Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus.

FEMS Microbiology Letters, 362, 2015, fnv010 doi: 10.1093/femsle/fnv010 Advance Access Publication Date: 24 January 2015 Research Letter

R E S E A R C H L E T T E R – Biotechnology & Synthetic Biology

Chaomin Yin1 , Liesheng Zheng2 , Jihong Zhu1 , Liguo Chen2 and Aimin Ma1,3,∗ 1

College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, China, 2 College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China and 3 Key Laboratory of Agro-Microbial Resources and Utilization, Ministry of Agriculture, Wuhan 430070, China

∗ Corresponding author: College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, China. Key Laboratory of Agro-Microbial Resources and Utilization, Ministry of Agriculture, Wuhan 430070, China. Tel: +86-27-87282111; Fax: +86-27-87396057; E-mail: [email protected] One sentence summary: Highly active Pogpd promoter fragment drove eGFP expression in Pleurotus ostreatus. Editor: Gerard Wall

ABSTRACT Developing efficient native promoters is important for improving recombinant protein expression by fungal genetic engineering. The promoter region of glyceraldehyde-3-phosphate dehydrogenase gene in Pleurotus ostreatus (Pogpd) was isolated and optimized by upstream truncation. The activities of these promoters with different lengths were further confirmed by fluorescence, quantitative real-time PCR and Western blot analysis. A truncated Pogpd-P2 fragment (795 bp) drove enhanced green fluorescence protein (egfp) gene expression in P. ostreatus much more efficiently than full-length Pogpd-P1. Further truncating Pogpd-P2 to 603, 403 and 231 bp reduced the eGFP expression significantly. However, the 403-bp fragment between –356 bp and the start codon was the minimal but sufficient promoter element for eGFP expression. Compact native promoters for genetic engineering of P. ostreatus were successfully developed and validated in this study. This will broaden the preexisting repertoire of fungal promoters for biotechnology application. Key words: oyster mushroom; transformation; Agrobacterium tumefaciens

INTRODUCTION Pleurotus ostreatus, or oyster mushroom, is cultivated worldwide due to its short growth period, high adaptability and productivity (Chai et al., 2013). During the growth, P. ostreatus secretes lots of extracellular hydrolytic enzymes which have a potential applications in pulp bleaching, textile, bioremediation, food and medicine industry (Chrapkowska and Podyma 2000; Mazumder et al., 2008; Sun and Liu 2009; Pezzella et al., 2013; Salame et al.,

2013; Liu et al., 2014; Yin et al., 2014a,b). In nature, however, the amount of enzymes produced by fungi is limited because of the influence of growth conditions (Nitta et al., 2004). Additionally, due to differences in glycosylation, the recombinant enzymes expressed in heterologous hosts often have altered properties, making them less suitable for biotechnological applications (Kilaru et al., 2006; Ward 2012). A possible solution to these problems is to develop a homologous expression system.

Received: 14 December 2014; Accepted: 20 January 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected].

1

Downloaded from http://femsle.oxfordjournals.org/ at New York University on April 27, 2015

Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus

2

FEMS Microbiology Letters, 2015, Vol. 362, No. 5

Table 1. Primers used for PCR amplification in this study. Sequences (5 →3 )

Descriptions

Pogpd-1F Pogpd-1R

CGAGCTCCGTTCGTGACTCGCAAT CGGGATCCCGTGGACAGGCTTTTGGGAATA

Primers for Pogpd -1

Pogpd-2F

CGGAATTCGTTGCCCTCAAGGGTCTTC


Pogpd-3F

CGGAATTCCAGTGGCAACCGTTCTTC


Pogpd-4F

CGGAATTCTCTGGAATCGTTATCTCGGT


Pogpd-5F

CGGAATTCTAACAGGATCGGCTCACAC


egF egR

ATGGTGAGCAAGGGCGAG ATGGTGAGCAAGGGCGAG

Primers for eGFP

hpF hpR

ACATGCATGCATATGAAAAAGCCTGAACTCAC CCGCTCGAGCGGCTATTCCTTTGCCCTCGGAC

Primers for hph

QegF QegR

CAGAAGAACGGCATCAAGGTG CTTCTCGTTGGGGTCTTTGC

eGFP primers for qRT-PCR

α-tubulinF α-tubulinR

GTTGGCGTTGGTGGGAGC GCCAGCACTATGCCCGTG

α-tubulin primers for qRT-PCR

M13F M13R

CGCCAGGGTTTTCCCAGTCACGAC AGCGGATAACAATTTCACACAGGA

Primers for sequencing

Restriction enzyme sites are underlined.

