding using pulsatile dilution reduced the aggregation of protein. Out of the refolding buffers tested, buffer 3 composed of 50 mM Tris, pH 8.5, containing 10% (w/v) sucrose and 2 mM CaCl2 was found optimal for maximum refolding of pectate lyase (1516 IU/mg). Slight reduction in activity of refolded protein (1493 IU/mg) was observed when the process was carried out at large scale (10 ml of urea solubilized pectate lyase was refolded in 90 ml refolding buffer). Buffer 1 containing 10% glycerol and buffer 2 containing arginine (0.25 mM) and glycerol (5% v/v) resulted in comparatively low refolding efficiency with specific activity of refolded purified enzyme as 1307 IU/mg and 1390 IU/ mg, respectively (Table SI2). Increase in CaCl2 concentration from 0.2 mM to 2 mM and sucrose concentration from 2% to 10% continuously increased the activity of refolded enzyme. Beyond these values no further increase in the activity of the refolded pectate lyase was recorded (Fig. 2). Purification About 51 mg of the purified protein was recovered after affinity chromatography followed by dialysis with 1.6-fold increase in specific activity of refolded enzyme (1493 IU/mg). Purification recovery of the total protein from the inclusion body fraction was higher than obtained from the bioactive soluble fraction. In terms of total activity, approximately 74% purified bioactive protein was recovered from IB aggregates in comparison to 56% downstream recovery from the soluble fraction (Table 1). To

confirm the purity, pectate lyase purified from the soluble fraction and IBs was concentrated (Fig. 3). Enzyme characterization

364 365

Q2

366

Purified recombinant pectate lyase was trypsin digested and subjected to MALDI TOF/TOF analysis which resulted in detection of 15 oligo peptides ranging in sizes from 10 to 25 amino acids. Peptide mass fingerprinting confirmed that the protein is having molecular mass of 45.47 kDa. Matrix Science mascot search showed the peptide sequences belonging to B. subtilis RCK pectate lyase with a top score of 94 and peptide charge state 1+ (Table. SI3). Kinetic parameters determination showed the enzyme had an apparent Km and Vmax of 0.45 mg/ml and 993 lmol/min/mg, respectively. The enzyme exhibited maximum activity at pH 9.5, 50 °C (Fig. 4a and b). Thermal and pH stability analysis showed that the protein retained half of its activity for 55 min at 50 °C and for 20 min at 60 °C, whereas, it completely lost activity within 5 min at 70 °C. The enzyme was observed to retain more than 80% residual activity in the pH range of 6.5–9.0.

367

Estimation of change in enzyme structure by CD spectroscopy and spectrofluorometry

382

Far UV circular dichroism spectra revealed that the protein was composed of 31% secondary structures in form of b-strands and 11% in form of a-helix. Except slight deepening in peak at 202 nm and 212 nm, no significant change in secondary structure was observed after the addition of CaCl2 (Fig. 5a). However, measurable changes in near UV CD spectra were recorded. As the concentration of CaCl2 was increased to 2.0 mM, CD signal shifted toward zero line in the wavelength range 260–270 nm and 275– 285 nm. Simultaneously, signal shifted slightly away from zero line towards positive ellipticity in the wavelength range 287–295 nm (Fig. 5b). Fluorescence spectra exhibited that the binding of Ca2+ with pectate lyase caused decrease in the emission intensity from 475 au to 297 au which was further reduced to 261 au after polygalacturonic acid binding (Fig. 6a). Similarly, significant decrease in emission intensity from 971 au to 384 au was recorded after polygalacturonic acid (0.4% w/v) binding in the absence of extra CaCl2 (Fig. 6b).

