DEVELOPMENTAL
BIOLOGY
153, 150-157 (1992)
Characterization of RNA Polymerase II-Dependent Transcription in Xenopus Extracts TETSUYA TOYODA AND ALAN P. WOLFFE’ Lrrborator,tJqf Moleculur Embryolog!y, National Institu fes oj’ Child Health a& Human Development, lVofio?rol Iustitu tes (ti Healttl Bu ildir~g 6, Room 131, Bethesda, Maryland 200892 Accepted April 2X, 199% We examine the RNA polymerase II-dependent transcription directed by several promoters in extracts prepared from distinct developmental stages ofXenop7L.s 2ae~i.s. RNA polymerase II accurately initiates transcription from the cytomegalovirus, herpes simplex virus thgmidine kinase, and Xenopus heat-shock protein (hsp) 70 promoters. The efficiency of transcription of these different promoters is dependent on whether extracts from oocytes, eggs, or somatic cells are used and on the temperature of incubation. In contrast to the viral promoters, the hsp 70 promoter is more active at heat shock temperatures in oocyte and egg extracts (31”-34°C) than at physiological temperatures for Xe?lorjus (20”-25°C). extracts should be useful in examining the molecular mechanisms responsible for differenThese in vitro transcription ‘0 1992 Academic Press, Inc. tial gene expression during XUK~~US development.
useful in the analysis of the molecular mechanisms regulating genes (for example, Brown and Schlissel, 1985; Andrews and Brown, 1987). However, there are many advantages to dissecting regulatory events i?l vitro (Wolffe and Brown, 1988; Wolffe, 1991). In vitro extracts from Xenopus oocytes and eggs capable of transcribing class III and class I genes have been described (Birkenmeier et al., 1978; Pape et al., 1989) and utilized for studies on transcriptional regulation (Vrana et al., 1988; Pape et al., 1989). Comparable systems capable of accurate transcription of class II gene promoters have not been available. In this report we establish optimal conditions for the accurate initiation of transcription at four class II gene promoters and describe their differential activity in extracts of Xenopus oocytes, eggs, and somatic cells.
INTRODUCTION
Experimental investigation using Xenopus laevis oocytes, eggs, embryos, and somatic cells has yielded many insights into the regulation of vertebrate development at the molecular level (Kay and Peng, 1991). The large oocytes and eggs of Xenopus store many of the macromolecules required for the rapid cell proliferation and differentiation that occur during early embryogenesis. Although Xenopus oocytes are very active transcriptionally, following maturation of the oocyte into an egg, transcription is inhibited. After fertilization, no transcription occurs until the mid-blastula transition (MBT, 4000 cells) (Newport and Kirschner, 1982a,b). The molecular mechanisms regulating this transition in transcriptional activity are still ill-defined. There are several examples of the transcriptional regulation of specific class II genes during early Xenopus development. The Xenopus hsp 70 gene is constitutively active in oocytes, yet inactive in somatic cells at physiologic temperatures (20”-26°C). However, a transcriptional induction in response to heat shock (31”-34°C) occurs in both cell types (Bienz, 1984a,b; Bienz and Pelham, 1982). Other genes, such as c-myc, Z’FIIIA, and FRG Yz, are selectively active in oocytes (Vriz et al., 1989; Hall and Taylor, 1989; Tafuri and Wolffe, 1990) and much reduced in transcriptional efficiency in somatic cells. The microinjection of trarbs-acting factors and mutant promoters into Xenopus oocytes and eggs has been
1 To whom correspondence
C, 1992 by Academic Press, Inc. of reproduction in any form reserved.
AND
METHODS
Cell Culture
Rapidly proliferating subclones of A6 somatic cells (ATCC, CCL 102) were selected by repeated passage at 1% confluence in 66% Leibovitz’s L-15 media (GIBCO) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (GIBCO), 100 U/ml penicillin G and 100 pg/ml streptomycin at 25°C. Whole Cell Preparation
from Egys and Oocytes
X laevis egg extracts were method of Lohka and Masui gonadotropin (Sigma) (1000 dorsal lymph sac of 10 female
has been addressed
0012-1606/92 $5.00 Copyright All rights
MATERIALS
150
prepared according to the (1983). Human chorionic U) was injected into the X Zaevis. Eggs laid over a
M
I 1234567
69
FIG. 1. I,( r,itvo transcription of theXerro?,z~s hsp 70 and human cytomcgalovirus promoters with Xww~us A6 somatic cell nuclear extracts. (A) 0.5 pg of pXL1OXP was incubated with 40 ~g of A6 nuclear extract for 1 hr at 25°C in the absence (lane 8) or presence (lane 9) of 4 &ml tu-amanitin. RNAs synthesized were annealed with 50 fmole of “2P-lat~eled primer (200K cpm) (see Materials and Methods). Controls include primer extension analyses of RNA isolated from immature XCWJ~~~~.S oocytes, A6 somatic cells, and heat-shocked A6 somatic cells (31°C for 3 hr, see Wolfre et crl.. 1984). The sequence analysis indicates that the correct start site of transcription was utilized in vitw (Bienz, 1983a). (8) A similar protocol was used to examine the start site of transcription at the CMT: promoter. 0.5 fig of hCMVCAT was incuhated with 40 pg of A6 and Drosoph i2u nuclear extracts as indicated for 1 hr. The sequence of hCMVCAT indicates the complimentary sequence of the RNA start site (A/+lGTCTAG). ilrrows mark the correctly initiated transcripts.
