Mycologia, 107(1), 2015, pp. 39–45. DOI: 10.3852/14-074 # 2015 by The Mycological Society of America, Lawrence, KS 66044-8897

Characterization of the antigenicity of Cpl1, a surface protein of Cryptococcus neoformans var. neoformans Jian-Piao Cai1

established virulence factor and a target site for diagnostic tests. The CPL1 gene is required for capsular formation and virulence. The protein product Cpl1 has been proposed to be a secreted protein, but the characteristics of this protein have not been reported. Here we sought to characterize Cpl1. Phylogenetic analysis showed that the Cpl1 of C. neoformans var. neoformans and the Cpl1 orthologs identified in C. neoformans var. grubii and C. gattii formed a distinct cluster among related fungi; while the putative ortholog found in Trichosporon asahii was distantly related to the Cryptococcus cluster. We expressed Cpl1 abundantly as a secreted His-tagged protein in Pichia pastoris. The protein was used to immunize guinea pigs and rabbits for high titer mono-specific polyclonal antibody that was shown to be highly specific against the cell wall of C. neoformans var. neoformans and did not cross react with C. gattii, T. asahii, Aspergillus spp., Candida spp. and Penicillium spp. Using the anti-Cpl1 antibody, we detected Cpl1 protein in the fresh culture supernatant of C. neoformans var. neoformans and we showed by immunostaining that the Cpl1 protein was located on the surface. The Cpl1 protein is a specific surface protein of C. neoformans var. neoformans. Key words: capsule, CLP1, Cryptococcus, fungus, immunostaining

State Key Laboratory of Emerging Infectious Diseases, Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region

Ling-Li Liu1 Center for Clinical Laboratory, Zhujiang Hospital, Southern Medical University, Guangzhou, People’s Republic of China Department of Clinical Laboratory, Hainan Provincial People’s Hospital, Haikou, People’s Republic of China

Kelvin K.W. To State Key Laboratory of Emerging Infectious Diseases, Carol Yu Centre for Infection, Research Centre of Infection and Immunology, Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region

Candy C.Y. Lau Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region

Patrick C.Y. Woo Susanna K.P. Lau State Key Laboratory of Emerging Infectious Diseases, Carol Yu Centre for Infection, Research Centre of Infection and Immunology, Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region

Yong-Hui Guo Center for Clinical Laboratory, Zhujiang Hospital, Southern Medical University, Guangzhou, People’s Republic of China

INTRODUCTION

Antonio H.Y. Ngan

Cryptococcosis commonly affects immunocompromised patients (Mok et al. 1998, Chim et al. 2000, O’Meara and Alspaugh 2012). Cryptococcus typically causes pulmonary and cerebral infections, but it also can cause disseminated infections involving other organs. In recent years there has been increasing number of Cryptococcus infection among immunocompetent individuals in British Columbia, Canada and the Pacific Northwest of the United States (Chaturvedi and Chaturvedi 2011). One important phenotypic characteristic of Cryptococcus is the presence of a large capsule enclosing the yeast cells, which can be visualized by negative Indiaink staining. Furthermore, the capsule has been shown to be a virulence factor, in that poorly encapsulated Cryptococcus and knockout mutants without capsules have markedly reduced virulence in mice models (Bulmer et al. 1967). It has been shown that deletion of the CPL1 gene resulted in

Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region

Xiao-Yan Che Center for Clinical Laboratory, Zhujiang Hospital, Southern Medical University, Guangzhou, People’s Republic of China

Kwok-Yung Yuen2 State Key Laboratory of Emerging Infectious Diseases, Carol Yu Centre for Infection, Research Centre of Infection and Immunology, Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region

Abstract: Cryptococcus neoformans var. neoformans is an important fungal pathogen. The capsule is a well Submitted 24 Mar 2014; accepted for publication 5 Aug 2014. 1 Contributed equally to this work. 2 Corresponding author. E-mail: [email protected]

39

40

MYCOLOGIA

reduction of capsule formation and knockout mutants had reduced virulence (Liu et al. 2008). Cpl1 has been postulated to be a secreted protein because of the presence of an N-terminal signal peptide. However, the Cpl1 protein has not been extensively studied. Here we sought to determine the specificity of the Cpl1 protein among fungi and to determine the cellular localization of the protein.

dard precautions were taken to avoid PCR contamination, and no false-positive result was observed in negative controls. All PCR products were gel-purified with the QIAquick gel extraction kit (QIAGEN, Hilden, Germany). Both strands of the PCR products were sequenced with an ABI Prism 3700 DNA analyzer (Applied Biosystems, Foster City, California) with the two PCR primers. The sequences of the PCR products were compared with known sequences of the genes in the GenBank database.