384

Action of pectate lyase on pectin and polygalacturonic acid

401

To access the efficacy of recombinant pectate lyase in hydrolyzing the methylated and non-methylated pectins, the enzyme was used for hydrolysis of polygalacturonic acid (non-methylated)

402

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

368 369 370 371 372 373 374 375 376 377 378 379 380 381

383

385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400

403 404

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 5

S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx Table 1 Purification profile of soluble active fraction and inclusion body fraction of pectate lyase. Fraction

Soluble active fraction Inclusion body fraction a

405 406 407 408 409 410 411

Crude enzyme

Affinity chromatography

Total protein (mg)a

Specific activity (IU/mg)

Total activity (IU)

Protein (mg)

Specific activity (IU/mg)

Total activity (IU)

Yield (%)

Protein (mg)

Specific activity (IU/mg)

Total activity (IU)

Yield (%)

189

835

158,000

31

2941

91,000

58

28

3195

89,000

56

109

937

102,000

57

1396

80,000

77

51

1490

76,000

74

Total protein was purified from 3.017 g wet cell biomass obtained from 1 L induced culture harvested at OD600nm 3.27.

and citrus pectin (methylated) (Figs. 7 and 8). The HPLC chromatograms revealed that on hydrolysis with pectate lyase, polygalacturonic acid (RT 6.8 min) was converted to oligogalacturonic acid (RT 7.3 min) (Fig. 7), while, citrus pectin (RT 7.0 min) was hydrolyzed to polygalacturonic acid and oligogalacturonic acid (Fig. 8). This demonstrates the ability of pectate lyase to act upon non-methylated and methylated forms of pectin.

412

Discussion

413

B. subtilis is well studied for secretion of various pectinases [1,18,20,21]. This bacterium has been observed to secrete pectinases both in submerged as well as in solid state fermentation [18]. In addition to already characterized pectinases, there might be several unidentified pectinases in B. subtilis [1]. As the level of production of pectate lyases from wild type strains is low, it is desirable to produce them using recombinant DNA technology. Heterologous protein expression in E. coli BL21(DE3), has become the backbone of recombinant protein production process because of its low fermentation time, high density cultivation capabilities, easy to maintain culture-systems and the robustness of organism to withstand variability in temperature [22]. Production of recombinant pectate lyase from B. subtilis has been studied as intracellular and secretory expression in various hosts such as Pichia pastoris; B. subtilis and E. coli by different research groups (Table 2). However, if compared in terms of the final yield of bioactive protein, process of pectate lyase IBs refolding is a prospective approach for obtaining larger amounts of industrially important recombinant enzymes. Considering the industrial application of alkaline pectate lyase, there is a need to enhance its production. Therefore, efforts were made to clone and express pectate lyase from B. subtilis RCK. In contrast to earlier reports we obtained significantly higher amount of protein from soluble fraction and IB fraction with specific activity of about 3194 IU/mg and 1493 IU/ mg, respectively (Table 2). The inclusion body aggregates were solubilized in 7 M urea and refolded using pulsatile dilution. The refolding buffer containing 10% of sucrose minimized the aggregation of protein with maximum refolding efficiency. The presence of sucrose in the solvent is already known to increase the stability of protein by making the conditions thermodynamically less favorable for the unfolded state [29]. In present study L-arginine was also observed to be effective in enhancing the yield of bioactive pectate lyase. However, sucrose was more effective in yield improvement. The presence of L-arginine in the refolding buffer has been reported as enhancer of refolding yield by suppressing protein aggregation [30] as well as inhibitory by acting as protein denaturant [31] in refolding process. As the refolded enzyme was dialyzed against very low concentrations of sucrose, a steep decrease in the activity of the enzyme was observed due to enzyme precipitation. Therefore, protein solution was dialyzed against successively reduced