12-hr period were collected and dejellied in 2% cysteine, 20%] MBS (18 mMNaC1,0.2 mMKC1,0.5 mMNaHCO,, 2 mM Hepes-NaOH, pH 7.5, 0.15 mM MgCl,, 0.05 mM Ca(NO,),, 0.1 mM CaCl,). After washing three times in 20% MBS, followed by washing twice in egg extract buffer (50 mM Hepes-KOH, pH 7.4,50 mM KCl, 2.5 mM MgCl,, 2 mM 2-mercaptoethanol, 1 mM PMSF, 2 pg/ml leupeptin), the eggs were crushed by centrifugation at 9OOOgfor 15 min at 4°C. The light and heavy ooplasmic fractions, above the yolk pellet and below the lipid pellicle, were combined and further fractionated by ammonium sulfate precipitation. Ooplasmic fractions were diluted with 4 vol of precipitation buffer (15 mM HepesKOH, pH 7.6,110 mM KCl, 3 mM MgCl,, 0.1 rnM EDTA, 1 mM DTT, 1 mM PMSF, 10 pg/ml leupeptin). Ammonium sulfate (4 M, pH 7.6) was added to a final concentration of 0.36 M and the solution gently mixed for 30 min. The extract was clarified by centrifugation at 35,000 rpm in a Beckman ‘70 Ti rotor (84,OOOg). After removal of material floating on the supernatant sur-
face, the supernatant was collected by decantation and precipitated through the stepwise addition of 0.3 g of solid ammonium sulfate per milliliter of supernatant. After stirring for 15 min, the precipitate was collected by centrifugation at 15,000 rpm for 15 min in a SS-34 rotor (2’7,OOOg).The pellet was gently resuspended with a glass rod in an equal volume of HEMG (PK) buffer (25 mMHepes-KOH, pH 7.6,12.5 mMMgCl,, 1 mMDTT, 0.1 mM EDTA, 1 mM PMSF, 10 pg/ml leupeptin, lo%, glycerol). The suspension was dialyzed for 4-8 hr against two changes of 1 litre of HEMG O.lK (HEMG containing 0.1 M KCl). The lysate was centrifuged at 10,OOOyfor 10 min and the supernatant was quickly frozen in small aliquots in a dry ice-methanol bath and stored at -80°C. X laevis oocyte extracts mere prepared from mature ovaries by mincing the tissue and digesting follicle cells away from the oocyte for 2 hr at 25°C using 1 mg/ml collagenase (Sigma) in OR2 media (82.5 mM NaCl, 2.5 mM KCl, 1 mM CaCl,, 1 m&f MgCl,, 1 mM NaHCO,, 5 mM Hepes-NaOH, pH 7.8). Small oocytes and follicle cells were separated away from the mature oocytes. These mature oocytes were thoroughly washed three times in 20% MBS and twice in egg extract buffer. Oocytes were then crushed by centrifugation at 150,OOOn for 1 hr at 4°C and processed as described for the preparation of the egg extract.
The rapidly proliferating A6 cells (AGMR) were grown in 66% L15 plus 10% FBS to a cell density of 107/ml. The method of Manley et al. (1983) was used to prepare whole cell extracts with some minor modifications. Cells were washed thoroughly in ice-cold 66% phosphate-buffered saline (PBS) and the cell pellet was resuspended in four packed-cell volumes of 10 mMTrisHCl, pH 7.9,l mIIEDTA, 5 mMDTT, 1 mMPMSF, and 1 pg/ml leupeptin on ice. After a 20-min incubation on ice, the cells were lyzed by homogenization in a Douncc homogenizer with the “B” pestle. Four packed-cell volumes of 50 mM Tris-HCl, pH 7.9, 10 mM MgCl,, 2 mM DTT, 1 mM PMSF, 1 pg/ml leupeptin, 25% sucrose, and 50% glycerol were then added to the suspension and the mixture was stirred gently for 5 min. One packed-cell volume of saturated ammonium sulfate was then added dropwise to this mixture, followed by gentle stirring for 20 min. The cell lysate was then centrifuged at 50,000 rpm for 3 hr in a Beckman 70 Ti rotor (170,000.@ to remove insoluble debris and nucleic acid. Solid ammonium sulfate was added (0.33 g/ml supernatant) and the suspension stirred for an additional 30 min. The precipitate was collected by centrifugation at 15,000!~for 20 min and
152
DEVELOPMENTAL BIOLOGY
Oocyte
A6 Whole Cell Extract
Egg Extract
Extract
I
I
I
VOLUME 153,1992
A6 Nuclear Extract
Drosophila Extract
I
FIG. 2. Selectivity in promoter utilization in transcription extracts prepared from Xcr~opus cells at distinct developmental stages. 0.2 pmole each of hCMVCAT (CMV), pCAT control (SV40), pBLCAT2 (HSV tk), and pXLlOXP (hsp 70) were incubated with 40 pg of each extract under standard conditions for 1 hr. RNAs were annealed with 50 fmoles of each primer (200K cpm) and reverse transcribed (see Materials and Methods). The arrows indicate the position of the major transcripts.
resuspended with * the volume of the initial supernatant volume of HEMG (-K) buffer. This suspension was then dialyzed for 4-8 hr against two changes of 1 litre of HEMG O.lK. The lysate was centrifuged at 10,OOOg for 10 min and the supernant was frozen in small aliquots in a dry ice-methanol bath and stored at -80°C. The method of Soeller et al. (1988) was used to prepare nuclear extracts from AGMR cells. The washed cells were suspended in 4 ml/g (of cells) in buffer A (0.35 M sucrose, 15 mlM Hepes-KOH, pH 7.6,lO mM KCl, 5 mM MgCl,, 0.1 mM EDTA, 0.5 mMEGTA, 1 mMDTT, 1 mM PMSF, 1 pg/ml leupeptin, 0.1% Triton X-100) and were
A
B HSV lk
IISP10 HS
0
t
Nt Il.5
WC 0 0 t NE WC D
HS 0
t WCNt HS D 0 t WCNE 0
FIG. 3. Selectivity in promoter utilization is dependent upon temperature and transcription extract. Transcription reactions were established such that approximately equal transcription of the hsp 70 and HSV tk promoters occurred. Oocyte (0), egg (E), A6 somatic cell nuclear extracts from normal (NE) cells or cells heat shocked at 31°C for 3 hr (HS), A6 somatic cell whole cell extracts (WC), and Drosophila nuclear extracts (D) were used. Transcription temperature was 25” or 31°C (HS). Samples were processed as described. (A) RNA synthesis using the hsp ‘70 promoter. (B) RNA synthesis using the HSV tk promoter. Arrows indicate correctly initiated transcripts.