Highly active promoters are critical for establishing efficient gene expression and transformation systems (Liu et al., 2013). One of the most frequently used promoters derives from the glyceraldehyde-3-phosphate dehydrogenase (gpd, EC 1.2.1.12) encoding genes which have been proved to be highly expressed in fungi and other higher eukaryotes (Espinosa et al., 2011). The gpd-encoding genes are also expressed constitutively without depending on the carbon or nitrogen source or other specific inducers (Huang, Lu and Li 2014). Therefore, the gpd promoters are widely used for homologous or heterologous gene expressions in different fungi (Hirano et al., 2000; Punt et al., 2002; Kuo, Chou and Huang 2004; Kilaru et al., 2006; Espinosa et al., 2011; Cao, Jiao and Xia 2012; Huang, Lu and Li 2014). In P. ostreatus, we previously isolated the gpd promoter (Pogpd) and successfully applied it to the Agrobacterium-mediated transformation system (Ding et al., 2011). Despite its potential application in gene expression, little is known about the critical parts of Pogpd promoter necessary for the expression of recombinant proteins. Furthermore, with a length of about 1.0 kb, the promoter was, more or less, inconvenient in vector construction. In this study, we constructed five expression vectors with the full-length and four truncated Pogpd promoters to investigate the effects of promoter length on the promoter activity by comparing their efficiencies in driving the expression of enhanced green fluorescence protein (eGFP) gene in P. ostreatus. The results will provide helpful information for the future use of this promoter in the production of recombinant proteins.

MATERIALS AND METHODS Strains, plasmids and growth conditions The P. ostreatus dikaryotic strain Pd739 was kept in Laboratory of Food Microbiology, Huazhong Agricultural University, and maintained at room temperature on potato dextrose agar (PDA, Difco, USA) plate. For the selection and maintenance of transformants, PDA medium was supplemented with 50 μg mL−1 hygromycin (Roche, Germany). Escherichia coli DH5α (Takara, China), used as a host strain for plasmid construction and propagation, was

grown in Luria-Bertani broth (LB, Difco, USA) or on LB plate which, when required, was supplemented with ampicillin (0.1 mg mL−1 ), X-gal (40 μg mL−1 ) and IPTG (10 μg mL−1 ). Agrobacterium tumefaciens strain GV3101 (IMCAS, China), grown in YEB medium (Fluka, USA) containing 100 μg mL−1 kanamycin and 50 μg mL−1 rifampicin (Sigma-Aldrich, USA), was used to transform P. ostreatus. The plasmid pMD18-T (Takara, China) was used as cloning vector. The pCAMBIA1300 vector was purchased from YRGen Biotech Company (China).

Pogpd promoter cloning and expression cassettes construction The Pogpd promoter was amplified from the genomic DNA of P. ostreatus using the primers Pogpd-1F (containing a SacI site) and Pogpd-1R (Table 1) as described by Ding et al. (2011). Four truncated Pogpd promoter fragments were amplified using the common downstream primer Pogpd-1R with BamHI site and the respective upstream primers Pogpd-2F, Pogpd-3F, Pogpd-4F and Pogpd-5F, each carrying an EcoRI site (Table 1). All PCR products were digested with BamHI/EcoRI and cloned into BamHI/EcoRIlinearized pMD-eGFP vector (Ding et al., 2011) to generate pMDPogpdx-eGFP, in which x was the amplified fragment of 960, 795, 633, 403 or 231 bp to drive the eGFP expression. Subsequently, the amplified hygromycin phosphotransferase (hph) gene, in which SphI and XhoI restriction sites were added using primers of hpF and hpR (Table 1), was digested and ligated into the EcoRI (or SacI)-SphI excised vector pMD-Pogpdx-eGFP to generate the eGFP-hph fusion expression cassette driven by the homologous P. ostreatus Pogpd promoter. This fusion construct was then inserted into the pCAMBIA1300 vector backbone after removing the CaMV35S promoter-hph by digestion with EcoRI and XhoI, generating the binary vector Pogpdx-pCAMBIA1300 (Fig. 1a). Five vectors were introduced into A. tumefaciens strains GV3101 through electroporation (Bio-Rad, USA).