414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453

Dialysis

concentrations of dialyzing buffer. This resulted in recovery of about 71% of the refolded protein in terms of total activity from IB fraction. However, specific activity of the purified pectate lyase after refolding was lower than the purified protein obtained from the soluble active fraction. This lower specific activity might be due to partial protein aggregation, which results in inefficient refolding. Protein aggregation is considered to follow higher order kinetics, while refolding is of first order. This makes the former comparatively faster as the concentration of the protein in renaturation buffer increases [15]. The recombinant pectate lyase from B. subtilis RCK showed activity even in the absence of CaCl2 in the reaction mixture, however, 1.5-fold increases in activity was observed in presence of 0.44 mM CaCl2 in the assay buffer. Ca2+ is considered essential for the activity of the enzyme but its roles in binding and or catalysis are not clear. Different functional attributes for Ca2+ have been speculated by various research groups highlighting the role of this divalent cation as mediator of electrostatic interaction between protein and oligogalacturonate [32], Lewis acid in the b elimination reaction [33] and for the enzyme substrate complex formation [34]. There are some reports highlighting the role of Ca2+ only for the enzyme substrate complex formation and striking out its direct involvement in catalysis [35]. CD spectra revealed that b-sheets compose a large portion (31%) of the structure of bioactive protein. These results are in accordance with those reported by Pickersgill et al. [36]. Near UV CD spectra indicated that as the concentration of CaCl2 was increased to 2.0 mM, shift in CD ellipticity was observed, however, even at this concentration, presence of good CD signal is itself an indication of the active conformation of the protein. Near UV CD signal is produced due to the environment around each aromatic amino acids side chain. Shift in signal towards zero line has been reported as indication of the unfolding of the protein tertiary structure [14]. In the native structure of the enzyme, Arg279 is conserved in the amino acid sequence of pectate lyases, play a central role in catalysis by making several hydrogen bonds with substrate [36]. This residue occurs in the sequence as Arg-Ala-Cis-Pro and plays a critical role in Ca2+ binding, thereby, has been proposed to be a part of the active site. The carbonyl of the Ala H-bonds to one of two buried water molecules that H-bond the Tyr of the five-residue aromatic stack of pectate lyase [36]. Therefore, it may be speculated that changes in near UV CD spectra after Ca2+ binding may be due to increase in flexibility of the protein to facilitate the substrate binding. Results obtained from fluorescence spectra also emphasize the change in the tertiary structure of the protein after Ca2+ binding. Intrinsic fluorescence of the protein is contributed by Trp and Tyr residues. B. subtilis pectate lyase has three long loops in its tertiary structure which form a local globular structure of 104 amino acids. This region is full of aromatic residues and exists near the site responsible for Ca2+ binding [37]. Spectro-fluorometry analysis revealed that the binding of polygalacturonic acid and Ca2+ was responsible for fluorescence quenching, which signify the tendency of Trp residues to

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 6

S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx

Fig. 2. Effect of the concentration of sucrose and CaCl2 on the refolding of pectate lyase.

65 kDa 45 kDa 35 kDa 25 kDa 18 kDa

Relative activity (%)

Relative activity (%)

Fig. 3. SDS–PAGE analysis of the concentrated purified pectate lyase. Lane 1–2: concentrated pectate lyase purified from soluble active fraction; lane 3–5: concentrated pectate lyase purified from inclusion body fraction.

escape from aqueous environment. The fluorescence from the aromatic residues is greatly affected by the presence of neighboring protonated acidic groups such as Asp and Glu. In the native structure of B. subtilis pectate lyase, primary Ca2+ is bound to seven ligands: 2 carboxyl oxygens coordinated by Asp223 and Asp227, 2 carboxyl oxygens of Asp184 and three water molecules [36]. Water molecules have been speculated to play a central role in the catalysis by representing substrate molecules and by forming hydrogen bonding network for creating link with conserved amino acid residues [37]. One possible explanation is that occupation of the binding pocket by Ca2+caused the increase in flexibility of the native structure of enzyme which in turn resulted in quenching of trp fluorescence. Quenching was also observed when fluorescence was analyzed in absence of CaCl2 but in the presence of polygalacturonic acid. Therefore, it may be concluded that the role of Ca2+ might be insignificant in enzyme substrate complex formation. Insignificant role of Ca2+ in substrate binding has already been hypothesized [36]. However, binding of Ca2+ was observed to increase the fluorescence intensity at about 300 nm and the same was not observed after addition of polygalacturonic acid. This signifies that the interaction of Ca2+ might be important for catalysis of pectate lyase. Maximum enzyme activity at pH 9.5 proves the alkalophilic nature of pectate lyase. The purified enzyme was stable in neutral to slightly alkaline pH conditions. Under these physical conditions, purified fraction of pectate lyase was used for analyzing the effect of methyl group present in the substrates on the activity of pectate lyase. Most of the pectate lyases reported thus far are highly active on polygalacturonic acid and low on methylated substrates [1,38]. Polygalacturonic acid represents the demethylated form of pectin [21]. It was observed that the enzyme was highly efficient in the degradation of polygalacturonic acid, forming oligogalacturonic acid with a retention time about 7.6 min in Aminex column HPX87H (Bio Rad). Action of the enzyme on citrus pectin resulted in formation of polygalacturonic acid with simultaneous formation of oligogalacturonic acid. Substrate specificity of pectate lyase has also been observed earlier by other groups which showed the capability of pectate lyase to act upon methylated and unmethylated forms of pectin [39]. Thermostability profiling confirmed that the enzyme is moderately thermostable with a half life of an hour at 50 °C. Therefore, this enzyme will be useful in industrial processes that require high temperature, namely; fiber processing in textile industries and degumming of plant fibers in pulp and paper industries etc [2]. In addition, alkaline pectate lyase might play a role in removal of