MATERIALS AND METHODS

Phylogenetic characterization.— Phylogenetic trees were constructed by the neighbor joining method using Jukes-Cantor correction with Clustal X 1.83. The bootstrap values were calculated from 1000 trees. P. marneffei Mp1p protein was used as outgroup.

Identification of orthologs of Cpl1 in other fungi.—Fungal sequence data from other genomes available in NCBI databases were used to identify orthologs of Cpl1 in fungi with BLASTP and TBLASTN with Cpl1 as query. Blast hits with an E-value # 1e-10 were subjected to reciprocal BLAST and included in the analysis. Fungal strains.—Cryptococcus neoformans var. neoformans ATCC 32045 was purchased from ATCC. C. neoformans var. grubii 19187 and 10M143375 and Trichosporon asahii were clinical isolates obtained from Queen Mary Hospital. Candida spp. (C. albicans, C. parapsilosis, C. glabrata, C. krusei), Aspergillus spp. (A. fumigatus, A. flavus, A. terreus, A. niger, A. nidulans) and Penicillium marneffei were clinical isolates obtained from the Center for Clinical Laboratory, Zhujiang Hospital of Southern Medical University, Guangzhou, China. C. gattii ATCC 56991 was kindly provided by the Public Health Laboratory Centre of Hong Kong. Post-translational modification prediction of Cpl1.— The amino acid sequence of Cpl1 was used to predict the posttranslational modifications. Theoretical pI and molecular mass values of the predicted proteins were calculated with the Compute pI/Mw tool (http://web.expasy.org/ compute_pi/) (Gasteiger et al. 2005). Analysis of theoretical subcellular localization was carried out with PSORT II (http://psort.ims.u-tokyo.ac.jp/form2.html) (Nakai and Horton 1999). Prediction of signal peptides and their cleavage sites was performed with SignalP (http://www.cbs. dtu.dk/services/SignalP/) (Petersen et al. 2011). Potential N-glycosylation sites and O-glycosylation sites were predicted with NetNGlyc1.0 (http://www.cbs.dtu.dk/services/ NetNGlyc/) and NetOGlyc 4.0 (http://www.cbs.dtu.dk/ services/NetOGlyc/) (Steentoft et al. 2013), respectively. DNA sequence analysis.—Ribosomal RNA intergenic spacer (IGS) was used to confirm the species and varieties of C. neoformans strains in this study. Total DNA was extracted from one C. neoformans standard strain C. neoformans var. neoformans strain ATCC32045 and two clinical isolates, C. neoformans var. grubii strain 19187 and C. neoformans var. grubii strain 10M143375. IGS, were amplified with forward primer (59–ATCCTTTGCAGACGACTTGA–39) and reverse primer (59–GTGATCAGTGCATTGCATGA–39) with the iProof high-fidelity PCR kit (Bio-Rad Laboratories, USA). Reactions were incubated at 98 C for 1 min, followed by 98 C for 10 s, 55 C for 30 s, and 72 C for 1 min for 40 cycles with a final extension at 72 C for 10 min in an automated thermalcycler (Applied Biosystems, Foster City, California). Stan-