Agrobacterium-mediated transformation and transformant screening Agrobacterium-mediated transformation of P. ostreatus was performed as described by Ding et al. (2011). The A. tumefaciens strain


∗

Primers

Yin et al.

3

GV3101 harboring pCAMBIA1300 or pMD-Pogpdx-eGFP was cultivated at 28◦ C in YEB in the presence of the proper selective antibiotics to an OD600 of 0.6–0.8. Collected bacterial cells by centrifugation and suspended in induction medium (IM, 200 μM acetosyringone plus, without antibiotic) to an OD600 of 0.2 and incubated for additional 6 h at 28◦ C with shaking at 150 rpm to pre-induce virulence of A. tumefaciens. Mycelia from P. ostreatus were grown on the middle of sterile microporous membranes (0.45 μm, 25 mm) on PDA for 3 days. Then the membranes inoculated with fungal colonies were dipped into the culture of pre-induced A. tumefaciens for 40 min and placed on an IM agar plate at 25◦ C for 5 days, after which the co-cultivated mycelia were transferred to selection ager medium (SM, containing 50 μg mL−1 hygromycin and 200 μg mL−1 cefotaxime) twice to select putative transformants. Genomic DNA from mycelia of five randomly selected transformants and the control were extracted using the CTAB method (Yin et al., 2014b), and PCR analysis for the existence of hph and eGFP genes was conducted using primers hpF/hpR and egF/egR (Table 1), respectively. For Southern blot analysis, the hph gene fragment obtained previously was digoxigenin (DIG) labeled as a specific probe for signal detecting. Genomic DNA (10 μg) was digested with HindIII, electrophoretically separated on a 1% agarose gel and transferred to HybondN+ nylon membranes (Amersham Bioscience, UK) according to the gel electrophoresis and Southern blotting standard protocols. Membranes were UV-crosslinked and pre-hybridized at 42◦ C for 2 h, followed by overnight hybridization with the denatured probe at 42◦ C. Thereafter, the hybridized membranes were washed twice with 2 × SSC and 0.1% SDS at room temperature for 5 min, twice with 0.5 × SSC and 0.1% SDS at 68◦ C for 15 min

and finally a color reaction was performed according to the manufacturer’s instructions of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Germany).

Fluorescence microscopy eGFP expression was assessed by preparing mycelia of randomly selected P. ostreatus transformants on glass slides after 5 days of growth on plates with hygromycin B. The samples were examined under a Nikon Eclipse 80i fluorescence microscope (Nikon, Japan) with excitation at 455–490 nm. Images were taken under 20 × objective and processed with NIS-Elements BR 3.0 imaging software (Nikon, Japan).

Intracellular protein extraction and eGFP determination Three positive transformants randomly taken from each of the eGFP constructs were grown on cellophane membranes laid over PDA plates for 5 days at 25◦ C. The total proteins were extracted from mature mycelia ground with liquid nitrogen in solution (100 mM Tris-HCl, pH 7.5, 2.5 mM EDTA, 7 mM βmercaptoethanol, 1 mM phenylmethylsulfonyl fluoride and 1% Triton) (Amore, Honda and Faraco 2012). After centrifugation at 15 000 g at 4◦ C for 15 min, the supernatant was recovered for further assays. Protein concentration was determined by the Bradford method (Bradford 1976). Fluorescence intensity was measured with a spectrophotometer (Hitachi F-4600 FL, Tokyo, Japan) at the excitation/emission wavelengths of 481.8/512 nm. Each measurement was expressed as relative fluorescence intensities


