Characterization of Rough and Smooth Morphotypes of Mycobacterium abscessus Isolates from Clinical Specimens Kai Rüger, Annegret Hampel, Sandra Billig, Nadine Rücker, Sebastian Suerbaum, Franz-Christoph Bange ‹Department of Medical Microbiology and Hospital Epidemiology, Hannover Medical School, Hanover, Germany
T
he genus Mycobacterium contains more than 100 different species which belong either to the Mycobacterium tuberculosis complex or to the large group of nontuberculous mycobacteria (NTMs). M. abscessus is an NTM, and clinical studies have begun to shed light on its epidemiology. M. abscessus is involved in soft tissue infections and is a dominant respiratory pathogen in patients with cystic fibrosis (CF). It is the second-most-common NTM species isolated from CF patients in the United States and the most common NTM species isolated from CF patients in Europe (1–6). Fatal infections with M. abscessus have been reported, especially after lung transplantation (7). M. abscessus has been subdivided in type I and type II, which, together with Mycobacterium chelonae, share identical 16S rRNA genes but show differences within the hsp65 gene (8, 9). Based on multilocus sequence analysis of hsp65, rpoB, secA, and the 16S-23S internal transcribed spacer (ITS) region, M. abscessus was further subdivided into three species, M. abscessus (sensu stricto), M. bolletii, and M. massiliense (10, 11). Recently, uniting M. bolletii and M. massiliense as M. abscessus subspecies bolletii (the former type II) and separating that subspecies from M. abscessus subspecies abscessus (the former type I) have been proposed (12). M. abscessus colonies on agar plates grow with either a rough or a smooth morphology (13, 14). M. abscessus can show cord formation when visualized microscopically (15). Production of a glycopeptidolipid (GPL) masks the cord-forming structures of the mycobacterial cell wall. Macroscopically, cord-forming M. abscessus grows with the rough morphotype, and non-cord-forming, GPL-producing M. abscessus grows with the smooth morphotype (14). The presence of GPL is associated with lesser virulence. A rough clinical isolate persisted in the lungs of experimentally infected mice and disseminated into the spleen, whereas a smooth isolate was cleared from the lungs within 3 weeks (16). An isogenic mutant of M. abscessus that lacked GPL production lost biofilm formation but gained the ability to replicate inside macrophages, stimulate Toll-like receptor 2, and induce cytokine production
(17, 18). It has also been suggested that the rough morphotype is more virulent in humans (19). In a previous study looking at the epidemiology of M. abscessus, isolates of 12 rough morphotypes but only 1 smooth morphotype were collected from the respiratory tract of CF patients (13). At present, it is not known whether clinical isolates of smooth and rough morphotypes of M. abscessus differ in antimicrobial susceptibility. Macrolides such as clarithromycin are first-line antibiotics for treatment of pulmonary disease caused by M. abscessus subspecies bolletii. Due to the presence of the inducible methylase Erm(41) which confers macrolide resistance in M. abscessus subspecies abscessus, rates of response to clarithromycin are lower for this subspecies (20–22). Amikacin and cefoxitin are the two other first-line antibiotics for the treatment of M. abscessus (23). M. abscessus is generally resistant to fluoroquinolones, doxycycline, and minocycline. A newer tetracycline, tigecycline, has shown in vitro activity against M. abscessus (24, 25), but its role in treatment of disease has yet to be established. In this study, we compared the proportions of the occurrence of rough and smooth morphotypes of M. abscessus isolated from the respiratory tract of 34 patients, 28 of whom had cystic fibrosis, and analyzed the patterns of susceptibility to clarithromycin, amikacin, cefoxitin, and tigecycline of the two morphotypes.
244
p. 244 –250
jcm.asm.org
Journal of Clinical Microbiology
Received 15 May 2013 Returned for modification 28 June 2013 Accepted 29 October 2013 Published ahead of print 6 November 2013 Editor: S. A. Moser Address correspondence to Franz-Christoph Bange, [email protected]. K.R. and A.H. contributed equally to this article. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JCM.01249-13
January 2014 Volume 52 Number 1
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
Mycobacterium abscessus, which consists of the two subspecies M. abscessus subspecies abscessus and M. abscessus subspecies bolletii, can produce rough or smooth colony morphologies. Here we analyzed 50 M. abscessus isolates cultured from the respiratory specimens of 34 patients, 28 (82%) of whom had cystic fibrosis (CF), with respect to their colony morphologies and antibiotic susceptibilities. The overall proportions of occurrences of the two morphotypes were similar, with specimens from 50% of the patients showing a rough and 38% showing a smooth morphotype. A total of 12% of the specimens from the patients showed both morphotypes simultaneously. At the subspecies level, the proportions of rough and smooth morphotypes differed substantially; 88% of rough morphotypes belonged to M. abscessus subspecies abscessus, and 85% of smooth morphotypes belonged M. abscessus subspecies bolletii. Inducible clarithromycin resistance due to the Erm(41) methylase, as well as high-level resistance to clarithromycin due to mutations within the rrl gene, occurred independently of the morphotype. The MIC50s of amikacin and cefoxitin were identical for the two morphotypes, whereas the MIC50s of tigecycline were 0.25 g/ml for the rough morphotype and 2.0 g/ml for the smooth morphotype. Our results show that the smooth morphotype was more dominant in respiratory specimens from CF patients than previously thought. With respect to resistance, colony morphology did not affect the susceptibility of Mycobacterium abscessus to the first-line antibiotics clarithromycin, amikacin, and cefoxitin.
Mycobacterium abscessus, Rough and Smooth Morphotypes
MATERIALS AND METHODS
January 2014 Volume 52 Number 1
room temperature, lysozyme overnight at 37°C, and proteinase K and SDS for 20 h at 55°C (13). For DNA digestion, we used XbaI. Digestion was performed for approximately 18 h at 37°C. Our protocol consisted of an initial time of 3 s, a final time of 12 s, a run time of 20 h, a temperature of 14°C, voltage at 200 V, an agarose concentration of 1%, and a buffer of 0.5⫻ Tris-borate-EDTA (TBE). Staining was done with ethidium bromide. DNA sequencing of msp1. Analysis of msp1 was done as previously described (28). Briefly, the 5= part of the msp1 gene containing a potential CG insertion was amplified. A 5-l volume of the purified chromosomal DNA of both morphotypes from patients P2, P17, P31, and P37 was added as a template to a reaction mix containing 20 mM Tris-HCl (pH 8), 50 mM KCl, 1.5 mM MgCl2, 250 M deoxynucleoside triphosphate (dNTPs), 10 pmol of primers 767 (5=_AAAAGGCGACGGATATTCAA_3=) and 768 (5=_GAGTATCGGCGAATCCGTAA_3=), and 2.5 U Taq DNA polymerase (Invitrogen/Life Technologies). A total of 35 PCR cycles were performed under the following conditions: 95°C for 1 min, 52°C for 30 s, and 68°C for 1 min. The purified PCR fragments had a length of about 450 bp, and their nucleotide sequences were analyzed by using a ABI Prism BigDye Terminator cycle sequencing v1.1 ready-reaction kit (Applied Biosystems, Austin, TX) and the 767 primer. Stability testing of the morphotypes. The original samples collected from patients P2, P17, P31, and P37 were plated on 7H11 agar plates, and single colonies presenting the smooth and rough morphotypes were isolated and subcultured as the next generation on 7H11 agar plates. The subculture of each morphotype was repeated for 12 generations. In addition, frozen stocks of the stabilized morphotypes from patients P2, P17, P31, and P37 were thawed and plated on 7H11 agar plates. The stocks were afterward refrozen at ⫺20°C. The procedure was repeated for 12 cycles, and the morphotypes were checked for stability.