Nucleotide sequence accession numbers.— Nucleotide sequences of the IGS of C. neoformans var. neoformans strain ATCC32045, Cryptococcus neoformans var. grubii strain 19187 and Cryptococcus neoformans var. grubii strain 10M143375 were deposited in the GenBank sequence database under accession numbers KC883800–KC883802. Preparation of culture supernatant.—The fungal culture supernatants from different growth conditions were prepared as by Hao et al. (2008). Briefly C. neoformans var. neoformans was cultured on Sabouraud agar plates (Guangzhou Letongtai Biotech Co. Ltd, China) at 37 C for 3 d, and the fungal colonies were inoculated into RPMI-1640 (GIBCO, Carlsbad, California), YPD, liquid Sabouraud or YPM-R containing yeast extract 10 g/L, peptone 20 g/L, maltose 60 g/L with 20% deactivated normal rabbit serum (GIBCO, Carlsbad, California) and shaken at 200 rpm at 37 C. Culture supernatants were obtained at 18, 40, 64, 88, 112, 148 and 160 h, and centrifuged at 3000 rpm for 10 min, passed through a 0.45 mm pore filter (Corning Inc. New York) and stored at 280 C until used. Cloning, expression and purification of recombinant Cpl1 of C. neoformans.—Total fungal RNA was extracted from C. neoformans var. neoformans strain ATCC 32045 (Brandt et al. 1993). RNA was reverse-transcribed to cDNA by a oligo(dT)priming strategy. The gene fragment encoding Cpl1 protein of C. neoformans var. neoformans was amplified from cDNA by PCR with forward primer 59–GCGGCCGCTGGCGTAGA– 39 and reverse primer 59–TTGCCCTAAAGGGAGCTGAT– 39. A soluble His-tagged protein was prepared as described by Daly and Hearn (2005) and Wang et al. (2011, 2012). Briefly the N-terminal cleavable signal peptide of the CPL1 gene was removed and 63 His were inserted to the C terminal coding region of the full-length CPL1 gene using reverse primer. The reconstructed gene was ligated into the eukaryotic expression vector pPIC9K (Invitrogen, Carlsbad, California) to generate the recombinant plasmid pPIC9KCPL1. After digesting with BglII, the linearized DNA was transformed to Pichia pastoris strain GS115 by electroporation. The transformed yeast cells were spread in minimal dextrose medium (MD) plates and were incubated at 30 C for 2–3 d. His+ transformants were selected on the MD plates, which were histidine free. His+ yeast recombinants were screened in vivo by their resistance to G418 (Invitro-

CAI ET AL.: CPL1 PROTEIN IN CRYPTOCOCCUS gen, Carlsbad, California). YPD plates containing G418 of three concentrations (1.5, 3.0, 4.0 mg/mL) were used to screen multicopy integrants in the yeast colonies. Transformants of multicopy colonies were isolated and assayed for the expression of Cpl1 proteins induced by methanol. Ten positive clones persistently expressing the Cpl1 recombinant protein were selected for large scale production. The recombinant protein was purified by Ni-NTA affinity chromatography (QIAGEN, Hilden, Germany) according to manufacturer’s instructions. Expression of the recombinant protein was confirmed by western blot analysis using mouse anti-His monoclonal antibody (Mab) (Sigma-Aldrich Co., USA) and sera from C. neoformans var. neoformansinfected mice. Generation of antibodies.—To prepare antibodies against Cpl1, 300 mg purified Cpl1 recombinant protein was mixed with an equal volume of complete Freund’s adjuvant (Sigma-Aldrich Co., USA) and injected subcutaneously into rabbits and 150 mg Cpl1 was injected subcutaneously into guinea pigs. Incomplete Freund’s adjuvant (Sigma-Aldrich Co., USA) was used in subsequent injections 43 at 10 d intervals. Serum samples were taken after the fourth injection. Rabbits also were immunized with C. albicans Csa2. The method for preparation of antibodies was the same as the one in C. neoformans with minor modifications. Five hundred micrograms purified Csa2 recombinant protein was injected into rabbits subcutaneously. The sera from rabbits immunized by A. fumigatus Afmp1, A. fumigatus Afmp4 and P. marneffei Mp1p were prepared as described by Wang et al. (2011, 2012). Development of Cpl1 antigen EIA.—The procedure for the Cpl1 antigen EIA was carried out as described by Hao et al. (2008) with some modifications. In brief, 96-well plates (Costar, Corning, New York) were coated with 2 mg/wellpurified rabbit antibodies in 100 mL overnight at 4 C, followed by incubation with a blocking reagent containing 2.5 g Casein sodium salt, 1.21 g Tris-base, 2 g gelatin, 20 g sucrose, 0.2 g Merthiolate and 5 mL Tween20 in 1000 mL ddH2O (Sigma-Aldrich Co., USA). After removal of the blocking solution, a series of known recombinant Cpl1 concentrations or twofold serial dilutions of culture filtrates of the fungal pathogens, starting from 1 : 2 in 0.1% bovine serum albumin (BSA), were added per well and incubated at 37 C for 1 h. After the plates were washed, 100 mL/well Cpl1 guinea pig antibodies diluted 1 : 500 in 0.1% BSA were added and incubated at 37 C for 1 h. After washing 100 mL goat anti-guinea pig IgG-HRP (Sigma-Aldrich Co., USA) diluted 1 : 1000 were added per well and incubated at 37 C for 30 min, then 3.39,5,59-tetramethylbenzidine (TMB) substrate was added. The reaction was stopped after 10 min by the addition of 0.3 M sulfuric acid, and the plates were examined in an EIA plate reader (Bio-Tek, USA) at 450 nm. Development of Cpl1 antibody EIA.—Microwell plates (Costar, Corning, New York) were coated with 100 ng Cpl1 in a total volume of 100 mL/well overnight at 4 C followed by incubation with a blocking regent. After removal of the blocking solution, twofold serial dilutions of rabbit sera