homogenized in a Dounce homogenizer with the “B” pestle. The homogenate was passed through three layers of cheese cloth to eliminate intact cells and then centrifuged at 4000 rpm in a Sorvall SS-34 rotor for 10 min. The pellets of nuclei were resuspended gently in buffer A (2 ml/g cells) and the nuclei were layered in 6-ml aliquots over an equal volume of buffer B (0.8 M sucrose, 15 mM Hepes-KOH, pH 7.6,10 mM KCl, 5 mM MgCl,, 0.1 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, 10 pg/ml leupeptin) in 15-ml graduated polycarbonate tubes. Nuclei were pelleted by centrifugation in a Sorvall HB-4 rotor at 5000 rpm for 10 min (4000~). The nuclear pellet was resuspended in 4 vol of precipitation buffer and transferred to Beckman 70 Ti polycarbonate tubes. Ammonium sulfate (4.0 M) (pH 7.6) was added stepwise to a final concentration of 0.36 &I, and lysis of the nuclei was accomplished by gentle mixing using a rotary mixer for 30 min. The extract was then processed as described for the Xenopus egg extract, by clarification and ammonium sulfate fractionation followed by dialysis and storage at -80°C. Drosophila nuclear extract was purchased from Stratagene or Promega. In vitro Transcription
Reactions
RNA synthesized in the in vitro transcription assays was quantitated by primer extension. These assays were done in 25 ~1 final volume of a buffer consisting of 12.5 mM Hepes-KOH, pH 7.6,6.25 mM MgCl,, 50 mM KCl, 1
153
TOVODAANDWOLFFE
100
50
KCI
150
200
0
40
(mM)
80
120
DNA
(pgiml)
160
200
D.
80
60
$
100
F a 5
80
2 a
60
E
-J 0
3
6 MW,
9
12
15
(mW
z 2
40
x .z
20
8 0 0
10
20
Temperature
30
40
(“C)
FIG. 4. Optimization of transcription in the Xenopus egg extract. hCMVCAT was incubated with 40 fig of Xenopus egg extract under the conditions indicated. Unless stated otherwise 0.6 pg of template in 25 ~1 was used. (A) The effect of variation in the concentration of KCl. (B) The effect of variation in the concentration of MgCl,. (C) The effect of variation in the concentration of template. (D) Transcription of 0.6 Kg of pBLCAT (HSV tk) and pXLlOXP (hsp 70) in the egg extract at different temperatures.
mM DTT, 0.05 mM EDTA, 0.5 mM each of ATP, CTP, GTP, and UTP, 1 mM spermidine, 10 U RNase inhibitor (GIBCO/BRL), 5% glycerol, and the indicated amount of the various extracts. Transcripts were annealed with 0.05 pmole of 5’ 32Plabeled primer (2 x 105cpm) in 10 ~1 of 20 mMTris-HCl, pH 8.0,0.2 mM EDTA, 0.25 M KC1 at 65°C for 5 min and at 55°C for 20 min, before cooling to room temperature. The annealed primer was elongated using 2 U of avian myeloblastosis virus reverse transcriptase (Promega) in 30 ~1 of 20 mM Tris-HCl, pH 8.0, 80 mM KCl, 8 mM MgCl,, 80 pg/ml of Actinomycin D (BMB), 10 mM DTT, 0.4 mM of each of four deoxynucleoside 5’ triphosphates (BMB), and 10 U of human placental RNase inhibitor (GIBCO/BRL) at 37°C for 1 hr. The reaction was stopped by the addition of 150 ~1 of ethanol. The nucleic acid was precipitated and washed in 70% ethanol, dried, and dissolved in 10 ~1 of formamide dye buffer. The solution was boiled for 2 min, chilled on ice, and then electrophoresed on a 6% polyacrylamide-urea gel.
Plasmids and Synthetic
Oligonucleotides
Transcription reactions used the plasmids hCMVCAT (cytomegalovirus (CMV) promoter and enhancer), pBLCAT2 (herpes simplex virus (HSV) thymidine kinase (tk) promoter), pXLlOXP (X Zaevis hsp 70 promoter), and pCAT control (SV40 early gene promoter and enhancer); these promoters have been described previously (Bienz, 1984a; Niller and Hennighausen, 1990; McKnight et al., 1981; Benoist and Chambon, 1981). They were the kind gifts of M. Bienz and L. Hennighausen or were purchased from BRL or Promega. Plasmid DNA was purified by cesium chloride centrifugation or by Quiagen chromatography (Diagen). The primer for reverse transcription analysis of hCMVCAT (reverse transcript length 136 nt), pBLCAT2 (128 nt), and pCAT control (186 nt) is 5’GGTGGTATATCCAGTGATTTTTTTCTCCAT, and that for pXL 1OXP (118 nt) is 5’CTCCTTACAGTTTGCTTTTCGCTAGAATA.
154
DEVELOPMENTALBIOLOGY
A.
VOLUME 1.53.1992
0.5min (sarcosyl) (sarcosyl) (1) DNA + extract
% sarcosyl
60 min
(sarcosyll (2) I + NTPs
0 time (1) -I)omoLDoLD 77NNOP4dcDc0,
B.
+ NTPs (2) 00008
Time (min) T
30 min
(3)
- extract
RNA
after NTPs (3) osggwg
C.
Time (min)
FIG. 5. The rate of initiation complex formation in the Xcnol~rs A6 somatic cell nuclear extract. (A) Sarcosyl inhibition of transcription, Transcription initiated at the hCMVCAT promoter is examined for sensitivity to different concentrations of Sarcosyl during preinitiation complex assembly (0 time (1)); after preinitiation complex assembly, but before RNA polymerase II has initiated transcription (+NTPs (2)); or after RNA polymerase II has initiated transcription (after NTPs (3)). (B and C) Rate of initiation complex formation on the hCMVCAT promoter was assayed by incubating the template in the A6 somatic cell nuclear extract for the times indicated before the addition of 0.1%) Sarcosyl. A single round of transcription occurs from completely assembled initiation complexes. This is assayed by primer extension (B) and is quantitated in (C). Arrows indicate correctly initiated transcripts.