RESULTS
Detection of rough and smooth morphotypes in clinical specimens. Fig. 1 shows the appearance of rough and smooth morphotypes of M. abscessus. When we recultured frozen stocks from 34 patients, 28 of whom had CF, the specimens from 30 patients had either the rough or the smooth morphotype. Of these, 17 (50%) had a rough morphotype, and 13 (38.2%) had a smooth morphotype. Of the specimens from the 28 CF patients, 14 (50%) showed a rough morphotype, and 13 (46.4%) a smooth morphotype. For four patients (P2, P17, P31, and P37), the cultures from the frozen stocks produced rough and smooth colonies simultaneously (Fig. 2). From each patient culture, we took a smooth and a rough colony and generated 12 sequential subcultures on 7H11 agar plates. Rough and smooth morphotypes of colonies from two patients (P2 and P17) were stable on the first subculture, from one patient (P37) on the second subculture, and from one patient (P31) on the eighth subculture. Using pulsed-field gel electrophoresis, we found that the rough and smooth morphotypes were indistinguishable in the colonies from each of the four patients (Fig. 2). We subjected a stable rough subculture and smooth subculture from each of the four patients to 12 subsequent freeze/ thaw cycles and found that colony morphology did not change. The majority of rough morphotypes belonged to M. abscessus subspecies abscessus, and the majority of smooth morphotypes belonged to M. abscessus subspecies bolletii (Table 1). From 12 of the 34 patients, a second isolate was available. The range of time lapses between the times of collection of the first and second isolates was 1.3 to 9.4 years. The morphologies of the first and second isolates were identical in 11 patients. One patient showed both morphotypes in his first specimen. The second specimen from the same patient showed only the rough morphotype. Pulsed-field gel elec-
jcm.asm.org 245
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
Strains and cultures. We searched the Laboratory Information System of the Department of Medical Microbiology and Hospital Epidemiology of the Hannover Medical School for patients from whose respiratory tract M. abscessus was cultured between January 2000 and December 2011. Isolates were then recultured from frozen stocks on 7H11 agar at 37°C for 7 days, and colony morphology was determined. For the patients with two or more isolates, the last available isolate was included in this study, when cultured at least 1 year after the first isolate, and was termed the “second” isolate. Colonies from plates were used directly for inoculation of Rapmyco Sensititre 96-well plates (susceptibility testing) and for pulsed-field gel electrophoresis. For all DNA-sequencing procedures, colonies were subcultured in 7H9 liquid medium, and genomic DNA was extracted. Isolation and identification of M. abscessus from patient samples. All specimens were processed in the MGIT culture system (Becton, Dickinson). In our laboratory, cultures that grow acid-fast bacilli are initially subjected to 16S rRNA gene sequencing. Those identified as belonging to the M. chelonae/M. abscessus complex are subsequently analyzed by the use of a LightCycler targeting the hsp65 gene that allows differentiation of M. chelonae, M. abscessus subspecies abscessus (type I), and M. abscessus subspecies bolletii (type II) as described previously (9). Phenotypic resistance. A total of 50 isolates of M. abscessus from 34 patients (30 first isolates from 30 patients that had only one of the two morphotypes, 8 first isolates from 4 patients that had rough and smooth morphotypes simultaneously, and 12 second isolates) were tested. Overall, we tested 29 rough and 21 smooth isolates. Phenotypic resistance was tested with Rapmyco Sensititre 96-well plates (Trek Diagnostic Systems), as recommended by the manufacturer. Briefly, bacterial colonies were harvested and diluted in water to McFarland standard 0.5. A 50-l volume of the solution was transferred into cation-adjusted Mueller-Hinton broth, and finally, 100 l of the bacterial colony/Mueller-Hinton broth suspension was transferred into each well of the Rapmyco Sensititre 96well plates. Plates were incubated at 30°C and manually assessed on days 5 and 14. For quality control, we used Staphylococcus aureus ATCC 29213. Genotypic analysis of erm(41), rrl, and rrs. PCR was done with a TProfessional Thermocycler (Biometra) using Taq polymerase (New England BioLabs) in a 25-l assay. The erm(41) gene was amplified with forward primer erm41KRforward_#615 (5=_AAGATGCACACCGTGCA GATG_3=) and reverse primer erm41KRreverse_#616 (5=_ACATCGCTG TCCACGATGAAAG_3=) at 65°C annealing temperature, resulting in a 934-bp or 658-bp fragment. Fragment size was analyzed on an agarose gel. Subsequent sequencing was done using the forward primer. The rrl gene was amplified with forward primer 18 (5=_AGTCGGGACCTAAGGCGA G_3=) and reverse primer 21 (5=_TTCCCGCTTAGATGCTTTCAG_3=) as published by Meier et al. with an annealing temperature of 62°C, resulting in a 1,525-bp fragment, and subsequent sequencing was done using primer 19 (5=_GTAGCGAAATTCCTTGTCGG_3=) (26). The rrs gene was amplified using forward primer 283 (5=_GAGTTTGATCCTGGCTC AGGA_3=) and reverse primer 261 (5=_AAGGAGGTGATCCAGCCGCA_3=) as published by Prammananan et al. with an annealing temperature of 65°C, resulting in a fragment of 1,507 bp, and subsequent sequencing was done using primer 289 (5=_AAGTCGGGAGTCGCTAGTAAT_3=) (27). Amplification of erm(41), rrl, and rrs was done in 35 cycles with 30 s of denaturation at 96°C and 60 s of elongation at 68°C, including a final elongation step for 5 min. Pulsed-field gel electrophoresis. Bacterial colonies were harvested from 7H11 agar, dissolved in 5 ml 7H9, and cultured for 72 h and 37°C. A lysis solution (400 l) containing 0.2 M glycine, 60 g/ml D-cycloserine, 20 mM lithium chloride, 200 mg/ml lysozyme, and 5 mM EDTA was added and incubated for 16 h at 37°C. Cells were harvested by centrifugation at 3,000 ⫻ g for 15 min and resuspended in TS buffer (50 mM Tris, 0.5 M sucrose, pH 7.6), and aliquots of 250 l were frozen at ⫺20°C. The aliquots were thawed at room temperature and heated to 75°C for 20 min. Lysed cells (200 l) were cast into a gel block using 2% low-melting-point agarose. Cell lysis was performed by adding lysostaphin for 15 min at
Rüger et al.
nies.
trophoresis revealed clonal identity of the first and second isolates for each of the 12 patients. In a recent publication, the genomes and transcriptomes of smooth and rough variants of three M. abscessus strains (two laboratory strains and one clinical strain from a patient with cystic fibrosis) were compared (28). The switch from a smooth to a rough morphotype of M. abscessus was associated with the downregulation of the msp1-msp2-gap operon in all three rough variants. This operon encodes two nonribosomal peptide synthases and a glycopetide transport gene. The genome of one rough variant revealed a CG insertion within the 5= part of the msp1, which caused a frameshift, leading to transcriptional arrest of the msp1msp2-gap operon (28). We compared the 5= parts of msp1 from the 4 rough and 4 smooth strains that we obtained from the four patients with the mixed morphotypes (P2, P17, P31, and P37; see also Fig. 2). None of the rough strains carried the CG insertion in the 5= part of msp1, indicating that, at least in these 4 isogenic smooth/rough pairs, the morphotypic switch was not caused by the CG insertion within the msp1 gene. MICs of clarithromycin in smooth and rough morphotypes. We tested 50 isolates (29 rough and 21 smooth) from 34 patients. A suspension of bacteria grown on agar plates was inoculated into 96 wells, and the MICs for clarithromycin were read on days 5 and 14. The rough and smooth isolates had a MIC50 of 0.5 g/ml on day 5. By day 14, the rough isolates had a MIC50 of ⬎16 g/ml, whereas smooth isolates had a MIC50 of 1 g/ml, indicating the presence of inducible clarithromycin resistance in rough isolates. Stratification of rough and smooth morphotypes to the subspecies level showed that the inducible clarithromycin resistance occurred more frequently in M. abscessus subspecies abscessus than in M. abscessus subspecies bolleti. By day 14, both the rough and smooth morphotypes of M. abscessus subspecies abscessus had a MIC50 of ⬎16 g/ml, whereas rough morphotypes of M. abscessus subspecies bolletii had a MIC50 of 2 g/ml and smooth morphotypes had a MIC50 of 1 g/ml. Noninducible, high-level resistance to clarithromycin, which was defined as a MIC ⬎ 16 g/ml on day 5, was detected in 9 of 50 isolates, 5 with a rough and 4 with a smooth morphotype. In all 50 isolates, we sequenced the erm(41) gene, which encodes a methylase that mediates inducible clari-
246
jcm.asm.org
thromycin resistance in M. abscessus (20). A total of 69% of the rough isolates and 19% of the smooth isolates had the wild-type allele (Table 2). A total of 31% of the rough morphotypes and 81% of the smooth morphotypes had either a 276-bp deletion or a single nucleotide polymorphism at position 28 (T¡C) of erm(41) (Table 2). Both mutations lead to the loss of the inducible clarithromycin resistance (20, 21). Bastian and colleagues showed that the T¡C mutation within the erm(41) gene occurs only in M. abscessus subspecies abscessus and that the 276-bp deletion occurs only in M. abscessus subspecies bolletii (21). They also found that 77% of M. abscessus subspecies abscessus isolates and 41% of M. abscessus subspecies bolletii isolates had the wild-type erm(41) gene. Thus, we stratified the genotypic analysis of the erm(41) gene of the 50 clinical isolates from this study according to the two subspecies of M. abscessus. A total of 75% of M. abscessus subspecies abscessus isolates and 13.6% of M. abscessus subspecies bolletii isolates carried the wildtype erm(41) gene (Table 3). The 276-bp deletion was exclusively present in M. abscessus subspecies bolletii, whereas the T¡C mutation was exclusively present in M. abscessus subspecies abscessus (Table 3). Mutations at positions 2058 and 2059 of the rrl gene, which causes high-level resistance to clarithromycin (29), were present in all 9 strains with an antibiotic MIC ⬎ 16 g/ml on day 5 (Table 2). Of these 9 isolates, those from four patients (P2, P3, P6, and P14) were second isolates; three of those four patients (P2, P3, and P14) had a corresponding first isolate without high-level clarithromycin resistance (Table 4), suggesting development of highlevel resistance to clarithromycin in vivo. Interestingly, 2 of the 9 strains with high-level resistance had a functional erm(41) gene, showing the presence of both inducible and high-level resistance to clarithromycin. MICs of amikacin in smooth and rough morphotypes. In M. abscessus, the MIC50 of amikacin was 16 g/ml and did not differ between the rough and smooth morphotypes. Of 50 isolates, 8 (4 with a rough morphotype and 4 with a smooth morphotype) showed high-level resistance to amikacin, as defined by a MIC ⱖ 64 g/ml. Of the 8 isolates, 4 (those from patients P2, P3, P4, and P6) were second isolates; three of those four patients (P2, P3, and
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
FIG 1 Growth characteristics of rough and smooth phenotypes on 7H11 agar cultured at 37°C: representative single rough (left) and smooth (right) colo-
Mycobacterium abscessus, Rough and Smooth Morphotypes
TABLE 1 Colony morphologies of M. abscessus subspecies abscessus and M. abscessus subspecies bolletii from 34 patientsa No. (%) of first isolates from patients (n ⫽ 34) with M. abscessus Colony morphology
M. abscessus subsp. abscessus
M. abscessus subsp. bolletii
Total
Rough Smooth Mixed
15 (88.2) 2 (15.4) 2 (50)
2 (11.8) 11 (84.6) 2 (50)
17 (100) 13 (100) 4 (100)
a Strains were cultured on 7H11 agar to evaluate culture morphology; differentiation of subspecies was done by LightCycler-based analysis of the hsp65 gene.
January 2014 Volume 52 Number 1
P4) had a corresponding first isolate without high-level aminoglycoside resistance (Table 3), suggesting development of high-level resistance to aminoglycoside in vivo. A total of 7 strains with an antibiotic MIC ⱖ 64 g/ml had a single nucleotide polymorphism at position 1408 (A¡G) of the rrs gene, which had been shown to mediate high-level aminoglycoside resistance in M. abscessus (27). MICs of cefoxitin, doxycycline, minocycline, and tigecycline. Besides clarithromycin and amikacin, cefoxitin is frequently used for treatment of M. abscessus infection. For cefoxitin, we found a MIC50 of 64 g/ml and a MIC90 of 128 g/ml that did not differ between the rough and smooth morphotypes of M. abscessus. We also tested tetracyclines such as doxycycline, minocycline, and tigecycline. Doxycycline and minocycline had a MIC50 and MIC90
jcm.asm.org 247
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
FIG 2 Colony morphology of the primary subculture and results of pulsed-field gel electrophoresis of rough and smooth strains from the four patients (P2, P17, P31, and P37) that produced a mixed phenotype. Subcultures from primary specimens that had been kept as frozen stocks were recultured on 7H11 agar at 37°C, and photos were taken. Two patients (P2 and P17) had predominantly rough morphotypes, and two patients (P31 and P37) had predominantly smooth morphotypes. From each patient, one smooth colony and one rough colony were subcultured until the morphotypes remained stable before genomic DNA was prepared, XbaI digested, and separated by pulsed-field gel electrophoresis. The gel photo shows a comparison of the smooth (s) and rough (r) morphotypes from each of the four patients (P2, P17, P31, and P37). M, molecular marker; ATCC, M. abscessus ATCC 19977 type strain.