41

starting at a dilution of 1 : 250 with 0.1% BSA of 100 mL/well were added and incubated 1 h at 37 C. After washing, Cpl1HRP diluted 1 : 1000 of 100 mL/well were added and incubated 30 min at 37 C and 100 mL TMB substrate was added. The reaction was stopped after 10 min at 25 C by the addition of 0.3 M sulfuric acid and absorbance was determined as described above. Indirect immunofluorescence staining.—In the indirect immunofluorescence staining assay, C. neoformans var. neoformans cells were harvested and fixed by fixation fluid containing 40 mL formaldehyde, anhydrous disodium hydrogen phosphate 6.5 g, sodium biphosphoricum 4.0 g in 1000 mL ddH2O. The cells were washed twice in phosphate buffered saline (PBS) and adjusted to 5 3 106– 1 3 107 cells/mL. Forty microliter cell suspension was added to 10 mL 20 mg/mL purified rabbit antibody and 50 ml deactivated normal rabbit serum diluted 1 : 20 in PBS and incubated at 4 C for 30 min. After washing the cells were incubated with fluorescein-labeled goat anti-rabbit IgG (Sigma-Aldrich Co., USA) containing 0.01% Evans blue at 4 C for 30 min and were observed under fluorescence microscope (Leica, Germany). C. gattii and T. asahii were used as the negative control.

RESULTS Phylogenetic relationship of potential Cpl1 orthologs.— Using the Cpl1 sequence of C. neoformans var. neoformans (GenBank accession number AAW42354.1) as query in BLASTP and TBLASTN, 28 putative orthologs belonging to 19 fungal species have an E value # 1210. This also has been confirmed with reciprocal BLAST. Notably putative orthologs were not found in Candida or Aspergillus. Phylogenetic analysis was performed using the full-length amino acid sequences of Cpl1 and its putative orthologs. Among the 28 putative orthologs, those from C. neoformans var. grubii (n 5 1), C. gattii (n 5 1), Tremella mesenterica (n 5 1) and T. asahii var. asahii (n 5 1) formed a single cluster with C. neoformans var. neoformans (SUPPLEMENTARY FIG. 1). Putative orthologs identified in C. neoformans var. grubii and C. gattii were phylogenetically closely related to the Cpl1 protein with amino acid identity of 92% and 91%, respectively (SUPPLEMENTARY TABLE I). On the other hand, the putative orthologs found in T. mesenterica and T. asahii var. asahii were more distantly related to the Cpl1 in the cluster with amino acid identity of 61% and 58%, respectively. Post-translational modifications in Cpl1.—The theoretical molecular mass of full length Cpl1 was 20.8kDa with pI of 5.25. Cpl1 protein was predicted to be localized on the cell wall or secreted to extracellular environment. An N-terminal signal peptide was predicted with cleavage site located between amino acid position 30 and 31 (VTAQAA). Eleven potential