Time (minutes)

a

pH

b

Fig. 4. (a) Thermostability analysis of pectate lyase at various temperatures viz. 50 °C (diamond), 60 °C (square); 70 °C (triangle). (b) Analysis of the stability (square) and activity (triangle) of pectate lyase with respect to change in pH.

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx

7

Fig. 5. (a) CD spectra of pectate lyase in the absence of CaCl2 (solid line) and with 1.0 mM CaCl2 (broken line). (b) CD spectra of pectate lyase in the near UV (250–300 nm) range. (i) Without addition of CaCl2 (dotted line), (ii) with 1.0 mM CaCl2 (broken line) and (iii) with 2.0 mM CaCl2 (solid line).

Fig. 6. (a) Fluorescence spectra of pectate lyase showing the effect of addition of CaCl2 and polygalacturonic acid on the tertiary structure of the protein. Solid line: pectate lyase; dotted line: pectate lyase with 1 mM CaCl2; dashed line: pectate lyase with 1 mM CaCl2 and 0.4% w/v polygalacturonic acid. (b) Fluorescence spectra of pectate lyase showing the effect of the addition polygalacturonic acid in the absence of CaCl2 on the tertiary structure of the protein. Solid line: pectate lyase; dotted line: pectate lyase with 0.2% w/v PGA; dashed line: pectate lyase with 0.4% w/v polygalacturonic acid.

Sample Name: 0.2% PGA+ Pel

Oligogalacturonic acid

PGA

Sample Name: 0.2% PGA control

Fig. 7. Action of pectate lyase on 0.2% polygalacturonic acid (PGA) showing almost complete degradation of PGA in comparison to control (left) and formation of oligogalacturonides acid with retention time of 7.3 min (right).

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 8

S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx

Fig. 8. Action of pectate lyase on 0.2% pectin showing bioconversion of pectin forming PGA and oligogalacturonides with retention time of 6.6 min and 7.2 min, respectively (right) comparison to control with no enzyme (left).

Table 2 Comparison of the properties of recombinant pectate lyases from Bacillus subtilis.

551 552 553 554

Host/vector

Optimum CaCl2 concentration

Pectate lyase activity/yield

Kinetic properties (Km/Vmax)

Thermostability

Reference

E. coli/pET28a

2 mM

358 U mg1

50 °C for 24 h at pH 7.0

[1]

B. subtilis WB600/ pWB980 E. coli/pET22b P. pastoris GS115/ pHBM905A E. coli/pET22b P. pastoris GS115/ pPIC9 K E. coli/pET28a

0.44 mM

445 U mg1/61%

0.15 mg/ml and 59.6 U/ mg Not determined

60 °C for 20 min at pH 9.0

[5]

Not determined 0.09 mg/ml and 18.13 lmol/min Not determined Not determined

Not determined More than 85% activity at 40 °C at pH 9.5

[6] [9]

50 °C for 30 min at pH 9.0 20 min at 60 °C at pH 9.4

[11] [12]

0.45 mg/ml and 993 lmol/min/mg

55 min at 50 °C and for 20 min at 60 °C at pH 6.5–9.0

Present study

1

/22%

0.5 mM Not defined

11,300 U mg 452 U mg1

1.0 mM 0.5 mM

1010 U mg1/27% 1008 U mg1/21%

0.4 mM

3190 U mg1/50% from soluble fraction 1493 U mg1/71% from IB fraction

pectic material from wastewater produced by vegetable food processing industries [40]. There are also many other significant applications of alkaline pectate lyases such as in poultry feed, coffee and tea fermentation and oil extraction [21].