Rüger et al.
TABLE 2 Sequence analysis of the erm(41) and rrl genes of 29 rough and 21 smooth isolates No. (%) of M. abscessus isolates (n ⫽ 50) erm(41)
rrl
Wild type
276-bp deletion
Rough Smooth
20 (69) 4 (19)
4 (13.7) 15 (71.4)
Total
5 (17.3) 2 (9.6)
29 (100) 21 (100)
above 8 g/ml both in rough and in smooth morphotypes. In contrast, MICs were lower for tigecycline and differed between the rough isolates, which had a tigecycline MIC50 of 0.25 g/ml and a MIC90 of 1 g/ml, and the smooth isolates, which had a tigecycline MIC50 of 2 g/ml and a MIC90 ⬎ 4 g/ml. DISCUSSION
In this study, we investigated the prevalences and antibiotic susceptibilities of rough and smooth morphotypes in respiratory specimens from 34 patients, most of whom had cystic fibrosis. Even though isolates with rough morphotypes occurred more frequently than those with smooth morphotypes (50% versus 38%), our results show that the rough morphotype was less dominant in respiratory specimens from CF patients than previously thought. The proportions found in a study in South Korea were 61% for rough and 28% for smooth morphotypes (30). A study in Sweden found 12 rough isolates but only 1 smooth isolate in the respiratory tract of CF patients (13). Looking at the subspecies level, the proportions of smooth morphotypes in this present study were low (15%) in M. abscessus subspecies abscessus and high (85%) in M. abscessus subspecies bolletii. This differs from the proportions found in the South Korea population, where the prevalences of smooth morphotypes were low (27% and 28%) for both subspecies (30). Even though the population sizes studied so far are still small, there appears to be no clear dominance of either morphotype in a given population or between the two subspecies. Together, these findings suggest that the distribution of M. abscessus subspecies with rough and smooth colony morphologies within the respiratory tract of affected patients shows regional diversity and that, at least in CF patients, it is not confined to one of the two distinct subspecies of M. abscessus. In rough and smooth morphotypes, we did not find a difference in MIC50 (16 g/ml for both morphotypes) for amikacin. In patients with cystic fibrosis, mucoid morphotypes of Pseudomonas aeruginosa form biofilm and show resistance to a wide range of antibiotics (31). Initially, it was thought that the extracelluar ma-
Wild type
Mutations at positions 2058 and 2059 (AA¡AC/AG/CA/TA/GA)
Total
24 (82.7) 17 (81)
5 (17.3) 4 (19)
29 (100) 21 (100)
trix (alginate) produced by mucoid strains acts as a physical barrier to antibiotics. However, it later became evident that the broad range of antibiotic resistances of Pseudomonas aeruginosa isolates in CF patients is due to so-called hypermutators that assemble classic resistance mechanisms such as target mutations (32, 33). Nonetheless, treatment with alginate lysis of mucoid isolates of Pseudomonas aeruginosa enhances susceptibility to tobramycin, indicating that, at least for aminoglycosides, alginate acts as a physical barrier (34). Our study suggest that the glycopeptidolipid of M. abscessus has no immediate effect on the antimicrobial action of amikacin. Inducible clarithromycin resistance was higher in rough than in smooth morphotypes. Loss of inducible clarithromycin resistance is caused by a deletion or a nucleotide polymorphism within erm(41) (20, 21). The deletion is absent in M. abscessus subspecies abscessus and is frequently present in M. abscessus subspecies bolletii (21). In this study, 88% of the rough morphotypes belonged to M. abscessus subspecies abscessus and 85% of the smooth morphotypes belonged to M. abscessus subspecies bolletii. Thus, differences in the proportions of inducible clarithromycin resistance between smooth and rough isolates are the result of a higher proportion of M. abscessus subspecies abscessus among rough isolates and of M. abscessus subspecies bolletii among smooth isolates. It is noteworthy that we found 2 isolates which had a 23S rRNA mutation at positions 2058 and 2059 despite the presence of the Erm methylase. Acquisition of high-level clarithromycin resistance in the presence of the Erm methylase has been demonstrated in vivo in a recent study, and it has been suggested that a mutation at positions 2058 and 2059 of 23S rRNA provides an advantage that is independent of the presence of a functional erm(41) gene (35). In previous studies of the tetracyclines, only tigecycline had been shown to be effective against M. abscessus in vitro. Wallace and colleagues reported MICs of ⬎64 g/ml for minocycline and a MIC50 ⫽ 0.12 g/ml for tigecycline (24). Another study reported
TABLE 3 Sequence analysis of the erm(41) and rrl genes of M. abscessus subspecies abscessus and M. abscessus subspecies bolletii No. (%) of M. abscessus isolates (n ⫽ 50) erm(41)
Subspecies
Wild type
M. abscessus subsp. abscessus M. abscessus subsp. bolletii
21 (75) 3 (13.6)
248
jcm.asm.org
rrl
276-bp deletion
Single nucleotide polymorphism at position 28 (T¡C) 7 (25)
19 (86.4)
Total
Wild type
Mutations at positions 2058 and 2059 (AA¡AC/AG/CA/TA/GA)
28 (100) 22 (100)
23 (82.1) 18 (77.8)
5 (17.9) 4 (22.2)
Total 28 (100) 22 (100)
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
Colony morphology
Single nucleotide polymorphism at position 28 (T¡C)
Mycobacterium abscessus, Rough and Smooth Morphotypes
TABLE 4 MICs on day 5 for first and second isolates from 5 patients (P2, P3, P4, P6, and P14) determined using the microdilution methoda MIC (g/ml) P2 (mixed)a
P3 (smooth)
P4 (smooth)
P6 (smooth)
P14 (rough)
Antibiotic
First isolate
Second isolate
First isolate
Second isolate
First isolate
Second isolate
First isolate
Second isolate
First isolate
Second isolate
Clarithromycin Amikacin
0.25 8
⬎16 ⬎64
0.06 8
⬎16 ⬎64
0.25 4
0.25 ⬎64
⬎16 ⬎64
⬎16 ⬎64
0.5 16
⬎16 32
a
a MIC50 of 0.5 g/ml for tigecycline and a MIC50 of 32 g/ml for doxycycline (25). Our results suggest that, for further evaluations of the efficacy of tigecycline for the treatment of M. abscessus, the testing of the morphotype should be included. At present, we have no mechanistic explanation as to why tigecycline shows higher MICs in smooth than in rough morphotypes. It is unclear whether glycopeptidolipids directly interfere with the drug. In summary, we found no difference in susceptibility to the two first-line antibiotics amikacin and cefoxitin between rough and smooth morphotypes of Mycobacterium abscessus strains that were isolated from CF patients. The higher rate of inducible resistance to clarithromycin in rough morphotypes was due to a higher prevalence of Mycobacterium abscessus subspecies abscessus in this group, which carries an inducible methylase that mediates clarithromycin resistance. Therefore, with respect to decisions on antibiotic treatment, we see no immediate benefit in differentiating between the two morphotypes by the clinical laboratory. Based on this and previous work, with respect to diagnostics in clinical microbiology, we discuss the following. It might be useful to further differentiate M. abscessus strains to obtain more information about differences in epidemiology and virulence between the two subspecies. Differentiation can be achieved by analysis of hsp65 gene polymorphism (8, 9). Subspecies differentiation could also serve as a surrogate marker for inducible clarithromycin resistance. Yet it should be stressed that in strains isolated from CF patients in this study, a subgroup of M. abscessus subspecies bolletii (13.6%; see Table 2) had a functional erm(41) gene and a subgroup of M. abscessus subspecies abscessus lacked a functional erm(41) gene (25%; Table 2). Phenotypic testing for antibiotic resistance might be useful for guiding antibiotic treatment. However, except for clarithromycin resistance, the poor correlation between in vitro drug susceptibility results and clinical response to antibiotic treatment is of concern (36). Unambiguous detection of inducible clarithromycin resistance requires the sequencing of the erm(41) gene (21). The proportion of strains with high-level resistance to clarithromycin and amikacin was between 10% and 20% in this study; thus, partial sequencing of the 16S rRNA and 23S rRNA genes to detect high-level resistance to clarithromycin and amikacin should be considered based on the individual case. ACKNOWLEDGMENTS The work was supported by the Niedersächsische Verein zur Bekämpfung der Tuberkulose, Lungen- und Bronchialerkrankungen and by International Research Training Group 1273 funded by the German Research Foundation to S.B. We declare that we have no conflicts of interest.
REFERENCES 1. Bange FC, Kirschner P, Bottger EC. 1999. Recovery of mycobacteria from patients with cystic fibrosis. J. Clin. Microbiol. 37:3761–3763.