42

MYCOLOGIA

FIG. 1. SDS-PAGE (A) and western blot analysis (B) of Cpl1 protein expressed in Pichia pastoris. A. Lane 1: induced supernatant of positive transformant (pPIC9KCPL1/GS115) at 3 d; Lane 2: induced supernatant of control transformant (pPIC9K/GS115); Lane 3: protein marker; Lane 4: His-tag purified protein. B. Lane 1: MAb against Penicillium marneffei Mp1p protein as control; Lane 2: anti-His MAb; Lane 3: protein marker; Lane 4: serum from a mouse infected with C. neoformans var. neoformans; Lane 5: serum from an uninfected mouse. O-glycosylation

sites were found but no N-glycosylation sites could be identified.

Identification and expression of Cpl1 in P. pastoris.— A truncated form of the CPL1 gene, where the Nterminal cleavable signal peptide of 26 amino acid residues were removed, was cloned downstream of the a-factor secretion domain in the P. pastoris vector pPIC9K to achieve protein secretion. CPL1 gene encoding 169 amino acid residues with a predicted molecular mass of 18.6 kDa was produced in the yeast protein expression system (FIG. 1A). Western blotting analysis of Cpl1 with sera from mice infected with C. neoformans var. neoformans strain ATCC 32045 and anti-His Mab demonstrated the immunoreactivity of Cpl1 protein expressed from P. pastoris (FIG. 1B).

TABLE I. Cpl1 detection in different C. neoformans var. neoformans culture supernatant by antigen EIA* Detection of Cpl1 Culture medium

Cultures

RPMI-1640 YPD YPM-R Sabouraud C. neoformans culture RPMI-1640 supernatant filtrate YPD YPM-R Sabouraud

OD450 value

EIAa

0.125 0.172 0.285 0.148 0.384 0.901 1.961 0.922

negative negative positive negative positive positive positive positive

* EIA: enzyme immunoassay. a The cutoff value was determined as 2.13 negative control. The mean OD450 value of negative control was 0.082 in RPMI-1640, 0.108 in YPD, 0.100 in YPM-R, 0.093 in normal rabbit serum and 0.089 in Sabouraud.

FIG. 2. Detection of Cpl1 protein in the culture supernatant of C. neoformans var. neoformans using sandwich enzyme immunoassay (line with triangles). C. neoformans var. neoformans was cultured in YPM-R medium. YPMR medium without C. neoformans var. neoformans was used as baseline (line with squares). Rabbit anti-Cpl1 antibody was used as capture antibody, while guinea pig anti-Cpl1 antibody was used as detection antibody.

Detection of Cpl1 in culture filtrates.—RPMI-1640, YPD, liquid Sabouraud and YPM-R were used as the culture medium for C. neoformans var. neoformans. The concentrations of Cpl1 in different culture supernatants were detected with anti-Cpl1 antibody. The cutoff value was determined as 2.13 the negative control OD450 value. Among the four tested culture media, the concentration of Cpl1 was found to be highest in YPMR medium (TABLE I). To further analyze the kinetics of Cpl1 in YPM-R medium, culture supernatants were harvested at different times. The concentration of Cpl1 was found to be increased gradually during cultivation in which the OD450 rise from 0.348 at h 18 to 0.981 at h 160 (FIG. 2). The sensitivity and specificity of Cpl1 antigen EIA.—To determine the analytical sensitivity of Cpl1 antigen EIA, a series of known concentration of recombinant Cpl1 and native Cpl1 in dilutions of culture filtrates were used. The detection limit of recombinant Cpl1 was found be approximately 240 pg/mL of Cpl1 (FIG. 3A). To evaluate the specificity of the EIA test, culture supernatants of C. gattii, T. asahii, Candida spp, Aspergillus spp and P. marneffei were used. Cpl1 protein was detected only in the supernatants of C. neoformans var. neoformans and C. neoformans var. grubii (FIG. 3B). There was no cross-reactivity between C. neoformans var. neoformans Cpl1 protein and the putative orthologs in C. gattii or T. asahii. The sensitivity and specificity of Cpl1 antibody EIA.— Anti-Cpl1 antibody was detected in the serum samples