Immunoblotting was by established procedures (Andrews and Brown, 1987) using commercially available monoclonal antibodies to the large subunit of RNA polymerase II (IBL Research Products, ARNA-3) or rabbit polyclonal antibodies to histone Hl (Wolffe, 1989). RESULTS
Spec(fic Initiatioyl Polymerase II
AND
DISCIJSSION
qf Transcription
bg RNA
We used the Xenopus heat-shock protein (hsp) 70 and the human CMV promoters (Bienz, 1984a; Niller and
Hennighausen, 1990) to assess the accuracy of transcription initiation by RNA polymerase II in the A6 somatic cell nuclear extract (Fig. 1). The hsp 70 promoter initiates transcription in vitro at the identical site to that seen i?l viva (Fig. lA, compare lanes 3 and 8); transcription is also sensitive to low concentrations of Namanitin (4 cc.g/ml) (Fig. lA, compare lanes 8 and 9). Accurate initiation of transcription in the nuclear extract is also seen on the CMV promoter (Fig. 1B). We compared the accuracy and efficiency of transcription of these two promoters together with the SV40 early promoter and the HSV tk promoter in the A6 nuclear extract, in the A6 whole cell extract, and in the oocyte and egg extracts (Fig. 2). A commercially avail-
TOYODA AND WOLFFE
Xwloplr,s RNA Po/!/,,rcYYl.srII
A II Ill IV V E A6 2C B c N
B OEWCNED
A6
FIG. 6. RNA polymerase II in the Xwwpvs extracts and duringX(Jjco1,~s development. (A) Immunoblotting analysis of RNA polymerasc II using monoclonal antibodies (IBL Research Products, ARNA-3. 10 pg protein (oocytes (stages II-V) or eggs (El after yolk removal, or 5 X 10” A6 cells (A6l) or 40 Jungprotein from two cell (2C), blastula (B), gastrula (G), or neurula (N) is resolved on a 613%’ gradient SDS-PAGE gel before transfer to nitrocellulose and immunoblotting. The positions of nonphosphorylated (II,) and phosphorglated (II,) forms of RNA polymerase II large subunit are indicated. (B) Immunoblotting analysis of RNA polymerase II in oocyte (01, egg (El, A6 somatic cell whole cell (WC) nuclear (NE), and Lkoso$~i/o extract. RNA polymerase II quantity is 2 x lo” A6 cell equivalents (40 pg protein in each lane). The positions of nonphosphorylated (II,) and phosphorylated (II,,) forms of RNA polymerase II large subunit are indicated.
able Lkosoplrilu extract was used as a control for RNA polymerase II activity. The primer extension results shown in Fig. 2 indicate that correctly initiated transcripts form a large component of total transcription from the CMV, HSV tk and hsp 70 promoters (arrows). Interestingly transcriptional efficiency varies among the four promoters and is dependent on the extract. For example, the CMV and SV40 promoters are very weak in oocyte and egg extracts, whereas they are relatively strong in the A6 somatic cell nuclear extract. Conversely the HSV tk and hsp 70 promoters are strong in oocyte and egg extracts, but relatively weak in the nuclear extract. It is important to note that absolute values should not be compared between different extracts, only the relative transcriptional efficiency of the promoters in the same extract. The differences between the individual promoters in transcriptional efficiency may be attributed to variation in the abundance or activity of the transcription factors that must associate with the individual promoters before they can be recognized by RNA polymerase II. Such variation between the extracts may be developmentally important (for example, Winning et t/l., 1991). The transcriptional regulation of the X~YLO~ZLS hsp 70 promoter during X~no~s development has been investigated in some detail (Bienz, 1984a,b; Ovsenek ef trl., 1990; Ovsenek and Heikkila, 1990). Oocytes appear to
155
synthesize and store the heat-shock transcription factor in a cryptic form that can be activated by heat shock (Ovsenek and Heikkila, 1990). Although hsp 70 is constitutively active in oocytes, transcriptional induction in response to heat shock still occurs (Bienz and Pelham, 1982). We determined that the transcription extracts prepared from oocytes and eggs retained the capacity to respond to heat shock dn c!itro (Fig. 3). In this experiment, template concentration and extract volume have been adjusted to allow approximately equal rates of transcription initiation in the different extracts at 20°C (Fig. 3A). Raising the temperature of incubation of the transcription reaction to 31°C leads to dramatic changes in relative transcriptional efficiency. The rate of transcription initiation at the hsp 70 promoter is significantly increased at 31°C for the oocyte and egg extracts, whereas transcription initiation in the other extracts does not change. Control experiments reveal that transcription initiated at the HSV tk promoter in the oocyte, egg, and Drosoph ikx extracts does not undergo a major change following the increase in temperature to 31°C; however, transcription in the somatic cell extracts significantly declines. Prior heat shock of the A6 somatic cells before preparation of the nuclear transcription extract does not provide any advantage for hsp 70 transcription or disadvantage for HSV tk transcription (Fig. 3A, HS lanes). This indicates that the effect of heat shock is rapidly reversible i?/ ?J~UO.The effect of transient temperature elevation on transcription an clitrn is also reversible (data not shown).