January 2014 Volume 52 Number 1
2. Bange FC, Brown BA, Smaczny C, Wallace RJ, Jr, Bottger EC. 2001. Lack of transmission of Mycobacterium abscessus among patients with cystic fibrosis attending a single clinic. Clin. Infect. Dis. 32:1648 –1650. http://dx.doi.org/10.1086/320525. 3. Bange FC, Bottger EC. 2002. Improved decontamination method for recovering mycobacteria from patients with cystic fibrosis. Eur. J. Clin. Microbiol. Infect. Dis. 21:546 –548. http://dx.doi.org/10.1007/s10096-002 -0760-y. 4. Olivier KN, Weber DJ, Wallace RJ, Jr, Faiz AR, Lee JH, Zhang Y, Brown-Elliot BA, Handler A, Wilson RW, Schechter MS, Edwards LJ, Chakraborti S, Knowles MR. 2003. Nontuberculous mycobacteria. I: multicenter prevalence study in cystic fibrosis. Am. J. Respir. Crit. Care Med. 167:828 – 834. http://dx.doi.org/10.1164/rccm.200207-678OC. 5. Girón RM, Máiz L, Barrio I, Martínez MT, Salcedo A, Prados C. 2008. Nontuberculous mycobacterial infection in patients with cystic fibrosis: a multicenter prevalence study. Arch. Bronconeumol. 44:679 – 684. (In Spanish) http://dx.doi.org/10.1016/S0300-2896(08)75777-6. 6. Roux AL, Catherinot E, Ripoll F, Soismier N, Macheras E, Ravilly S, Bellis G, Vibet MA, Le Roux E, Lemonnier L, Gutierrez C, Vincent V, Fauroux B, Rottman M, Guillemot D, Gaillard JL. 2009. Multicenter study of prevalence of nontuberculous mycobacteria in patients with cystic fibrosis in France. J. Clin. Microbiol. 47:4124 – 4128. http://dx.doi.org /10.1128/JCM.01257-09. 7. Zaidi S, Elidemir O, Heinle JS, McKenzie ED, Schecter MG, Kaplan SL, Dishop MK, Kearney DL, Mallory GB. 2009. Mycobacterium abscessus in cystic fibrosis lung transplant recipients: report of 2 cases and risk for recurrence. Transpl. Infect. Dis. 11:243–248. http://dx.doi.org/10.1111/j .1399-3062.2009.00378.x. 8. Devallois A, Goh KS, Rastogi N. 1997. Rapid identification of mycobacteria to species level by PCR-restriction fragment length polymorphism analysis of the hsp65 gene and proposition of an algorithm to differentiate 34 mycobacterial species. J. Clin. Microbiol. 35:2969 –2973. 9. Sedlacek L, Rifai M, Feldmann K, Bange FC. 2004. LightCycler-based differentiation of Mycobacterium abscessus and Mycobacterium chelonae. J. Clin. Microbiol. 42:3284 –3287. http://dx.doi.org/10.1128/JCM .42.7.3284-3287.2004. 10. Adékambi T, Reynaud-Gaubert M, Greub G, Gevaudan MJ, La Scola B, Raoult D, Drancourt M. 2004. Amoebal coculture of “Mycobacterium massiliense” sp. nov. from the sputum of a patient with hemoptoic pneumonia. J. Clin. Microbiol. 42:5493–5501. http://dx.doi.org/10.1128/JCM .42.12.5493-5501.2004. 11. Adékambi T, Berger P, Raoult D, Drancourt M. 2006. rpoB gene sequencebased characterization of emerging non-tuberculous mycobacteria with descriptions of Mycobacterium bolletii sp. nov., Mycobacterium phocaicum sp. nov. and Mycobacterium aubagnense sp. nov. Int. J. Syst. Evol. Microbiol. 56(Pt 1):133–143. http://dx.doi.org/10.1099/ijs.0.63969-0. 12. Leao SC, Tortoli E, Euzeby JP, Garcia MJ. 2011. Proposal that Mycobacterium massiliense and Mycobacterium bolletii be united and reclassified as Mycobacterium abscessus subsp. bolletii comb. nov., designation of Mycobacterium abscessus subsp. abscessus subsp. nov. and emended description of Mycobacterium abscessus. Int. J. Syst. Evol. Microbiol. 61(Pt 9):2311–2313. http://dx.doi.org/10.1099/ijs.0.023770-0. 13. Jönsson BE, Gilljam M, Lindblad A, Ridell M, Wold AE, WelinderOlsson C. 2007. Molecular epidemiology of Mycobacterium abscessus, with focus on cystic fibrosis. J. Clin. Microbiol. 45:1497–1504. http://dx .doi.org/10.1128/JCM.02592-06. 14. Howard ST, Rhoades E, Recht J, Pang X, Alsup A, Kolter R, Lyons CR, Byrd TF. 2006. Spontaneous reversion of Mycobacterium abscessus from a smooth to a rough morphotype is associated with reduced expression of
jcm.asm.org 249
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
The first specimen of patient 2 (P2) showed both morphotypes; the second specimen of patient 2 showed only rough morphotypes. MICs for clarithromycin and amikacin are shown for the rough morphotype for the first specimen. The MICs for the smooth morphotype were 0.5 g/ml for clarithromycin and 16 g/ml for amikacin.
Rüger et al.
15.
16. 17.
19.
20.
21.
22.
23.
24.
25.
250
jcm.asm.org
26.
27.
28.
29.
30.
31. 32.
33. 34.
35.
36.
Clinical outcome of Mycobacterium abscessus infection and antimicrobial susceptibility testing. J. Microbiol. Immunol. Infect. 43:401– 406. http://dx.doi.org/10.1016/S1684-1182(10)60063-1. Meier A, Kirschner P, Springer B, Steingrube VA, Brown BA, Wallace RJ, Jr, Bottger EC. 1994. Identification of mutations in 23S rRNA gene of clarithromycin-resistant Mycobacterium intracellulare. Antimicrob. Agents Chemother. 38:381–384. http://dx.doi.org/10.1128/AAC.38.2.381. Prammananan T, Sander P, Brown BA, Frischkorn K, Onyi GO, Zhang Y, Bottger EC, Wallace RJ, Jr. 1998. A single 16S ribosomal RNA substitution is responsible for resistance to amikacin and other 2-deoxystreptamine aminoglycosides in Mycobacterium abscessus and Mycobacterium chelonae. J. Infect. Dis. 177:1573–1581. http://dx.doi.org/10.1086/515328. Pawlik A, Garnier G, Orgeur M, Tong P, Lohan A, Le Chevalier F, Sapriel G, Roux AL, Conlon K, Honore N, Dillies MA, Ma L, Bouchier C, Coppee JY, Gaillard JL, Gordon SV, Loftus B, Brosch R, Herrmann JL. 3 September 2013. Identification and characterization of the genetic changes responsible for the characteristic smooth-to-rough morphotype alterations of clinically persistent Mycobacterium abscessus. Mol. Microbiol. http://dx.doi.org/10.1111/mmi.12387. Wallace RJ, Jr, Meier A, Brown BA, Zhang Y, Sander P, Onyi GO, Bottger EC. 1996. Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus. Antimicrob. Agents Chemother. 40:1676 –1681. Kim HY, Kook Y, Yun YJ, Park CG, Lee NY, Shim TS, Kim BJ, Kook YH. 2008. Proportions of Mycobacterium massiliense and Mycobacterium bolletii strains among Korean Mycobacterium chelonaeMycobacterium abscessus group isolates. J. Clin. Microbiol. 46:3384 – 3390. http://dx.doi.org/10.1128/JCM.00319-08. Høiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O. 2010. Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob. Agents 35:322–332. http://dx.doi.org/10.1016/j.ijantimicag.2009.12.011. Oliver A, Canton R, Campo P, Baquero F, Blazquez J. 2000. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 288:1251–1254. http://dx.doi.org/10.1126/science .288.5469.1251. Oliver A, Mena A. 2010. Bacterial hypermutation in cystic fibrosis, not only for antibiotic resistance. Clin. Microbiol. Infect. 16:798 – 808. http: //dx.doi.org/10.1111/j.1469-0691.2010.03250.x. Alipour M, Suntres ZE, Omri A. 2009. Importance of DNase and alginate lyase for enhancing free and liposome encapsulated aminoglycoside activity against Pseudomonas aeruginosa. J. Antimicrob. Chemother. 64:317– 325. http://dx.doi.org/10.1093/jac/dkp165. Maurer FP, Ruegger V, Ritter C, Bloemberg GV, Bottger EC. 2012. Acquisition of clarithromycin resistance mutations in the 23S rRNA gene of Mycobacterium abscessus in the presence of inducible erm(41). J. Antimicrob. Chemother. 67:2606 –2611. http://dx.doi.org/10.1093/jac/dks279. Leung JM, Olivier KN. 2013. Nontuberculous mycobacteria: the changing epidemiology and treatment challenges in cystic fibrosis. Curr. Opin. Pulm. Med. 19:662– 669. http://dx.doi.org/10.1097/MCP.0b013e328365ab33.
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
18.
glycopeptidolipid and reacquisition of an invasive phenotype. Microbiology 152:1581–1590. http://dx.doi.org/10.1099/mic.0.28625-0. Sánchez-Chardi A, Olivares F, Byrd TF, Julián E, Brambilla C, Luquin M. 2011. Demonstration of cord formation by rough Mycobacterium abscessus variants: implications for the clinical microbiology laboratory. J. Clin. Microbiol. 49:2293–2295. http://dx.doi.org/10.1128/JCM.02322-10. Byrd TF, Lyons CR. 1999. Preliminary characterization of a Mycobacterium abscessus mutant in human and murine models of infection. Infect. Immun. 67:4700 – 4707. Nessar R, Reyrat JM, Davidson LB, Byrd TF. 2011. Deletion of the mmpL4b gene in the Mycobacterium abscessus glycopeptidolipid biosynthetic pathway results in loss of surface colonization capability, but enhanced ability to replicate in human macrophages and stimulate their innate immune response. Microbiology 157:1187–1195. http://dx.doi.org /10.1099/mic.0.046557-0. Davidson LB, Nessar R, Kempaiah P, Perkins DJ, Byrd TF. 2011. Mycobacterium abscessus glycopeptidolipid prevents respiratory epithelial TLR2 signaling as measured by HbetaD2 gene expression and IL-8 release. PLoS One 6:e29148. http://dx.doi.org/10.1371/journal.pone .0029148. Catherinot E, Roux AL, Macheras E, Hubert D, Matmar M, Dannhoffer L, Chinet T, Morand P, Poyart C, Heym B, Rottman M, Gaillard JL, Herrmann JL. 2009. Acute respiratory failure involving an R variant of Mycobacterium abscessus. J. Clin. Microbiol. 47:271–274. http://dx.doi .org/10.1128/JCM.01478-08. Nash KA, Brown-Elliott BA, Wallace RJ, Jr. 2009. A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus but is absent from Mycobacterium chelonae. Antimicrob. Agents Chemother. 53:1367–1376. http://dx.doi.org/10.1128/AAC.01275-08. Bastian S, Veziris N, Roux AL, Brossier F, Gaillard JL, Jarlier V, Cambau E. 2011. Assessment of clarithromycin susceptibility in strains belonging to the Mycobacterium abscessus group by erm(41) and rrl sequencing. Antimicrob. Agents Chemother. 55:775–781. http://dx.doi.org /10.1128/AAC.00861-10. Koh WJ, Jeon K, Lee NY, Kim BJ, Kook YH, Lee SH, Park YK, Kim CK, Shin SJ, Huitt GA, Daley CL, Kwon OJ. 2011. Clinical significance of differentiation of Mycobacterium massiliense from Mycobacterium abscessus. Am. J. Respir. Crit. Care Med. 183:405– 410. http://dx.doi.org/10 .1164/rccm.201003-0395OC. Brown-Elliott BA, Nash KA, Wallace RJ, Jr. 2012. Antimicrobial susceptibility testing, drug resistance mechanisms, and therapy of infections with nontuberculous mycobacteria. Clin. Microbiol. Rev. 25:545–582. http: //dx.doi.org/10.1128/CMR.05030-11. Wallace RJ, Jr, Brown-Elliott BA, Crist CJ, Mann L, Wilson RW. 2002. Comparison of the in vitro activity of the glycylcycline tigecycline (formerly GAR-936) with those of tetracycline, minocycline, and doxycycline against isolates of nontuberculous mycobacteria. Antimicrob. Agents Chemother. 46:3164 –3167. http://dx.doi.org/10.1128/AAC.46.10.3164 -3167.2002. Huang YC, Liu MF, Shen GH, Lin CF, Kao CC, Liu PY, Shi ZY. 2010.