CAI ET AL.: CPL1 PROTEIN IN CRYPTOCOCCUS

43

FIG. 4. Evaluation of the sensitivity and specificity of rabbit anti-Cpl1 antibody enzyme immunoassay. Cpl1 protein was coated on a 96-well plate. Rabbit antibody against C. albicans Csa2 (square), A. fumigatus Afmp1 (triangle), A. fumigatus Afmp4 (asterisk), and P. marneffei Mp1p (cross) were used as controls. Anti-Cpl1 antibody was detected only in the serum samples from rabbits immunized with C. neoformans var. neoformans Cpl1 protein (rhombus).

showed that Cpl1 protein was specifically located on the surface of C. neoformans var. neoformans (FIG. 5A) but was not found in C. gattii (FIG. 5C) or T. asahii (FIG. 5E). DISCUSSION FIG. 3. Evaluation of the sensitivity and specificity of Cpl1 enzyme immunoassay. Culture filtrates were collected after 120 h incubation. A. Evaluation of analytical sensitivity by detection of recombinant Cpl1 protein by Clp1 antigen EIA. B. Evaluation of the specificity by detection of Cpl1 antigen with different fungal culture filtrates by PAbs-PAbs Cpl1 enzyme immunoassay. Cpl1 protein was detected only in the supernatants of C. neoformans var. neoformans and C. neoformans var. grubii. No cross reactivity was observed between C. neoformans var. neoformans Cpl1 protein and the putative orthologues in C. gattii, T. asahii.

from rabbits immunized with C. neoformans var. neoformans Cpl1 protein. The detection limit of immunized rabbit sera is 1/8000 (FIG. 4). However, no anti-Cpl1 antibody could be detected in the serum samples of rabbits immunized with C. albicans Csa2, A. fumigatus Afmp1p and Afmp4p or P. marneffei Mp1p. Distribution of Cpl1 in C. neoformans examined by indirect immunofluorescence.— The distribution of Cpl1 protein in C. neoformans var. neoformans was determined by immunofluorescence staining with anti-Cpl1-Ab. The indirect immunofluorescence assay

The Cryptococcus capsule is an important virulence factor (O’Meara and Alspaugh 2012). The CPL1 gene first was reported in 2008 to be an important gene for capsule formation and virulence (Liu et al. 2008). Because it was proposed to produce a putative secreted protein, we sought to identify and examine the various characteristics of Cpl1. Our bioinformatic analysis suggested that Cpl1 protein orthologs with high amino acid identity were identified only in C. neoformans var. neoformans and C. neoformans var. grubii, with distantly related orthologs identified in C. gattii, T. asahii and T. mesenterica. No putative orthologs were identified in other pathogenic fungi such as Aspergillus spp., Penicillium spp. and Candida spp. Using anti-Cpl1 antibody generated in Cpl1-immunized rabbits, high abundance of Cpl1 protein was detected in culture supernatant of C. neoformans var. neoformans, confirming that Cpl1 indeed exists and can be secreted by C. neoformans var. neoformans. We also have shown that Cpl1 protein is present on the cell surface by immunostaining. In vitro testing has confirmed that anti-Cpl1 antibody did not cross react with proteins in the culture supernatant of C. gattii and other commonly encountered pathogenic fungi.