We examined in detail the optimal ionic conditions, DNA concentration, and incubation temperature for transcriptional activity in the extracts. Data are shown only for the egg extract (Fig. 4). Optimal rates of transcription initiation occurred at 100 mM KC1 (Fig. 4A) and 12 mM M&l, (Fig. 4B). These compare favorably with those previously described for transcription by RNA polymerase II in mammalian extracts (Weil ef al., 1979; Manley cutrrl., 1983). Specific transcription initiation occurred most often when the DNA concentration was 60-100 &ml (Fig. 4C). Similar results were obtained with the other four extracts. As previously noted, specific initiation varied with temperature in a promoter- and extract-specific manner (Fig. 3). Optimal transcription of the HSV tk promoter in the egg extract occurs at 25°C whereas for the hsp 70 promoter 31-34°C was optimal (Fig. 4D). WC also examined the rate of initiation complex formation in the X
BIOLOGY
153, 150-157 (1992)
Characterization of RNA Polymerase II-Dependent Transcription in Xenopus Extracts TETSUYA TOYODA AND ALAN P. WOLFFE’ Lrrborator,tJqf Moleculur Embryolog!y, National Institu fes oj’ Child Health a& Human Development, lVofio?rol Iustitu tes (ti Healttl Bu ildir~g 6, Room 131, Bethesda, Maryland 200892 Accepted April 2X, 199% We examine the RNA polymerase II-dependent transcription directed by several promoters in extracts prepared from distinct developmental stages ofXenop7L.s 2ae~i.s. RNA polymerase II accurately initiates transcription from the cytomegalovirus, herpes simplex virus thgmidine kinase, and Xenopus heat-shock protein (hsp) 70 promoters. The efficiency of transcription of these different promoters is dependent on whether extracts from oocytes, eggs, or somatic cells are used and on the temperature of incubation. In contrast to the viral promoters, the hsp 70 promoter is more active at heat shock temperatures in oocyte and egg extracts (31”-34°C) than at physiological temperatures for Xe?lorjus (20”-25°C). extracts should be useful in examining the molecular mechanisms responsible for differenThese in vitro transcription ‘0 1992 Academic Press, Inc. tial gene expression during XUK~~US development.
useful in the analysis of the molecular mechanisms regulating genes (for example, Brown and Schlissel, 1985; Andrews and Brown, 1987). However, there are many advantages to dissecting regulatory events i?l vitro (Wolffe and Brown, 1988; Wolffe, 1991). In vitro extracts from Xenopus oocytes and eggs capable of transcribing class III and class I genes have been described (Birkenmeier et al., 1978; Pape et al., 1989) and utilized for studies on transcriptional regulation (Vrana et al., 1988; Pape et al., 1989). Comparable systems capable of accurate transcription of class II gene promoters have not been available. In this report we establish optimal conditions for the accurate initiation of transcription at four class II gene promoters and describe their differential activity in extracts of Xenopus oocytes, eggs, and somatic cells.
INTRODUCTION
Experimental investigation using Xenopus laevis oocytes, eggs, embryos, and somatic cells has yielded many insights into the regulation of vertebrate development at the molecular level (Kay and Peng, 1991). The large oocytes and eggs of Xenopus store many of the macromolecules required for the rapid cell proliferation and differentiation that occur during early embryogenesis. Although Xenopus oocytes are very active transcriptionally, following maturation of the oocyte into an egg, transcription is inhibited. After fertilization, no transcription occurs until the mid-blastula transition (MBT, 4000 cells) (Newport and Kirschner, 1982a,b). The molecular mechanisms regulating this transition in transcriptional activity are still ill-defined. There are several examples of the transcriptional regulation of specific class II genes during early Xenopus development. The Xenopus hsp 70 gene is constitutively active in oocytes, yet inactive in somatic cells at physiologic temperatures (20”-26°C). However, a transcriptional induction in response to heat shock (31”-34°C) occurs in both cell types (Bienz, 1984a,b; Bienz and Pelham, 1982). Other genes, such as c-myc, Z’FIIIA, and FRG Yz, are selectively active in oocytes (Vriz et al., 1989; Hall and Taylor, 1989; Tafuri and Wolffe, 1990) and much reduced in transcriptional efficiency in somatic cells. The microinjection of trarbs-acting factors and mutant promoters into Xenopus oocytes and eggs has been
1 To whom correspondence
C, 1992 by Academic Press, Inc. of reproduction in any form reserved.
AND
METHODS
Cell Culture
Rapidly proliferating subclones of A6 somatic cells (ATCC, CCL 102) were selected by repeated passage at 1% confluence in 66% Leibovitz’s L-15 media (GIBCO) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (GIBCO), 100 U/ml penicillin G and 100 pg/ml streptomycin at 25°C. Whole Cell Preparation
from Egys and Oocytes
X laevis egg extracts were method of Lohka and Masui gonadotropin (Sigma) (1000 dorsal lymph sac of 10 female
has been addressed
0012-1606/92 $5.00 Copyright All rights
MATERIALS
150
prepared according to the (1983). Human chorionic U) was injected into the X Zaevis. Eggs laid over a
M
I 1234567
69
FIG. 1. I,( r,itvo transcription of theXerro?,z~s hsp 70 and human cytomcgalovirus promoters with Xww~us A6 somatic cell nuclear extracts. (A) 0.5 pg of pXL1OXP was incubated with 40 ~g of A6 nuclear extract for 1 hr at 25°C in the absence (lane 8) or presence (lane 9) of 4 &ml tu-amanitin. RNAs synthesized were annealed with 50 fmole of “2P-lat~eled primer (200K cpm) (see Materials and Methods). Controls include primer extension analyses of RNA isolated from immature XCWJ~~~~.S oocytes, A6 somatic cells, and heat-shocked A6 somatic cells (31°C for 3 hr, see Wolfre et crl.. 1984). The sequence analysis indicates that the correct start site of transcription was utilized in vitw (Bienz, 1983a). (8) A similar protocol was used to examine the start site of transcription at the CMT: promoter. 0.5 fig of hCMVCAT was incuhated with 40 pg of A6 and Drosoph i2u nuclear extracts as indicated for 1 hr. The sequence of hCMVCAT indicates the complimentary sequence of the RNA start site (A/+lGTCTAG). ilrrows mark the correctly initiated transcripts.