T
he genus Mycobacterium contains more than 100 different species which belong either to the Mycobacterium tuberculosis complex or to the large group of nontuberculous mycobacteria (NTMs). M. abscessus is an NTM, and clinical studies have begun to shed light on its epidemiology. M. abscessus is involved in soft tissue infections and is a dominant respiratory pathogen in patients with cystic fibrosis (CF). It is the second-most-common NTM species isolated from CF patients in the United States and the most common NTM species isolated from CF patients in Europe (1–6). Fatal infections with M. abscessus have been reported, especially after lung transplantation (7). M. abscessus has been subdivided in type I and type II, which, together with Mycobacterium chelonae, share identical 16S rRNA genes but show differences within the hsp65 gene (8, 9). Based on multilocus sequence analysis of hsp65, rpoB, secA, and the 16S-23S internal transcribed spacer (ITS) region, M. abscessus was further subdivided into three species, M. abscessus (sensu stricto), M. bolletii, and M. massiliense (10, 11). Recently, uniting M. bolletii and M. massiliense as M. abscessus subspecies bolletii (the former type II) and separating that subspecies from M. abscessus subspecies abscessus (the former type I) have been proposed (12). M. abscessus colonies on agar plates grow with either a rough or a smooth morphology (13, 14). M. abscessus can show cord formation when visualized microscopically (15). Production of a glycopeptidolipid (GPL) masks the cord-forming structures of the mycobacterial cell wall. Macroscopically, cord-forming M. abscessus grows with the rough morphotype, and non-cord-forming, GPL-producing M. abscessus grows with the smooth morphotype (14). The presence of GPL is associated with lesser virulence. A rough clinical isolate persisted in the lungs of experimentally infected mice and disseminated into the spleen, whereas a smooth isolate was cleared from the lungs within 3 weeks (16). An isogenic mutant of M. abscessus that lacked GPL production lost biofilm formation but gained the ability to replicate inside macrophages, stimulate Toll-like receptor 2, and induce cytokine production
(17, 18). It has also been suggested that the rough morphotype is more virulent in humans (19). In a previous study looking at the epidemiology of M. abscessus, isolates of 12 rough morphotypes but only 1 smooth morphotype were collected from the respiratory tract of CF patients (13). At present, it is not known whether clinical isolates of smooth and rough morphotypes of M. abscessus differ in antimicrobial susceptibility. Macrolides such as clarithromycin are first-line antibiotics for treatment of pulmonary disease caused by M. abscessus subspecies bolletii. Due to the presence of the inducible methylase Erm(41) which confers macrolide resistance in M. abscessus subspecies abscessus, rates of response to clarithromycin are lower for this subspecies (20–22). Amikacin and cefoxitin are the two other first-line antibiotics for the treatment of M. abscessus (23). M. abscessus is generally resistant to fluoroquinolones, doxycycline, and minocycline. A newer tetracycline, tigecycline, has shown in vitro activity against M. abscessus (24, 25), but its role in treatment of disease has yet to be established. In this study, we compared the proportions of the occurrence of rough and smooth morphotypes of M. abscessus isolated from the respiratory tract of 34 patients, 28 of whom had cystic fibrosis, and analyzed the patterns of susceptibility to clarithromycin, amikacin, cefoxitin, and tigecycline of the two morphotypes.
244
p. 244 –250
jcm.asm.org
Journal of Clinical Microbiology
Received 15 May 2013 Returned for modification 28 June 2013 Accepted 29 October 2013 Published ahead of print 6 November 2013 Editor: S. A. Moser Address correspondence to Franz-Christoph Bange, [email protected]. K.R. and A.H. contributed equally to this article. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JCM.01249-13
January 2014 Volume 52 Number 1
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
Mycobacterium abscessus, which consists of the two subspecies M. abscessus subspecies abscessus and M. abscessus subspecies bolletii, can produce rough or smooth colony morphologies. Here we analyzed 50 M. abscessus isolates cultured from the respiratory specimens of 34 patients, 28 (82%) of whom had cystic fibrosis (CF), with respect to their colony morphologies and antibiotic susceptibilities. The overall proportions of occurrences of the two morphotypes were similar, with specimens from 50% of the patients showing a rough and 38% showing a smooth morphotype. A total of 12% of the specimens from the patients showed both morphotypes simultaneously. At the subspecies level, the proportions of rough and smooth morphotypes differed substantially; 88% of rough morphotypes belonged to M. abscessus subspecies abscessus, and 85% of smooth morphotypes belonged M. abscessus subspecies bolletii. Inducible clarithromycin resistance due to the Erm(41) methylase, as well as high-level resistance to clarithromycin due to mutations within the rrl gene, occurred independently of the morphotype. The MIC50s of amikacin and cefoxitin were identical for the two morphotypes, whereas the MIC50s of tigecycline were 0.25 g/ml for the rough morphotype and 2.0 g/ml for the smooth morphotype. Our results show that the smooth morphotype was more dominant in respiratory specimens from CF patients than previously thought. With respect to resistance, colony morphology did not affect the susceptibility of Mycobacterium abscessus to the first-line antibiotics clarithromycin, amikacin, and cefoxitin.
Mycobacterium abscessus, Rough and Smooth Morphotypes
MATERIALS AND METHODS
January 2014 Volume 52 Number 1
room temperature, lysozyme overnight at 37°C, and proteinase K and SDS for 20 h at 55°C (13). For DNA digestion, we used XbaI. Digestion was performed for approximately 18 h at 37°C. Our protocol consisted of an initial time of 3 s, a final time of 12 s, a run time of 20 h, a temperature of 14°C, voltage at 200 V, an agarose concentration of 1%, and a buffer of 0.5⫻ Tris-borate-EDTA (TBE). Staining was done with ethidium bromide. DNA sequencing of msp1. Analysis of msp1 was done as previously described (28). Briefly, the 5= part of the msp1 gene containing a potential CG insertion was amplified. A 5-l volume of the purified chromosomal DNA of both morphotypes from patients P2, P17, P31, and P37 was added as a template to a reaction mix containing 20 mM Tris-HCl (pH 8), 50 mM KCl, 1.5 mM MgCl2, 250 M deoxynucleoside triphosphate (dNTPs), 10 pmol of primers 767 (5=_AAAAGGCGACGGATATTCAA_3=) and 768 (5=_GAGTATCGGCGAATCCGTAA_3=), and 2.5 U Taq DNA polymerase (Invitrogen/Life Technologies). A total of 35 PCR cycles were performed under the following conditions: 95°C for 1 min, 52°C for 30 s, and 68°C for 1 min. The purified PCR fragments had a length of about 450 bp, and their nucleotide sequences were analyzed by using a ABI Prism BigDye Terminator cycle sequencing v1.1 ready-reaction kit (Applied Biosystems, Austin, TX) and the 767 primer. Stability testing of the morphotypes. The original samples collected from patients P2, P17, P31, and P37 were plated on 7H11 agar plates, and single colonies presenting the smooth and rough morphotypes were isolated and subcultured as the next generation on 7H11 agar plates. The subculture of each morphotype was repeated for 12 generations. In addition, frozen stocks of the stabilized morphotypes from patients P2, P17, P31, and P37 were thawed and plated on 7H11 agar plates. The stocks were afterward refrozen at ⫺20°C. The procedure was repeated for 12 cycles, and the morphotypes were checked for stability.
RESULTS
Detection of rough and smooth morphotypes in clinical specimens. Fig. 1 shows the appearance of rough and smooth morphotypes of M. abscessus. When we recultured frozen stocks from 34 patients, 28 of whom had CF, the specimens from 30 patients had either the rough or the smooth morphotype. Of these, 17 (50%) had a rough morphotype, and 13 (38.2%) had a smooth morphotype. Of the specimens from the 28 CF patients, 14 (50%) showed a rough morphotype, and 13 (46.4%) a smooth morphotype. For four patients (P2, P17, P31, and P37), the cultures from the frozen stocks produced rough and smooth colonies simultaneously (Fig. 2). From each patient culture, we took a smooth and a rough colony and generated 12 sequential subcultures on 7H11 agar plates. Rough and smooth morphotypes of colonies from two patients (P2 and P17) were stable on the first subculture, from one patient (P37) on the second subculture, and from one patient (P31) on the eighth subculture. Using pulsed-field gel electrophoresis, we found that the rough and smooth morphotypes were indistinguishable in the colonies from each of the four patients (Fig. 2). We subjected a stable rough subculture and smooth subculture from each of the four patients to 12 subsequent freeze/ thaw cycles and found that colony morphology did not change. The majority of rough morphotypes belonged to M. abscessus subspecies abscessus, and the majority of smooth morphotypes belonged to M. abscessus subspecies bolletii (Table 1). From 12 of the 34 patients, a second isolate was available. The range of time lapses between the times of collection of the first and second isolates was 1.3 to 9.4 years. The morphologies of the first and second isolates were identical in 11 patients. One patient showed both morphotypes in his first specimen. The second specimen from the same patient showed only the rough morphotype. Pulsed-field gel elec-
jcm.asm.org 245
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
Strains and cultures. We searched the Laboratory Information System of the Department of Medical Microbiology and Hospital Epidemiology of the Hannover Medical School for patients from whose respiratory tract M. abscessus was cultured between January 2000 and December 2011. Isolates were then recultured from frozen stocks on 7H11 agar at 37°C for 7 days, and colony morphology was determined. For the patients with two or more isolates, the last available isolate was included in this study, when cultured at least 1 year after the first isolate, and was termed the “second” isolate. Colonies from plates were used directly for inoculation of Rapmyco Sensititre 96-well plates (susceptibility testing) and for pulsed-field gel electrophoresis. For all DNA-sequencing procedures, colonies were subcultured in 7H9 liquid medium, and genomic DNA was extracted. Isolation and identification of M. abscessus from patient samples. All specimens were processed in the MGIT culture system (Becton, Dickinson). In our laboratory, cultures that grow acid-fast bacilli are initially subjected to 16S rRNA gene sequencing. Those identified as belonging to the M. chelonae/M. abscessus complex are subsequently analyzed by the use of a LightCycler targeting the hsp65 gene that allows differentiation of M. chelonae, M. abscessus subspecies abscessus (type I), and M. abscessus subspecies bolletii (type II) as described previously (9). Phenotypic resistance. A total of 50 isolates of M. abscessus from 34 patients (30 first isolates from 30 patients that had only one of the two morphotypes, 8 first isolates from 4 patients that had rough and smooth morphotypes simultaneously, and 12 second isolates) were tested. Overall, we tested 29 rough and 21 smooth isolates. Phenotypic resistance was tested with Rapmyco Sensititre 96-well plates (Trek Diagnostic Systems), as recommended by the manufacturer. Briefly, bacterial colonies were harvested and diluted in water to McFarland standard 0.5. A 50-l volume of the solution was transferred into cation-adjusted Mueller-Hinton broth, and finally, 100 l of the bacterial colony/Mueller-Hinton broth suspension was transferred into each well of the Rapmyco Sensititre 96well plates. Plates were incubated at 30°C and manually assessed on days 5 and 14. For quality control, we used Staphylococcus aureus ATCC 29213. Genotypic analysis of erm(41), rrl, and rrs. PCR was done with a TProfessional Thermocycler (Biometra) using Taq polymerase (New England BioLabs) in a 25-l assay. The erm(41) gene was amplified with forward primer erm41KRforward_#615 (5=_AAGATGCACACCGTGCA GATG_3=) and reverse primer erm41KRreverse_#616 (5=_ACATCGCTG TCCACGATGAAAG_3=) at 65°C annealing temperature, resulting in a 934-bp or 658-bp fragment. Fragment size was analyzed on an agarose gel. Subsequent sequencing was done using the forward primer. The rrl gene was amplified with forward primer 18 (5=_AGTCGGGACCTAAGGCGA G_3=) and reverse primer 21 (5=_TTCCCGCTTAGATGCTTTCAG_3=) as published by Meier et al. with an annealing temperature of 62°C, resulting in a 1,525-bp fragment, and subsequent sequencing was done using primer 19 (5=_GTAGCGAAATTCCTTGTCGG_3=) (26). The rrs gene was amplified using forward primer 283 (5=_GAGTTTGATCCTGGCTC AGGA_3=) and reverse primer 261 (5=_AAGGAGGTGATCCAGCCGCA_3=) as published by Prammananan et al. with an annealing temperature of 65°C, resulting in a fragment of 1,507 bp, and subsequent sequencing was done using primer 289 (5=_AAGTCGGGAGTCGCTAGTAAT_3=) (27). Amplification of erm(41), rrl, and rrs was done in 35 cycles with 30 s of denaturation at 96°C and 60 s of elongation at 68°C, including a final elongation step for 5 min. Pulsed-field gel electrophoresis. Bacterial colonies were harvested from 7H11 agar, dissolved in 5 ml 7H9, and cultured for 72 h and 37°C. A lysis solution (400 l) containing 0.2 M glycine, 60 g/ml D-cycloserine, 20 mM lithium chloride, 200 mg/ml lysozyme, and 5 mM EDTA was added and incubated for 16 h at 37°C. Cells were harvested by centrifugation at 3,000 ⫻ g for 15 min and resuspended in TS buffer (50 mM Tris, 0.5 M sucrose, pH 7.6), and aliquots of 250 l were frozen at ⫺20°C. The aliquots were thawed at room temperature and heated to 75°C for 20 min. Lysed cells (200 l) were cast into a gel block using 2% low-melting-point agarose. Cell lysis was performed by adding lysostaphin for 15 min at
Rüger et al.