44

MYCOLOGIA The specific nature of the Cpl1 in C. neoformans var. neoformans also makes it an attractive target for diagnostic testing. Traditionally cryptococcal capsule can be seen by microscopy negative staining with India ink; the capsule is an important phenotypic feature in clinical microbiology laboratories for the rapid diagnosis of Cryptococcus especially in patients with meningitis. However, the sensitivity of microscopy using India ink is low (Saha et al. 2009). Detection of cryptococcal glucuronoxylomannan has been used in recent years (Versalovic et al. 2011). Despite being a sensitive and specific test, there are reports of reduced sensitivity of these immunoassays for C. neoformans serotype C because this serotype has least O-acetylation and greatest xylose substitution (Kozel et al. 2003, Percival et al. 2011). False-negative cryptococcal antigen test has been reported for small-colony variants, as well as for cerebrospinal fluid (CSF) samples with low antigen concentration (To et al. 2006) and prozone phenomenon (Stamm and Polt 1980). Furthermore, false-positive cryptococcal antigen test can be a result of infections due to T. asahii (formerly T. beigelii) Capnocytophaga, Schizophyllum commune and non-infective causes such as malignancy, the presence of rheumatoid factors and contaminations with agar, agarose and syneresis fluid (McManus and Jones 1985, Blevins et al. 1995, Saha et al. 2009, Chan et al. 2014). Even when pronase has been used to pretreat the clinical specimens, a falsepositive cryptococcal antigen result in the CSF occasionally may occur in cancer patients (Kontoyiannis 2003). Cpl1 protein was not detected in the culture supernatant of T. asahii, which is a well known fungus causing false positive cryptococcal latex agglutination test, and therefore may represent a specific diagnostic target for C. neoformans infection. In summary, we have confirmed that the Cpl1 protein is surface protein specifically secreted by C. neoformans var. neoformans. The role of Cpl1 in capsule formation and virulence needs to be further characterized. Because Cpl1 protein is also secreted in abundance, it should be further evaluated as a potential diagnostic target in antigen detection. ACKNOWLEDGMENTS This work was supported by GDUPS 2010, grant 2011AA02A116 and the Ted Sun Foundation. We thank

FIG. 5. Indirect immunofluorescence micrographs of C. neoformans var. neoformans stained with rabbit anti-Cpl1 antibody (A), showing green fluorescence at the surface of the Cryptococcus. Evans blue was used as a counterstain. C.

r gattii (C), and T. asahii (E) were stained with rabbit antiCpl1 antibody as the negative control. These are corresponding bright field images for C. neoformans var. neoformans (B), C. gattii (D), and T. asahii (F). Original magnification 4003.

CAI ET AL.: CPL1 PROTEIN IN CRYPTOCOCCUS Dr J.Y.C. Lo (Public Health Laboratory Centre of Hong Kong) for providing the Cryptococcus gattii strain. This article is dedicated to Professor Xiao-Yan Che, whose death in 2013 was a great loss to the scientific community.

LITERATURE CITED Blevins LB, Fenn J, Segal H, Newcomb-Gayman P, Carroll KC. 1995. False-positive cryptococcal antigen latex agglutination caused by disinfectants and soaps. J Clin Microbiol 33:1674–1675. Brandt ME, Bragg SL, Pinner RW. 1993. Multilocus enzyme typing of Cryptococcus neoformans. J Clin Microbiol 31: 2819–2823. Bulmer GS, Sans MD, Gunn CM. 1967. Cryptococcus neoformans I. Nonencapsulated mutants. J Bacteriol 94:1475–1479. Chan JF, Teng JL, Li IW, Wong SC, Leung SS, Ho PO, To KK, Lau SK, Woo PC, Yuen KY. 2014. Fatal empyema thoracis caused by Schizophyllum commune with cross reactive cryptococcal antigenemia. J Clin Microbiol 52: 683–687, doi:10.1128/JCM.02770-13 Chaturvedi V, Chaturvedi S. 2011. Cryptococcus gattii: a resurgent fungal pathogen. Trends Microbiol 19:564– 571, doi:10.1016/j.tim.2011.07.010 Chim CS, Liang R, Wong SS, Yuen KY. 2000. Cryptococcal infection associated with fludarabine therapy. Am J Med 108:523–524, doi:10.1016/S0002-9343(99)00428-3 Daly R, Hearn MT. 2005. Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. J Mol Recognit 18:119–138, doi:10.1002/jmr.687 Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A. 2005. Protein identification and analysis tools on the ExPASy server. John M Walker, ed. Humana Press: The proteomics protocols handbook. p 571–607. Hao W, Pan YX, Ding YQ, Xiao S, Yin K, Wang YD, Qiu LW, Zhang QL, Woo PC, Lau SK et al. 2008. Well characterized monoclonal antibodies against cell wall antigen of Aspergillus species improve immunoassay specificity and sensitivity. Clin Vaccine Immunol 15: 194–202, doi:10.1128/CVI.00362-07 Kontoyiannis DP. 2003. What is the significance of an isolated positive cryptococcal antigen in the cerebrospinal fluid of cancer patients? Mycoses 46:161–163, doi:10.1046/j.1439-0507.2003.00877.x Kozel TR, Levitz SM, Dromer F, Gates MA, Thorkildson P, Janbon G. 2003. Antigenic and biological characteristics of mutant strains of Cryptococcus neoformans lacking capsular O acetylation or xylosyl side chains. Infect Immun 71:2868–2875, doi:10.1128/IAI.71.5.2868-2875. 2003 Liu OW, Chun CD, Chow ED, Chen C, Madhani HD, Noble SM. 2008. Systematic genetic analysis of virulence in the human fungal pathogen Cryptococcus neoformans. Cell 135:174–188, doi:10.1016/j.cell.2008.07.046