Figure 1. Construction of expression vectors with the full-length and truncated Pogpd promoters. (a) Map of the vector Pogpdx-pCAMBIA1300 adopted to study the full-length and four truncated fragments of Pogpd promoter through eGFP gene expression in P. ostreatus. (b) Schematic diagram of full-length Pogpd promoter (Pogpd-1) and its four truncated fragments (Pogpd-2 to Pogpd-5) used in binary plasmids. The fusion expression cassettes of eGFP and hph genes are driven by the Pogpd promoter. The cauliflower mosaic virus terminator (T-35S) is fused to the hph gene C-terminus. All the promoters contain two introns in the initial 200-bp untranslated region of Pogpd gene. The symbols denote the predicted binding domains of HSF (square), NIT2 (inverted triangle), CAAT (up triangle) and ADR1 (circle), respectively.

4


(RFI) per milligram protein by deducting the background effect of wild-type strain (control) grown under the same conditions.

RNA extraction and eGFP gene expression analysis

Western blot analysis of eGFP in P. ostreatus transformants Western blot analysis was performed to check the expression of eGFP gene driven by the Pogpd promoter with different lengths. Total protein, which was extracted from the transformants as previously described and separated by size with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (15%), was transferred from the gel to nitrocellulose membranes (Amersham Biosciences, UK) as described by Yin et al. (2014b). The membranes were incubated with 1/1000 anti-GFP antibody (Tiangen, China) for 2 h in 10 mL mixture (5 mL PBST + 5 mL MPBST + 10 μl of anti-GFP antibody). After washing three times with PBST for 15 min each, the membranes were incubated with the second probe, 1/5000 goat anti-mouse IgG conjugated with horseradish peroxidase (HRP) (Tiangen, China) in 10 mL mixture (5 mL PBST + 5 mL MPBST + 5 μl anti-mouse HRP). Finally, the membranes were rinsed three times with PBST, and bands were detected using 5 mL enhanced chemiluminescent labeling mixture (Amersham Biosciences, UK) with 1 min exposure by the MF-ChemiBIS 3.2 detection system (DNR, Israel).

RESULTS Features of Pogpd promoter A 960-bp flanking sequence upstream of the Pogpd gene was amplified from P. ostreatus Pd739 using the primers Pogpd-1F and Pogpd-1R (Table 1). Three types of binding domains were observed in the Pogpd promoter sequence. A single zinc finger DNA-binding motif (Cys-X2-Cys-X17-Cys-X2-Cys type) of the regulator NIT2 (TATCTA) and an alcohol dehydrogenase gene regulator 1 (ADR1) motif (NGGRGK) were located at –674 and –399 bp while two heat shock factors (HSF) (AGAAN) were located at –704 and –257 bp (Fig. 1b). These binding domains have been reported to appear in the gpd promoter of Tremella fuciformis (Sun et al., 2009) and hydrophobin gene promoter of Beauveria bassiana (Wang, Ying and Feng 2013). Similar to other basidiomycetes (Kuo, Chou and Huang 2004; Fei, Zhao and Li 2006), those consensus-promoter elements, such as the gpd box, pgk box, qut box and qa box in the A. nidulans gpd promoter region (Punt et al., 1990), were not found in the Pogpd region.

Figure 2. PCR and Southern blot analyses of P. ostreatus transformants. (a) PCR analysis of total DNA prepared from five transformants and the nontransformed wild-type strain. Lane 1–5: amplification results from the randomly selected transformants controlled by the promoters Pogpd-1 to Pogpd-5. Lane 6: amplification results of negative control using the wild-type strain of P. ostreatus. Lane 7: amplification results of positive control using the water instead of DNA. eGFP, hph and α-tubulin (used as a reference) genes were amplified using specific primers, respectively. (b) Southern blot analysis of P. ostreatus transformants. Genomic DNA of transformants from each deletion group was digested by HindIII and the fragment of hph gene was used as the probe. Lane M: marker; Lane 1–5: transformants controlled by promoters Pogpd-1 to Pogpd-5; Lane 6: the wild-type strain of P. ostreatus.