nies.
trophoresis revealed clonal identity of the first and second isolates for each of the 12 patients. In a recent publication, the genomes and transcriptomes of smooth and rough variants of three M. abscessus strains (two laboratory strains and one clinical strain from a patient with cystic fibrosis) were compared (28). The switch from a smooth to a rough morphotype of M. abscessus was associated with the downregulation of the msp1-msp2-gap operon in all three rough variants. This operon encodes two nonribosomal peptide synthases and a glycopetide transport gene. The genome of one rough variant revealed a CG insertion within the 5= part of the msp1, which caused a frameshift, leading to transcriptional arrest of the msp1msp2-gap operon (28). We compared the 5= parts of msp1 from the 4 rough and 4 smooth strains that we obtained from the four patients with the mixed morphotypes (P2, P17, P31, and P37; see also Fig. 2). None of the rough strains carried the CG insertion in the 5= part of msp1, indicating that, at least in these 4 isogenic smooth/rough pairs, the morphotypic switch was not caused by the CG insertion within the msp1 gene. MICs of clarithromycin in smooth and rough morphotypes. We tested 50 isolates (29 rough and 21 smooth) from 34 patients. A suspension of bacteria grown on agar plates was inoculated into 96 wells, and the MICs for clarithromycin were read on days 5 and 14. The rough and smooth isolates had a MIC50 of 0.5 g/ml on day 5. By day 14, the rough isolates had a MIC50 of ⬎16 g/ml, whereas smooth isolates had a MIC50 of 1 g/ml, indicating the presence of inducible clarithromycin resistance in rough isolates. Stratification of rough and smooth morphotypes to the subspecies level showed that the inducible clarithromycin resistance occurred more frequently in M. abscessus subspecies abscessus than in M. abscessus subspecies bolleti. By day 14, both the rough and smooth morphotypes of M. abscessus subspecies abscessus had a MIC50 of ⬎16 g/ml, whereas rough morphotypes of M. abscessus subspecies bolletii had a MIC50 of 2 g/ml and smooth morphotypes had a MIC50 of 1 g/ml. Noninducible, high-level resistance to clarithromycin, which was defined as a MIC ⬎ 16 g/ml on day 5, was detected in 9 of 50 isolates, 5 with a rough and 4 with a smooth morphotype. In all 50 isolates, we sequenced the erm(41) gene, which encodes a methylase that mediates inducible clari-
246
jcm.asm.org
thromycin resistance in M. abscessus (20). A total of 69% of the rough isolates and 19% of the smooth isolates had the wild-type allele (Table 2). A total of 31% of the rough morphotypes and 81% of the smooth morphotypes had either a 276-bp deletion or a single nucleotide polymorphism at position 28 (T¡C) of erm(41) (Table 2). Both mutations lead to the loss of the inducible clarithromycin resistance (20, 21). Bastian and colleagues showed that the T¡C mutation within the erm(41) gene occurs only in M. abscessus subspecies abscessus and that the 276-bp deletion occurs only in M. abscessus subspecies bolletii (21). They also found that 77% of M. abscessus subspecies abscessus isolates and 41% of M. abscessus subspecies bolletii isolates had the wild-type erm(41) gene. Thus, we stratified the genotypic analysis of the erm(41) gene of the 50 clinical isolates from this study according to the two subspecies of M. abscessus. A total of 75% of M. abscessus subspecies abscessus isolates and 13.6% of M. abscessus subspecies bolletii isolates carried the wildtype erm(41) gene (Table 3). The 276-bp deletion was exclusively present in M. abscessus subspecies bolletii, whereas the T¡C mutation was exclusively present in M. abscessus subspecies abscessus (Table 3). Mutations at positions 2058 and 2059 of the rrl gene, which causes high-level resistance to clarithromycin (29), were present in all 9 strains with an antibiotic MIC ⬎ 16 g/ml on day 5 (Table 2). Of these 9 isolates, those from four patients (P2, P3, P6, and P14) were second isolates; three of those four patients (P2, P3, and P14) had a corresponding first isolate without high-level clarithromycin resistance (Table 4), suggesting development of highlevel resistance to clarithromycin in vivo. Interestingly, 2 of the 9 strains with high-level resistance had a functional erm(41) gene, showing the presence of both inducible and high-level resistance to clarithromycin. MICs of amikacin in smooth and rough morphotypes. In M. abscessus, the MIC50 of amikacin was 16 g/ml and did not differ between the rough and smooth morphotypes. Of 50 isolates, 8 (4 with a rough morphotype and 4 with a smooth morphotype) showed high-level resistance to amikacin, as defined by a MIC ⱖ 64 g/ml. Of the 8 isolates, 4 (those from patients P2, P3, P4, and P6) were second isolates; three of those four patients (P2, P3, and
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
FIG 1 Growth characteristics of rough and smooth phenotypes on 7H11 agar cultured at 37°C: representative single rough (left) and smooth (right) colo-
Mycobacterium abscessus, Rough and Smooth Morphotypes
TABLE 1 Colony morphologies of M. abscessus subspecies abscessus and M. abscessus subspecies bolletii from 34 patientsa No. (%) of first isolates from patients (n ⫽ 34) with M. abscessus Colony morphology
M. abscessus subsp. abscessus
M. abscessus subsp. bolletii
Total
Rough Smooth Mixed
15 (88.2) 2 (15.4) 2 (50)
2 (11.8) 11 (84.6) 2 (50)
17 (100) 13 (100) 4 (100)
a Strains were cultured on 7H11 agar to evaluate culture morphology; differentiation of subspecies was done by LightCycler-based analysis of the hsp65 gene.
January 2014 Volume 52 Number 1
P4) had a corresponding first isolate without high-level aminoglycoside resistance (Table 3), suggesting development of high-level resistance to aminoglycoside in vivo. A total of 7 strains with an antibiotic MIC ⱖ 64 g/ml had a single nucleotide polymorphism at position 1408 (A¡G) of the rrs gene, which had been shown to mediate high-level aminoglycoside resistance in M. abscessus (27). MICs of cefoxitin, doxycycline, minocycline, and tigecycline. Besides clarithromycin and amikacin, cefoxitin is frequently used for treatment of M. abscessus infection. For cefoxitin, we found a MIC50 of 64 g/ml and a MIC90 of 128 g/ml that did not differ between the rough and smooth morphotypes of M. abscessus. We also tested tetracyclines such as doxycycline, minocycline, and tigecycline. Doxycycline and minocycline had a MIC50 and MIC90
jcm.asm.org 247
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
FIG 2 Colony morphology of the primary subculture and results of pulsed-field gel electrophoresis of rough and smooth strains from the four patients (P2, P17, P31, and P37) that produced a mixed phenotype. Subcultures from primary specimens that had been kept as frozen stocks were recultured on 7H11 agar at 37°C, and photos were taken. Two patients (P2 and P17) had predominantly rough morphotypes, and two patients (P31 and P37) had predominantly smooth morphotypes. From each patient, one smooth colony and one rough colony were subcultured until the morphotypes remained stable before genomic DNA was prepared, XbaI digested, and separated by pulsed-field gel electrophoresis. The gel photo shows a comparison of the smooth (s) and rough (r) morphotypes from each of the four patients (P2, P17, P31, and P37). M, molecular marker; ATCC, M. abscessus ATCC 19977 type strain.
Rüger et al.