45

McManus EJ, Jones JM. 1985. Detection of a Trichosporon beigelii antigen cross reactive with Cryptococcus neoformans capsular polysaccharide in serum from a patient with disseminated Trichosporon infection. J Clin Microbiol 21:681–685. Mok CC, Lau CS, Yuen KY. 1998. Cryptococcal meningitis presenting concurrently with systemic lupus erythematosus. Clin Exp Rheumatol 16:169–171. Nakai K, Horton P. 1999. PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci 24:34–36, doi:10.1016/S0968-0004(98)01336-X O’Meara TR, Alspaugh JA. 2012. The Cryptococcus neoformans capsule: a sword and a shield. Clin Microbiol Rev 25:387–408, doi:10.1128/CMR.00001-12 Percival A, Thorkildson P, Kozel TR. 2011. Monoclonal antibodies specific for immunorecessive epitopes of glucuronoxylomannan, the major capsular polysaccharide of Cryptococcus neoformans, reduce serotype bias in an immunoassay for cryptococcal antigen. Clin Vaccine Immunol 18:1292–1296, doi:10.1128/CVI.05052-11 Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8:785–786, doi:10.1038/ nmeth.1701 Saha DC, Xess I, Biswas A, Bhowmik DM, Padma MV. 2009. Detection of Cryptococcus by conventional, serological and molecular methods. J Med Microbiol 58:1098– 1105, doi:10.1099/jmm.0.007328-0 Stamm AM, Polt SS. 1980. False-negative cryptococcal antigen test. JAMA 244:1359, doi:10.1001/jama.1980. 03310120047024 Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, VesterChristensen MB, Schjoldager KT, Lavrsen K, Dabelsteen S, Pedersen NB, Marcos-Silva L et al. 2013. Precision mapping of the human O-GalNAc glycoproteome through SimpleCell technology. EMBO J 32: 1478–1488, doi:10.1038/emboj.2013.79 To KK, Cheng VC, Tang BS, Fan YW, Yuen KY. 2006. Falsenegative cerebrospinal fluid cryptococcal antigen test due to small-colony variants of Cryptococcus neoformans meningitis in a patient with cystopleural shunt. Scand J Infect Dis 38:1110–1114, doi:10.1080/00365540600664118 Versalovic J, ed. 2011. Manual of clinical microbiology. Washington: ASM Press. 2630 p. Wang YF, Cai JP, Wang YD, Dong H, Hao W, Jiang LX, Long J, Chan C, Woo PC, Lau SK et al. 2011. Immunoassays based on Penicillium marneffei Mp1p derived from Pichia pastoris expression system for diagnosis of penicilliosis. PLoS One 6:e28796, doi:10.1371/journal.pone.0028796 Wang ZY, Cai JP, Qiu LW, Hao W, Pan YX, Tung ET, Lau CC, Woo PC, Lau SK, Yuen KY et al. 2012. Development of monoclonal antibody-based galactomannoprotein antigen-capture ELISAs to detect Aspergillus fumigatus infection in the invasive aspergillosis rabbit models. Eur J Clin Microbiol Infect Dis 31:2943–2950, doi:10.1007/ s10096-012-1645-3