12-hr period were collected and dejellied in 2% cysteine, 20%] MBS (18 mMNaC1,0.2 mMKC1,0.5 mMNaHCO,, 2 mM Hepes-NaOH, pH 7.5, 0.15 mM MgCl,, 0.05 mM Ca(NO,),, 0.1 mM CaCl,). After washing three times in 20% MBS, followed by washing twice in egg extract buffer (50 mM Hepes-KOH, pH 7.4,50 mM KCl, 2.5 mM MgCl,, 2 mM 2-mercaptoethanol, 1 mM PMSF, 2 pg/ml leupeptin), the eggs were crushed by centrifugation at 9OOOgfor 15 min at 4°C. The light and heavy ooplasmic fractions, above the yolk pellet and below the lipid pellicle, were combined and further fractionated by ammonium sulfate precipitation. Ooplasmic fractions were diluted with 4 vol of precipitation buffer (15 mM HepesKOH, pH 7.6,110 mM KCl, 3 mM MgCl,, 0.1 rnM EDTA, 1 mM DTT, 1 mM PMSF, 10 pg/ml leupeptin). Ammonium sulfate (4 M, pH 7.6) was added to a final concentration of 0.36 M and the solution gently mixed for 30 min. The extract was clarified by centrifugation at 35,000 rpm in a Beckman ‘70 Ti rotor (84,OOOg). After removal of material floating on the supernatant sur-
face, the supernatant was collected by decantation and precipitated through the stepwise addition of 0.3 g of solid ammonium sulfate per milliliter of supernatant. After stirring for 15 min, the precipitate was collected by centrifugation at 15,000 rpm for 15 min in a SS-34 rotor (2’7,OOOg).The pellet was gently resuspended with a glass rod in an equal volume of HEMG (PK) buffer (25 mMHepes-KOH, pH 7.6,12.5 mMMgCl,, 1 mMDTT, 0.1 mM EDTA, 1 mM PMSF, 10 pg/ml leupeptin, lo%, glycerol). The suspension was dialyzed for 4-8 hr against two changes of 1 litre of HEMG O.lK (HEMG containing 0.1 M KCl). The lysate was centrifuged at 10,OOOyfor 10 min and the supernatant was quickly frozen in small aliquots in a dry ice-methanol bath and stored at -80°C. X laevis oocyte extracts mere prepared from mature ovaries by mincing the tissue and digesting follicle cells away from the oocyte for 2 hr at 25°C using 1 mg/ml collagenase (Sigma) in OR2 media (82.5 mM NaCl, 2.5 mM KCl, 1 mM CaCl,, 1 m&f MgCl,, 1 mM NaHCO,, 5 mM Hepes-NaOH, pH 7.8). Small oocytes and follicle cells were separated away from the mature oocytes. These mature oocytes were thoroughly washed three times in 20% MBS and twice in egg extract buffer. Oocytes were then crushed by centrifugation at 150,OOOn for 1 hr at 4°C and processed as described for the preparation of the egg extract.
The rapidly proliferating A6 cells (AGMR) were grown in 66% L15 plus 10% FBS to a cell density of 107/ml. The method of Manley et al. (1983) was used to prepare whole cell extracts with some minor modifications. Cells were washed thoroughly in ice-cold 66% phosphate-buffered saline (PBS) and the cell pellet was resuspended in four packed-cell volumes of 10 mMTrisHCl, pH 7.9,l mIIEDTA, 5 mMDTT, 1 mMPMSF, and 1 pg/ml leupeptin on ice. After a 20-min incubation on ice, the cells were lyzed by homogenization in a Douncc homogenizer with the “B” pestle. Four packed-cell volumes of 50 mM Tris-HCl, pH 7.9, 10 mM MgCl,, 2 mM DTT, 1 mM PMSF, 1 pg/ml leupeptin, 25% sucrose, and 50% glycerol were then added to the suspension and the mixture was stirred gently for 5 min. One packed-cell volume of saturated ammonium sulfate was then added dropwise to this mixture, followed by gentle stirring for 20 min. The cell lysate was then centrifuged at 50,000 rpm for 3 hr in a Beckman 70 Ti rotor (170,000.@ to remove insoluble debris and nucleic acid. Solid ammonium sulfate was added (0.33 g/ml supernatant) and the suspension stirred for an additional 30 min. The precipitate was collected by centrifugation at 15,000!~for 20 min and
152
DEVELOPMENTAL BIOLOGY
Oocyte
A6 Whole Cell Extract
Egg Extract
Extract
I
I
I
VOLUME 153,1992
A6 Nuclear Extract
Drosophila Extract
I
FIG. 2. Selectivity in promoter utilization in transcription extracts prepared from Xcr~opus cells at distinct developmental stages. 0.2 pmole each of hCMVCAT (CMV), pCAT control (SV40), pBLCAT2 (HSV tk), and pXLlOXP (hsp 70) were incubated with 40 pg of each extract under standard conditions for 1 hr. RNAs were annealed with 50 fmoles of each primer (200K cpm) and reverse transcribed (see Materials and Methods). The arrows indicate the position of the major transcripts.
resuspended with * the volume of the initial supernatant volume of HEMG (-K) buffer. This suspension was then dialyzed for 4-8 hr against two changes of 1 litre of HEMG O.lK. The lysate was centrifuged at 10,OOOg for 10 min and the supernant was frozen in small aliquots in a dry ice-methanol bath and stored at -80°C. The method of Soeller et al. (1988) was used to prepare nuclear extracts from AGMR cells. The washed cells were suspended in 4 ml/g (of cells) in buffer A (0.35 M sucrose, 15 mlM Hepes-KOH, pH 7.6,lO mM KCl, 5 mM MgCl,, 0.1 mM EDTA, 0.5 mMEGTA, 1 mMDTT, 1 mM PMSF, 1 pg/ml leupeptin, 0.1% Triton X-100) and were
A
B HSV lk
IISP10 HS
0
t
Nt Il.5
WC 0 0 t NE WC D
HS 0
t WCNt HS D 0 t WCNE 0
FIG. 3. Selectivity in promoter utilization is dependent upon temperature and transcription extract. Transcription reactions were established such that approximately equal transcription of the hsp 70 and HSV tk promoters occurred. Oocyte (0), egg (E), A6 somatic cell nuclear extracts from normal (NE) cells or cells heat shocked at 31°C for 3 hr (HS), A6 somatic cell whole cell extracts (WC), and Drosophila nuclear extracts (D) were used. Transcription temperature was 25” or 31°C (HS). Samples were processed as described. (A) RNA synthesis using the hsp ‘70 promoter. (B) RNA synthesis using the HSV tk promoter. Arrows indicate correctly initiated transcripts.