TABLE 2 Sequence analysis of the erm(41) and rrl genes of 29 rough and 21 smooth isolates No. (%) of M. abscessus isolates (n ⫽ 50) erm(41)
rrl
Wild type
276-bp deletion
Rough Smooth
20 (69) 4 (19)
4 (13.7) 15 (71.4)
Total
5 (17.3) 2 (9.6)
29 (100) 21 (100)
above 8 g/ml both in rough and in smooth morphotypes. In contrast, MICs were lower for tigecycline and differed between the rough isolates, which had a tigecycline MIC50 of 0.25 g/ml and a MIC90 of 1 g/ml, and the smooth isolates, which had a tigecycline MIC50 of 2 g/ml and a MIC90 ⬎ 4 g/ml. DISCUSSION
In this study, we investigated the prevalences and antibiotic susceptibilities of rough and smooth morphotypes in respiratory specimens from 34 patients, most of whom had cystic fibrosis. Even though isolates with rough morphotypes occurred more frequently than those with smooth morphotypes (50% versus 38%), our results show that the rough morphotype was less dominant in respiratory specimens from CF patients than previously thought. The proportions found in a study in South Korea were 61% for rough and 28% for smooth morphotypes (30). A study in Sweden found 12 rough isolates but only 1 smooth isolate in the respiratory tract of CF patients (13). Looking at the subspecies level, the proportions of smooth morphotypes in this present study were low (15%) in M. abscessus subspecies abscessus and high (85%) in M. abscessus subspecies bolletii. This differs from the proportions found in the South Korea population, where the prevalences of smooth morphotypes were low (27% and 28%) for both subspecies (30). Even though the population sizes studied so far are still small, there appears to be no clear dominance of either morphotype in a given population or between the two subspecies. Together, these findings suggest that the distribution of M. abscessus subspecies with rough and smooth colony morphologies within the respiratory tract of affected patients shows regional diversity and that, at least in CF patients, it is not confined to one of the two distinct subspecies of M. abscessus. In rough and smooth morphotypes, we did not find a difference in MIC50 (16 g/ml for both morphotypes) for amikacin. In patients with cystic fibrosis, mucoid morphotypes of Pseudomonas aeruginosa form biofilm and show resistance to a wide range of antibiotics (31). Initially, it was thought that the extracelluar ma-
Wild type
Mutations at positions 2058 and 2059 (AA¡AC/AG/CA/TA/GA)
Total
24 (82.7) 17 (81)
5 (17.3) 4 (19)
29 (100) 21 (100)
trix (alginate) produced by mucoid strains acts as a physical barrier to antibiotics. However, it later became evident that the broad range of antibiotic resistances of Pseudomonas aeruginosa isolates in CF patients is due to so-called hypermutators that assemble classic resistance mechanisms such as target mutations (32, 33). Nonetheless, treatment with alginate lysis of mucoid isolates of Pseudomonas aeruginosa enhances susceptibility to tobramycin, indicating that, at least for aminoglycosides, alginate acts as a physical barrier (34). Our study suggest that the glycopeptidolipid of M. abscessus has no immediate effect on the antimicrobial action of amikacin. Inducible clarithromycin resistance was higher in rough than in smooth morphotypes. Loss of inducible clarithromycin resistance is caused by a deletion or a nucleotide polymorphism within erm(41) (20, 21). The deletion is absent in M. abscessus subspecies abscessus and is frequently present in M. abscessus subspecies bolletii (21). In this study, 88% of the rough morphotypes belonged to M. abscessus subspecies abscessus and 85% of the smooth morphotypes belonged to M. abscessus subspecies bolletii. Thus, differences in the proportions of inducible clarithromycin resistance between smooth and rough isolates are the result of a higher proportion of M. abscessus subspecies abscessus among rough isolates and of M. abscessus subspecies bolletii among smooth isolates. It is noteworthy that we found 2 isolates which had a 23S rRNA mutation at positions 2058 and 2059 despite the presence of the Erm methylase. Acquisition of high-level clarithromycin resistance in the presence of the Erm methylase has been demonstrated in vivo in a recent study, and it has been suggested that a mutation at positions 2058 and 2059 of 23S rRNA provides an advantage that is independent of the presence of a functional erm(41) gene (35). In previous studies of the tetracyclines, only tigecycline had been shown to be effective against M. abscessus in vitro. Wallace and colleagues reported MICs of ⬎64 g/ml for minocycline and a MIC50 ⫽ 0.12 g/ml for tigecycline (24). Another study reported
TABLE 3 Sequence analysis of the erm(41) and rrl genes of M. abscessus subspecies abscessus and M. abscessus subspecies bolletii No. (%) of M. abscessus isolates (n ⫽ 50) erm(41)
Subspecies
Wild type
M. abscessus subsp. abscessus M. abscessus subsp. bolletii
21 (75) 3 (13.6)
248
jcm.asm.org
rrl
276-bp deletion
Single nucleotide polymorphism at position 28 (T¡C) 7 (25)
19 (86.4)
Total
Wild type
Mutations at positions 2058 and 2059 (AA¡AC/AG/CA/TA/GA)
28 (100) 22 (100)
23 (82.1) 18 (77.8)
5 (17.9) 4 (22.2)
Total 28 (100) 22 (100)
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
Colony morphology
Single nucleotide polymorphism at position 28 (T¡C)
Mycobacterium abscessus, Rough and Smooth Morphotypes
TABLE 4 MICs on day 5 for first and second isolates from 5 patients (P2, P3, P4, P6, and P14) determined using the microdilution methoda MIC (g/ml) P2 (mixed)a
P3 (smooth)
P4 (smooth)
P6 (smooth)
P14 (rough)
Antibiotic
First isolate
Second isolate
First isolate
Second isolate
First isolate
Second isolate
First isolate
Second isolate
First isolate
Second isolate
Clarithromycin Amikacin
0.25 8
⬎16 ⬎64
0.06 8
⬎16 ⬎64
0.25 4
0.25 ⬎64
⬎16 ⬎64
⬎16 ⬎64
0.5 16
⬎16 32
a
a MIC50 of 0.5 g/ml for tigecycline and a MIC50 of 32 g/ml for doxycycline (25). Our results suggest that, for further evaluations of the efficacy of tigecycline for the treatment of M. abscessus, the testing of the morphotype should be included. At present, we have no mechanistic explanation as to why tigecycline shows higher MICs in smooth than in rough morphotypes. It is unclear whether glycopeptidolipids directly interfere with the drug. In summary, we found no difference in susceptibility to the two first-line antibiotics amikacin and cefoxitin between rough and smooth morphotypes of Mycobacterium abscessus strains that were isolated from CF patients. The higher rate of inducible resistance to clarithromycin in rough morphotypes was due to a higher prevalence of Mycobacterium abscessus subspecies abscessus in this group, which carries an inducible methylase that mediates clarithromycin resistance. Therefore, with respect to decisions on antibiotic treatment, we see no immediate benefit in differentiating between the two morphotypes by the clinical laboratory. Based on this and previous work, with respect to diagnostics in clinical microbiology, we discuss the following. It might be useful to further differentiate M. abscessus strains to obtain more information about differences in epidemiology and virulence between the two subspecies. Differentiation can be achieved by analysis of hsp65 gene polymorphism (8, 9). Subspecies differentiation could also serve as a surrogate marker for inducible clarithromycin resistance. Yet it should be stressed that in strains isolated from CF patients in this study, a subgroup of M. abscessus subspecies bolletii (13.6%; see Table 2) had a functional erm(41) gene and a subgroup of M. abscessus subspecies abscessus lacked a functional erm(41) gene (25%; Table 2). Phenotypic testing for antibiotic resistance might be useful for guiding antibiotic treatment. However, except for clarithromycin resistance, the poor correlation between in vitro drug susceptibility results and clinical response to antibiotic treatment is of concern (36). Unambiguous detection of inducible clarithromycin resistance requires the sequencing of the erm(41) gene (21). The proportion of strains with high-level resistance to clarithromycin and amikacin was between 10% and 20% in this study; thus, partial sequencing of the 16S rRNA and 23S rRNA genes to detect high-level resistance to clarithromycin and amikacin should be considered based on the individual case. ACKNOWLEDGMENTS The work was supported by the Niedersächsische Verein zur Bekämpfung der Tuberkulose, Lungen- und Bronchialerkrankungen and by International Research Training Group 1273 funded by the German Research Foundation to S.B. We declare that we have no conflicts of interest.
REFERENCES 1. Bange FC, Kirschner P, Bottger EC. 1999. Recovery of mycobacteria from patients with cystic fibrosis. J. Clin. Microbiol. 37:3761–3763.