555

Conclusion

556

The present study reports characterization of an alkaline, thermotolerant recombinant pectate lyase and methods to generate recombinant bioactive pectate lyase from inactive IBs expressed in E. coli BL21(DE3). Solubilization in 7 M urea followed by pulsatile refolding improved the recovery of pectate lyase from IB aggregates. In comparison to the wild type almost 3.6-fold higher enzyme production was achieved in recombinant strain. Combined recovery of active protein both from soluble and insoluble fractions improved the overall productivity. Certainly, the process was efficient in terms of the recovery of soluble cytoplasmic fraction and recovery of refolded protein from IB fraction, however, the method could be costlier for production of industrial quantities of enzyme. Interestingly, the enzyme was found to be efficient in degradation of methylated as well as unmethylated form of pectin.

557 558 559 560 561 562 563 564 565 566 567 568 569

Author contribution

570

All the authors contributed in experimental design. S.K. and K.K.J. performed the experiments. A.S. and A.K.P. helped in refolding experiments. S.K., K.K.J., R.C.K. and A.K.P. analyzed the data and wrote the manuscript.

571

Submission declaration and verification

575

All authors declare that the manuscript has not been published previously and is not under consideration for publication elsewhere. Its publication is approved by all authors.

576

Uncited references

579

[23–28].

572 573 574

577 578

Q3

580

Acknowledgments

581

The fellowship grants from Indian Council of Medical Research Q4 (ICMR), New Delhi and Council of Scientific and industrial research Q5

582

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

583

YPREP 4615

No. of Pages 9, Model 5G

13 December 2014 S. Kumar et al. / Protein Expression and Purification xxx (2014) xxx–xxx

593

(CSIR), New Delhi, are gratefully acknowledged. The authors also wish to thank University of Delhi South Campus, New Delhi and National Institute of Immunology, New Delhi, for providing the infrastructural and instrumentation facility. The authors are grateful to Prof. J. P. Khurana, Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, for editing our manuscript. The authors are grateful to Dr. Satish Kumar, Scientist ‘H’, National Institute of Animal Biotechnology, Hyderabad, India for his valuable suggestions to improve the readability of our manuscript.

594

Appendix A. Supplementary data

595 596

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.pep.2014.12.003.