homogenized in a Dounce homogenizer with the “B” pestle. The homogenate was passed through three layers of cheese cloth to eliminate intact cells and then centrifuged at 4000 rpm in a Sorvall SS-34 rotor for 10 min. The pellets of nuclei were resuspended gently in buffer A (2 ml/g cells) and the nuclei were layered in 6-ml aliquots over an equal volume of buffer B (0.8 M sucrose, 15 mM Hepes-KOH, pH 7.6,10 mM KCl, 5 mM MgCl,, 0.1 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, 10 pg/ml leupeptin) in 15-ml graduated polycarbonate tubes. Nuclei were pelleted by centrifugation in a Sorvall HB-4 rotor at 5000 rpm for 10 min (4000~). The nuclear pellet was resuspended in 4 vol of precipitation buffer and transferred to Beckman 70 Ti polycarbonate tubes. Ammonium sulfate (4.0 M) (pH 7.6) was added stepwise to a final concentration of 0.36 &I, and lysis of the nuclei was accomplished by gentle mixing using a rotary mixer for 30 min. The extract was then processed as described for the Xenopus egg extract, by clarification and ammonium sulfate fractionation followed by dialysis and storage at -80°C. Drosophila nuclear extract was purchased from Stratagene or Promega. In vitro Transcription
Reactions
RNA synthesized in the in vitro transcription assays was quantitated by primer extension. These assays were done in 25 ~1 final volume of a buffer consisting of 12.5 mM Hepes-KOH, pH 7.6,6.25 mM MgCl,, 50 mM KCl, 1
153
TOVODAANDWOLFFE
100
50
KCI
150
200
0
40
(mM)
80
120
DNA
(pgiml)
160
200
D.
80
60
$
100
F a 5
80
2 a
60
E
-J 0
3
6 MW,
9
12
15
(mW
z 2
40
x .z
20
8 0 0
10
20
Temperature
30
40
(“C)
FIG. 4. Optimization of transcription in the Xenopus egg extract. hCMVCAT was incubated with 40 fig of Xenopus egg extract under the conditions indicated. Unless stated otherwise 0.6 pg of template in 25 ~1 was used. (A) The effect of variation in the concentration of KCl. (B) The effect of variation in the concentration of MgCl,. (C) The effect of variation in the concentration of template. (D) Transcription of 0.6 Kg of pBLCAT (HSV tk) and pXLlOXP (hsp 70) in the egg extract at different temperatures.
mM DTT, 0.05 mM EDTA, 0.5 mM each of ATP, CTP, GTP, and UTP, 1 mM spermidine, 10 U RNase inhibitor (GIBCO/BRL), 5% glycerol, and the indicated amount of the various extracts. Transcripts were annealed with 0.05 pmole of 5’ 32Plabeled primer (2 x 105cpm) in 10 ~1 of 20 mMTris-HCl, pH 8.0,0.2 mM EDTA, 0.25 M KC1 at 65°C for 5 min and at 55°C for 20 min, before cooling to room temperature. The annealed primer was elongated using 2 U of avian myeloblastosis virus reverse transcriptase (Promega) in 30 ~1 of 20 mM Tris-HCl, pH 8.0, 80 mM KCl, 8 mM MgCl,, 80 pg/ml of Actinomycin D (BMB), 10 mM DTT, 0.4 mM of each of four deoxynucleoside 5’ triphosphates (BMB), and 10 U of human placental RNase inhibitor (GIBCO/BRL) at 37°C for 1 hr. The reaction was stopped by the addition of 150 ~1 of ethanol. The nucleic acid was precipitated and washed in 70% ethanol, dried, and dissolved in 10 ~1 of formamide dye buffer. The solution was boiled for 2 min, chilled on ice, and then electrophoresed on a 6% polyacrylamide-urea gel.
Plasmids and Synthetic
Oligonucleotides
Transcription reactions used the plasmids hCMVCAT (cytomegalovirus (CMV) promoter and enhancer), pBLCAT2 (herpes simplex virus (HSV) thymidine kinase (tk) promoter), pXLlOXP (X Zaevis hsp 70 promoter), and pCAT control (SV40 early gene promoter and enhancer); these promoters have been described previously (Bienz, 1984a; Niller and Hennighausen, 1990; McKnight et al., 1981; Benoist and Chambon, 1981). They were the kind gifts of M. Bienz and L. Hennighausen or were purchased from BRL or Promega. Plasmid DNA was purified by cesium chloride centrifugation or by Quiagen chromatography (Diagen). The primer for reverse transcription analysis of hCMVCAT (reverse transcript length 136 nt), pBLCAT2 (128 nt), and pCAT control (186 nt) is 5’GGTGGTATATCCAGTGATTTTTTTCTCCAT, and that for pXL 1OXP (118 nt) is 5’CTCCTTACAGTTTGCTTTTCGCTAGAATA.
154
DEVELOPMENTALBIOLOGY
A.
VOLUME 1.53.1992
0.5min (sarcosyl) (sarcosyl) (1) DNA + extract
% sarcosyl
60 min
(sarcosyll (2) I + NTPs
0 time (1) -I)omoLDoLD 77NNOP4dcDc0,
B.
+ NTPs (2) 00008
Time (min) T
30 min
(3)
- extract
RNA
after NTPs (3) osggwg
C.
Time (min)
FIG. 5. The rate of initiation complex formation in the Xcnol~rs A6 somatic cell nuclear extract. (A) Sarcosyl inhibition of transcription, Transcription initiated at the hCMVCAT promoter is examined for sensitivity to different concentrations of Sarcosyl during preinitiation complex assembly (0 time (1)); after preinitiation complex assembly, but before RNA polymerase II has initiated transcription (+NTPs (2)); or after RNA polymerase II has initiated transcription (after NTPs (3)). (B and C) Rate of initiation complex formation on the hCMVCAT promoter was assayed by incubating the template in the A6 somatic cell nuclear extract for the times indicated before the addition of 0.1%) Sarcosyl. A single round of transcription occurs from completely assembled initiation complexes. This is assayed by primer extension (B) and is quantitated in (C). Arrows indicate correctly initiated transcripts.