January 2014 Volume 52 Number 1
2. Bange FC, Brown BA, Smaczny C, Wallace RJ, Jr, Bottger EC. 2001. Lack of transmission of Mycobacterium abscessus among patients with cystic fibrosis attending a single clinic. Clin. Infect. Dis. 32:1648 –1650. http://dx.doi.org/10.1086/320525. 3. Bange FC, Bottger EC. 2002. Improved decontamination method for recovering mycobacteria from patients with cystic fibrosis. Eur. J. Clin. Microbiol. Infect. Dis. 21:546 –548. http://dx.doi.org/10.1007/s10096-002 -0760-y. 4. Olivier KN, Weber DJ, Wallace RJ, Jr, Faiz AR, Lee JH, Zhang Y, Brown-Elliot BA, Handler A, Wilson RW, Schechter MS, Edwards LJ, Chakraborti S, Knowles MR. 2003. Nontuberculous mycobacteria. I: multicenter prevalence study in cystic fibrosis. Am. J. Respir. Crit. Care Med. 167:828 – 834. http://dx.doi.org/10.1164/rccm.200207-678OC. 5. Girón RM, Máiz L, Barrio I, Martínez MT, Salcedo A, Prados C. 2008. Nontuberculous mycobacterial infection in patients with cystic fibrosis: a multicenter prevalence study. Arch. Bronconeumol. 44:679 – 684. (In Spanish) http://dx.doi.org/10.1016/S0300-2896(08)75777-6. 6. Roux AL, Catherinot E, Ripoll F, Soismier N, Macheras E, Ravilly S, Bellis G, Vibet MA, Le Roux E, Lemonnier L, Gutierrez C, Vincent V, Fauroux B, Rottman M, Guillemot D, Gaillard JL. 2009. Multicenter study of prevalence of nontuberculous mycobacteria in patients with cystic fibrosis in France. J. Clin. Microbiol. 47:4124 – 4128. http://dx.doi.org /10.1128/JCM.01257-09. 7. Zaidi S, Elidemir O, Heinle JS, McKenzie ED, Schecter MG, Kaplan SL, Dishop MK, Kearney DL, Mallory GB. 2009. Mycobacterium abscessus in cystic fibrosis lung transplant recipients: report of 2 cases and risk for recurrence. Transpl. Infect. Dis. 11:243–248. http://dx.doi.org/10.1111/j .1399-3062.2009.00378.x. 8. Devallois A, Goh KS, Rastogi N. 1997. Rapid identification of mycobacteria to species level by PCR-restriction fragment length polymorphism analysis of the hsp65 gene and proposition of an algorithm to differentiate 34 mycobacterial species. J. Clin. Microbiol. 35:2969 –2973. 9. Sedlacek L, Rifai M, Feldmann K, Bange FC. 2004. LightCycler-based differentiation of Mycobacterium abscessus and Mycobacterium chelonae. J. Clin. Microbiol. 42:3284 –3287. http://dx.doi.org/10.1128/JCM .42.7.3284-3287.2004. 10. Adékambi T, Reynaud-Gaubert M, Greub G, Gevaudan MJ, La Scola B, Raoult D, Drancourt M. 2004. Amoebal coculture of “Mycobacterium massiliense” sp. nov. from the sputum of a patient with hemoptoic pneumonia. J. Clin. Microbiol. 42:5493–5501. http://dx.doi.org/10.1128/JCM .42.12.5493-5501.2004. 11. Adékambi T, Berger P, Raoult D, Drancourt M. 2006. rpoB gene sequencebased characterization of emerging non-tuberculous mycobacteria with descriptions of Mycobacterium bolletii sp. nov., Mycobacterium phocaicum sp. nov. and Mycobacterium aubagnense sp. nov. Int. J. Syst. Evol. Microbiol. 56(Pt 1):133–143. http://dx.doi.org/10.1099/ijs.0.63969-0. 12. Leao SC, Tortoli E, Euzeby JP, Garcia MJ. 2011. Proposal that Mycobacterium massiliense and Mycobacterium bolletii be united and reclassified as Mycobacterium abscessus subsp. bolletii comb. nov., designation of Mycobacterium abscessus subsp. abscessus subsp. nov. and emended description of Mycobacterium abscessus. Int. J. Syst. Evol. Microbiol. 61(Pt 9):2311–2313. http://dx.doi.org/10.1099/ijs.0.023770-0. 13. Jönsson BE, Gilljam M, Lindblad A, Ridell M, Wold AE, WelinderOlsson C. 2007. Molecular epidemiology of Mycobacterium abscessus, with focus on cystic fibrosis. J. Clin. Microbiol. 45:1497–1504. http://dx .doi.org/10.1128/JCM.02592-06. 14. Howard ST, Rhoades E, Recht J, Pang X, Alsup A, Kolter R, Lyons CR, Byrd TF. 2006. Spontaneous reversion of Mycobacterium abscessus from a smooth to a rough morphotype is associated with reduced expression of
jcm.asm.org 249
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
The first specimen of patient 2 (P2) showed both morphotypes; the second specimen of patient 2 showed only rough morphotypes. MICs for clarithromycin and amikacin are shown for the rough morphotype for the first specimen. The MICs for the smooth morphotype were 0.5 g/ml for clarithromycin and 16 g/ml for amikacin.
Rüger et al.
15.
16. 17.
19.
20.
21.
22.
23.
24.
25.
250
jcm.asm.org
26.
27.
28.
29.
30.
31. 32.
33. 34.
35.
36.
Clinical outcome of Mycobacterium abscessus infection and antimicrobial susceptibility testing. J. Microbiol. Immunol. Infect. 43:401– 406. http://dx.doi.org/10.1016/S1684-1182(10)60063-1. Meier A, Kirschner P, Springer B, Steingrube VA, Brown BA, Wallace RJ, Jr, Bottger EC. 1994. Identification of mutations in 23S rRNA gene of clarithromycin-resistant Mycobacterium intracellulare. Antimicrob. Agents Chemother. 38:381–384. http://dx.doi.org/10.1128/AAC.38.2.381. Prammananan T, Sander P, Brown BA, Frischkorn K, Onyi GO, Zhang Y, Bottger EC, Wallace RJ, Jr. 1998. A single 16S ribosomal RNA substitution is responsible for resistance to amikacin and other 2-deoxystreptamine aminoglycosides in Mycobacterium abscessus and Mycobacterium chelonae. J. Infect. Dis. 177:1573–1581. http://dx.doi.org/10.1086/515328. Pawlik A, Garnier G, Orgeur M, Tong P, Lohan A, Le Chevalier F, Sapriel G, Roux AL, Conlon K, Honore N, Dillies MA, Ma L, Bouchier C, Coppee JY, Gaillard JL, Gordon SV, Loftus B, Brosch R, Herrmann JL. 3 September 2013. Identification and characterization of the genetic changes responsible for the characteristic smooth-to-rough morphotype alterations of clinically persistent Mycobacterium abscessus. Mol. Microbiol. http://dx.doi.org/10.1111/mmi.12387. Wallace RJ, Jr, Meier A, Brown BA, Zhang Y, Sander P, Onyi GO, Bottger EC. 1996. Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus. Antimicrob. Agents Chemother. 40:1676 –1681. Kim HY, Kook Y, Yun YJ, Park CG, Lee NY, Shim TS, Kim BJ, Kook YH. 2008. Proportions of Mycobacterium massiliense and Mycobacterium bolletii strains among Korean Mycobacterium chelonaeMycobacterium abscessus group isolates. J. Clin. Microbiol. 46:3384 – 3390. http://dx.doi.org/10.1128/JCM.00319-08. Høiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O. 2010. Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob. Agents 35:322–332. http://dx.doi.org/10.1016/j.ijantimicag.2009.12.011. Oliver A, Canton R, Campo P, Baquero F, Blazquez J. 2000. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 288:1251–1254. http://dx.doi.org/10.1126/science .288.5469.1251. Oliver A, Mena A. 2010. Bacterial hypermutation in cystic fibrosis, not only for antibiotic resistance. Clin. Microbiol. Infect. 16:798 – 808. http: //dx.doi.org/10.1111/j.1469-0691.2010.03250.x. Alipour M, Suntres ZE, Omri A. 2009. Importance of DNase and alginate lyase for enhancing free and liposome encapsulated aminoglycoside activity against Pseudomonas aeruginosa. J. Antimicrob. Chemother. 64:317– 325. http://dx.doi.org/10.1093/jac/dkp165. Maurer FP, Ruegger V, Ritter C, Bloemberg GV, Bottger EC. 2012. Acquisition of clarithromycin resistance mutations in the 23S rRNA gene of Mycobacterium abscessus in the presence of inducible erm(41). J. Antimicrob. Chemother. 67:2606 –2611. http://dx.doi.org/10.1093/jac/dks279. Leung JM, Olivier KN. 2013. Nontuberculous mycobacteria: the changing epidemiology and treatment challenges in cystic fibrosis. Curr. Opin. Pulm. Med. 19:662– 669. http://dx.doi.org/10.1097/MCP.0b013e328365ab33.
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on March 7, 2015 by QUEENS UNIV BRACKEN LIB
18.
glycopeptidolipid and reacquisition of an invasive phenotype. Microbiology 152:1581–1590. http://dx.doi.org/10.1099/mic.0.28625-0. Sánchez-Chardi A, Olivares F, Byrd TF, Julián E, Brambilla C, Luquin M. 2011. Demonstration of cord formation by rough Mycobacterium abscessus variants: implications for the clinical microbiology laboratory. J. Clin. Microbiol. 49:2293–2295. http://dx.doi.org/10.1128/JCM.02322-10. Byrd TF, Lyons CR. 1999. Preliminary characterization of a Mycobacterium abscessus mutant in human and murine models of infection. Infect. Immun. 67:4700 – 4707. Nessar R, Reyrat JM, Davidson LB, Byrd TF. 2011. Deletion of the mmpL4b gene in the Mycobacterium abscessus glycopeptidolipid biosynthetic pathway results in loss of surface colonization capability, but enhanced ability to replicate in human macrophages and stimulate their innate immune response. Microbiology 157:1187–1195. http://dx.doi.org /10.1099/mic.0.046557-0. Davidson LB, Nessar R, Kempaiah P, Perkins DJ, Byrd TF. 2011. Mycobacterium abscessus glycopeptidolipid prevents respiratory epithelial TLR2 signaling as measured by HbetaD2 gene expression and IL-8 release. PLoS One 6:e29148. http://dx.doi.org/10.1371/journal.pone .0029148. Catherinot E, Roux AL, Macheras E, Hubert D, Matmar M, Dannhoffer L, Chinet T, Morand P, Poyart C, Heym B, Rottman M, Gaillard JL, Herrmann JL. 2009. Acute respiratory failure involving an R variant of Mycobacterium abscessus. J. Clin. Microbiol. 47:271–274. http://dx.doi .org/10.1128/JCM.01478-08. Nash KA, Brown-Elliott BA, Wallace RJ, Jr. 2009. A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus but is absent from Mycobacterium chelonae. Antimicrob. Agents Chemother. 53:1367–1376. http://dx.doi.org/10.1128/AAC.01275-08. Bastian S, Veziris N, Roux AL, Brossier F, Gaillard JL, Jarlier V, Cambau E. 2011. Assessment of clarithromycin susceptibility in strains belonging to the Mycobacterium abscessus group by erm(41) and rrl sequencing. Antimicrob. Agents Chemother. 55:775–781. http://dx.doi.org /10.1128/AAC.00861-10. Koh WJ, Jeon K, Lee NY, Kim BJ, Kook YH, Lee SH, Park YK, Kim CK, Shin SJ, Huitt GA, Daley CL, Kwon OJ. 2011. Clinical significance of differentiation of Mycobacterium massiliense from Mycobacterium abscessus. Am. J. Respir. Crit. Care Med. 183:405– 410. http://dx.doi.org/10 .1164/rccm.201003-0395OC. Brown-Elliott BA, Nash KA, Wallace RJ, Jr. 2012. Antimicrobial susceptibility testing, drug resistance mechanisms, and therapy of infections with nontuberculous mycobacteria. Clin. Microbiol. Rev. 25:545–582. http: //dx.doi.org/10.1128/CMR.05030-11. Wallace RJ, Jr, Brown-Elliott BA, Crist CJ, Mann L, Wilson RW. 2002. Comparison of the in vitro activity of the glycylcycline tigecycline (formerly GAR-936) with those of tetracycline, minocycline, and doxycycline against isolates of nontuberculous mycobacteria. Antimicrob. Agents Chemother. 46:3164 –3167. http://dx.doi.org/10.1128/AAC.46.10.3164 -3167.2002. Huang YC, Liu MF, Shen GH, Lin CF, Kao CC, Liu PY, Shi ZY. 2010.