597

References

598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642

[1] M. Soriano, P. Diaz, F.J. Pastor, Pectate lyase C from Bacillus subtilis: a novel endo-cleaving enzyme with activity on highly methylated pectin, Microbiology 152 (2006) 617–625. [2] M. Kapoor, Q.K. Beg, B. Bhushan, K. Singh, K.S. Dadhich, G.S. Hoondal, Application of an alkaline and thermostable polygalacturonase from Bacillus sp. MG-cp-2 in degumming of ramie (Boehmeria nivea) and sunn hemp (Crotalaria juncea) bast fibers, Process Biochem. 36 (2001) 803–807. [3] R.S. Jayani, S. Saxena, R. Gupta, Microbial pectinolytic enzymes: a review, Process Biochem. 40 (2005) 2331–2344. [4] D.E. Akin, B. Condon, M. Sohna, J.A. Foulk, R.B. Dodd, L.L. Rigsby, Optimization for enzyme-retting of flax with pectate lyase, Ind. Crops Prod. 25 (2007) 136– 146. [5] Y. Liu, G. Chen, J. Wang, Y. Hao, M. Li, Y. Li, B. Hu, F. Lu, Efficient expression of an alkaline pectate lyase gene from Bacillus subtilis and the characterization of the recombinant protein, Biotechnol. Lett. 34 (2012) 109–115. [6] T. Matsumoto, D. Katsura, A. Kondo, H. Fukuda, Efficient secretory over expression of Bacillus subtilis pectate lyase in Escherichia coli and single-step purification, Biochem. Eng. J. 2 (2002) 175–179. [7] A. Tonouchi, Y. Hara, R. Umehara, T. Sanuki, T. Fukusawa, K. Miyairi, Cloning of the gene encoding an endo-acting pectate lyase from Streptomyces thermocarboxydus, Biosci. Biotechnol. Biochem. 74 (2010) 433–436. [8] P. Yuan, K. Meng, P. Shi, H. Luo, H. Huang, T. Tu, P. Yang, B. Yao, An alkalineactive and alkali-stable pectate lyase from Streptomyces sp. S27 with potential in textile industry, J. Ind. Microb. Biotechnol. 39 (2012) 909–915. [9] C. Zhang, J. Yao, C. Zhou, L. Mao, G. Zhang, Y. Ma, The alkaline pectate lyase PECTATE LYASE168 of Bacillus subtilis heterologously expressed in Pichia pastoris is more stable and efficient for degumming ramie fiber, BMC Biotechnol. 13 (2013) 26. [10] N. Damak, S. Abdeljalil, A. Koubaa, S. Trigui, M. Ayadi, H. Trigui-Laahiani, E. Kallel, N. Turki, L. Djemal, H. Belghith, N.H. Taieb, A. Gargouri, Cloning and heterologous expression of a thermostable pectate lyase from Penicillium occitanis in E. coli, Int. J. Biol. Macromol. 62 (2013) 549–556. [11] B. Zhuge, G.C. Du, W. Shen, J. Zhuge, J. Chen, Efficient secretory expression of an alkaline pectate lyase gene from Bacillus subtilis in E. coli and the purification and characterization of the protein, Biotechnol. Lett. 29 (2007) 405–410. [12] B. Zhuge, G.C. Du, W. Shen, J. Zhuge, J. Chen, Expression of a Bacillus subtilis pectate lyase gene in Pichia pastoris, Biochem. Eng. J. 40 (2008) 92–98. [13] J.F. Kane, D.L. Hartley, Formation of recombinant protein inclusion bodies in E. coli, Trends Biotechnol. 6 (1988) 95–101. [14] D.E. Kamen, R.W. Woody, Folding kinetics of the protein pectate lyase C reveal fast-forming intermediate and slow proline isomerization, Biochemistry-US 41 (2002) 4713–4723. [15] A.K. Upadhyay, A. Murmu, A. Singh, A.K. Panda, Kinetics of inclusion body formation and its correlation with the characteristics of protein aggregates in Escherichia coli, PLoS ONE 7 (2012).