Immunoblotting was by established procedures (Andrews and Brown, 1987) using commercially available monoclonal antibodies to the large subunit of RNA polymerase II (IBL Research Products, ARNA-3) or rabbit polyclonal antibodies to histone Hl (Wolffe, 1989). RESULTS
Spec(fic Initiatioyl Polymerase II
AND
DISCIJSSION
qf Transcription
bg RNA
We used the Xenopus heat-shock protein (hsp) 70 and the human CMV promoters (Bienz, 1984a; Niller and
Hennighausen, 1990) to assess the accuracy of transcription initiation by RNA polymerase II in the A6 somatic cell nuclear extract (Fig. 1). The hsp 70 promoter initiates transcription in vitro at the identical site to that seen i?l viva (Fig. lA, compare lanes 3 and 8); transcription is also sensitive to low concentrations of Namanitin (4 cc.g/ml) (Fig. lA, compare lanes 8 and 9). Accurate initiation of transcription in the nuclear extract is also seen on the CMV promoter (Fig. 1B). We compared the accuracy and efficiency of transcription of these two promoters together with the SV40 early promoter and the HSV tk promoter in the A6 nuclear extract, in the A6 whole cell extract, and in the oocyte and egg extracts (Fig. 2). A commercially avail-
TOYODA AND WOLFFE
Xwloplr,s RNA Po/!/,,rcYYl.srII
A II Ill IV V E A6 2C B c N
B OEWCNED
A6
FIG. 6. RNA polymerase II in the Xwwpvs extracts and duringX(Jjco1,~s development. (A) Immunoblotting analysis of RNA polymerasc II using monoclonal antibodies (IBL Research Products, ARNA-3. 10 pg protein (oocytes (stages II-V) or eggs (El after yolk removal, or 5 X 10” A6 cells (A6l) or 40 Jungprotein from two cell (2C), blastula (B), gastrula (G), or neurula (N) is resolved on a 613%’ gradient SDS-PAGE gel before transfer to nitrocellulose and immunoblotting. The positions of nonphosphorylated (II,) and phosphorglated (II,) forms of RNA polymerase II large subunit are indicated. (B) Immunoblotting analysis of RNA polymerase II in oocyte (01, egg (El, A6 somatic cell whole cell (WC) nuclear (NE), and Lkoso$~i/o extract. RNA polymerase II quantity is 2 x lo” A6 cell equivalents (40 pg protein in each lane). The positions of nonphosphorylated (II,) and phosphorylated (II,,) forms of RNA polymerase II large subunit are indicated.
able Lkosoplrilu extract was used as a control for RNA polymerase II activity. The primer extension results shown in Fig. 2 indicate that correctly initiated transcripts form a large component of total transcription from the CMV, HSV tk and hsp 70 promoters (arrows). Interestingly transcriptional efficiency varies among the four promoters and is dependent on the extract. For example, the CMV and SV40 promoters are very weak in oocyte and egg extracts, whereas they are relatively strong in the A6 somatic cell nuclear extract. Conversely the HSV tk and hsp 70 promoters are strong in oocyte and egg extracts, but relatively weak in the nuclear extract. It is important to note that absolute values should not be compared between different extracts, only the relative transcriptional efficiency of the promoters in the same extract. The differences between the individual promoters in transcriptional efficiency may be attributed to variation in the abundance or activity of the transcription factors that must associate with the individual promoters before they can be recognized by RNA polymerase II. Such variation between the extracts may be developmentally important (for example, Winning et t/l., 1991). The transcriptional regulation of the X~YLO~ZLS hsp 70 promoter during X~no~s development has been investigated in some detail (Bienz, 1984a,b; Ovsenek ef trl., 1990; Ovsenek and Heikkila, 1990). Oocytes appear to
155
synthesize and store the heat-shock transcription factor in a cryptic form that can be activated by heat shock (Ovsenek and Heikkila, 1990). Although hsp 70 is constitutively active in oocytes, transcriptional induction in response to heat shock still occurs (Bienz and Pelham, 1982). We determined that the transcription extracts prepared from oocytes and eggs retained the capacity to respond to heat shock dn c!itro (Fig. 3). In this experiment, template concentration and extract volume have been adjusted to allow approximately equal rates of transcription initiation in the different extracts at 20°C (Fig. 3A). Raising the temperature of incubation of the transcription reaction to 31°C leads to dramatic changes in relative transcriptional efficiency. The rate of transcription initiation at the hsp 70 promoter is significantly increased at 31°C for the oocyte and egg extracts, whereas transcription initiation in the other extracts does not change. Control experiments reveal that transcription initiated at the HSV tk promoter in the oocyte, egg, and Drosoph ikx extracts does not undergo a major change following the increase in temperature to 31°C; however, transcription in the somatic cell extracts significantly declines. Prior heat shock of the A6 somatic cells before preparation of the nuclear transcription extract does not provide any advantage for hsp 70 transcription or disadvantage for HSV tk transcription (Fig. 3A, HS lanes). This indicates that the effect of heat shock is rapidly reversible i?/ ?J~UO.The effect of transient temperature elevation on transcription an clitrn is also reversible (data not shown).
We examined in detail the optimal ionic conditions, DNA concentration, and incubation temperature for transcriptional activity in the extracts. Data are shown only for the egg extract (Fig. 4). Optimal rates of transcription initiation occurred at 100 mM KC1 (Fig. 4A) and 12 mM M&l, (Fig. 4B). These compare favorably with those previously described for transcription by RNA polymerase II in mammalian extracts (Weil ef al., 1979; Manley cutrrl., 1983). Specific transcription initiation occurred most often when the DNA concentration was 60-100 &ml (Fig. 4C). Similar results were obtained with the other four extracts. As previously noted, specific initiation varied with temperature in a promoter- and extract-specific manner (Fig. 3). Optimal transcription of the HSV tk promoter in the egg extract occurs at 25°C whereas for the hsp 70 promoter 31-34°C was optimal (Fig. 4D). WC also examined the rate of initiation complex formation in the X