584 585 586 587 588 589 590 591 592

9

[16] S.M. Singh, A.K. Panda, Solubilization and refolding of bacterial inclusion body proteins, J. Biosci. Bioeng. 99 (2005) 303–310. [17] S. Peternel, R. Komel, Isolation of biologically active nanomaterial (inclusion bodies) from bacterial cells, Microb. Cell Fact. 9 (2010) 66. [18] S. Gupta, M. Kapoor, K.K. Sharma, L.M. Nair, R.C. Kuhad, Production and recovery of an alkaline exo-polygalacturonase from Bacillus subtilis RCK under solid-state fermentation using statistical approach, Bioresour. Technol. 99 (2008) 937–945. [19] J.A. Murmur, Procedure for the isolation of deoxyribo-nucleic acid from microorganisms, J. Mol. Biol. 3 (1961) 208–218. [20] S.R. Herron, J.A.E. Benen, R.D. Scavetta, J. Visser, F. Jurnak, Structure and function of pectic enzymes: virulence factors of plant pathogens, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 8762–8769. [21] C. Arunachalam, S. Asha, Pectinolytic enzyme – A review of new studies, Adv. Biotecnol. J.-Online (2010) 1–5. [22] N.H. Tolia, L.J. Tor, Strategies for protein co-expression in Escherichia coli, Nat. Methods 3 (2006) 55–64. [23] F.A. Marston, The purification of eukaryotic polypeptides synthesized in Escherichia coli, Biochem. J. 240 (1986) 1–12. [24] G. Georgiou, P. Valax, Expression of correctly folded proteins in Escherichia coli, Curr. Opin. Biotechnol. 7 (1996) 190–197. [25] B. Jurgen, A. Breitenstein, V. Urlacher, K. Buttner, H. Lin, M. Hecker, T. Schweder, P. Neubauer, Quality control of inclusion bodies in Escherichia coli, Microb. Cell Fact. 9 (2010) 41. [26] J. King, C. Haase-petfingell, A.S. Robinson, H. Speed, A. Mitraki, Thermo labile folding intermediates: inclusion body precursors and chaperonin substrates, FASEB J. 10 (1996) 57–66. [27] M.M. Alonso, N.G. Montalbán, E.G. Fruitos, A. Villaverde, Learning about protein solubility from bacterial inclusion bodies, Microb. Cell Fact. 8 (2009) 4. [28] S.M. Gerami, S. Farajnia, F. Mahboudi, H. Babaei, Optimizing refolding condition for recombinant tissue plasminogen activator, Iranian J. Biotechnol. 253 (2011) 9. [29] J.C. Lee, S.N. Timasheff, The stabilization of proteins by sucrose, J. Biol. Chem. 256 (1981) 7193–7201. [30] T. Arakawa, K. Tsumoto, The effects of arginine on refolding of aggregated proteins: not facilitate refolding, but suppress aggregation, Biochem. Biophys. Res. Commun. 304 (2003) 148–152. [31] Y. Xia, Y.D. Park, H. Mu, H.M. Zhou, X.Y. Wang, M.G. Meng, The protective effects of osmolytes on arginine kinase unfolding and aggregation, Int. J. Biol. Macromol. 40 (2007) 437–443. [32] Y. Zheng, C.H. Huang, W. Liu, T.P. Ko, Y. Xue, C. Zhou, R.T. Guo, Y. Ma, Crystal structure and substrate-binding mode of a novel pectate lyase from alkaliphilic Bacillus sp. N16-5, Biochem. Biophys. Res. Commun. 420 (2012) 269–274. [33] D. Suck, C. Oefner, Structure of DNase I at 2.0 Angstrom resolution suggests a mechanism for binding to and cutting DNA, Nature 321 (1986) 620–625. [34] M.S. Crawford, P.E. Kolattukudy, Pectate lyase from Fusarium solani f.sp. pisi: purification, characterization, in vitro translation of the mRNA, and involvement in pathogenicity, Arch. Biochem. Biophys. 258 (1987) 196–205. [35] M.N. Rao, A.A. Kembhavi, A. Pant, Role of lysine, tryptophan and calcium in the b-elimination activity of a low-molecular-mass pectate lyase from Fusarium moniliformae, Biochem. J. 319 (1996) 159–164. [36] R. Pickersgill, J. Jenkins, G. Harris, W. Nasser, J. Robert-Baudouy, The structure of Bacillus subtilis pectate lyase in complex with calcium, Nat. Struct. Biol. 13 (1994) 717–723. [37] S.E. Lietzke, R.D. Scavetta, M.D. Yoder, F. Jurnak, The refined three-dimensional structure of pectate lyase E from Erwinia chrysanfhemi at 2.2 A resolution, Plant Physiol. 111 (1996) 73–92. [38] H.G. Ouattara, S. Reverchon, S.L. Niamke, W. Nasser, Biochemical properties of pectate lyases produced by three different Bacillus strains isolated from fermenting cocoa beans and characterization of their cloned genes, Appl. Environ. Microbiol. 76 (2010) 5214. [39] F. Tardy, W. Nasser, J. Robert-Baudouy, N. Hugouvieux-Cotte-Pattat, Comparative analysis of the five major Erwinia chrysanthemi pectate lyases: enzyme characteristics and potential inhibitors, J. Bacteriol. 179 (1997) 2503– 2511. [40] K. Horikoshi, Enzymes from alkalophiles, in: W.M. Fogarty, C.T. Kelly (eds), Microbial enzymes and biotechnology, 2nd ed., Elsevier, Ireland, pp. 275–295.

Please cite this article in press as: S. Kumar et al., Characterization of recombinant pectate lyase refolded from inclusion bodies generated in E. coli BL21(DE3), Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.003

Q6

Q7

643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711