Specific PCR and Southern blot analysis of P. ostreatus transformants The randomly selected hygromycin-resistant transformants were analyzed by PCR to verify the presence of the transforming DNA. The PCR was performed with the primers of hpF/R and egF/R (Table 1) on genomic DNA extracted from the mycelia of the transformants. As expected, two target bands of 0.7 and 1.0 kb were obtained from all the five transformants, indicating the presence of the eGFP and hph genes in the transformants (Fig. 2a). Additionally, the integrity of the full expression cassette in all the transformants was demonstrated by PCR (data not shown). To analyze the integration mode of transforming DNA, we performed Southern blot analysis using a 1.0-kb fragment of the coding region of hph gene as the probe. Specific bands with different lengths were detected in the transformants derived from the HindIII-digested genomic DNA of Pogpdx-pCAMBIA1300 (Fig. 2b). The non-transformed mycelium did not show any hybridization. These results indicated random insertion of the T-DNA into the genomic DNA of different transformants.


Total RNA samples were extracted using the TRIzol Reagent (Invitrogen, USA). The first-strand cDNA was synthesized by using PrimeScript RT Reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, China). To determine the expression levels of the eGFP gene in different samples, quantitative real-time PCR (qRT-PCR) was performed with SYBR Premix Ex TaqTM (Takara, China) on the ABI ViiA7 Real-Time PCR System (Applied Biosystems, USA) using α-tubulin gene as endogenous control. Specific primers for αtubulin gene (Table 1) and eGFP gene (Table 1) were synthesized in Invitrogen Company (China). According to the manufacture’s protocol, the conditions of qRT-PCR were as follows: 95◦ C for 30 s, followed by 40 cycles at 95◦ C for 5 s and 60◦ C for 31 s. Each qRT-PCR reaction was carried out in independent triplicate trials.

Yin et al.

5


Figure 3. Expression of eGFP in P. ostreatus transformants. Detection for fluorescence under UV light (left column) and corresponding phase-contrast micrographs (right column) are shown with the same microscope equipment with an excitation filter at 450–490 nm, a dichroic filter at 505 nm and an emission filter at 520 nm. (a–e) indicate transformants controlled by promoters Pogpd-1 to Pogpd-5, (f) is the negative control (non-transformed wild-type P. ostreatus strain). Images were taken with 20 × fields of view, bar = 100 μm.

6


eGFP visualization and fluorescence detection of P. ostreatus transformants By fluorescence microscopy, distinct green fluorescence could be observed from Pogpdx-pCAMBIA1300-derived transformants (Fig. 3). Pogpd-1, Pogpd-2, Pogpd-3 and Pogpd-4 were able to drive highly stable and efficient eGFP expression in individual transformants, with fluorescence emission extending to the entire hyphae. However, no obvious green fluorescence was observed from the transformants with eGFP expression driven by Pogpd-5. In addition, five different transformants and a wild-type strain were assayed for fluorescence with a spectrofluorimeter. Their RFI were measured with 0.05 mg mL−1 protein solution at the maximal excitation and emission wavelengths of 481.8 and 512 nm, respectively (Fig. 4). The result was consistent with previous reports (Wang, Ying and Feng 2013; Huang, Lu and Li 2014). Besides, the maximal RFI (11403.9 ± 1683.6) observed in

the transformant controlled by the truncated Pogpd-2 (795 bp) was 1.6-fold higher than that by the full-length Pogpd-1 (960 bp). However, compared to the truncated Pogpd-2, further truncated Pogpd-3 (633 bp), Pogpd-4 (403 bp) and Pogpd-5 (231 bp) reduced the RFI by 72.8, 74.8 and 92.8%, respectively.

qRT-PCR and Western blot analysis of P. ostreatus transformants Quantitative analysis of promoter strength was performed through comparative qRT-PCR by comparing the relative transcript abundance of eGFP gene with the internal control of the α-tubulin gene (Fig. 5a). The qRT-PCR data showed that the eGFP gene was transcribed in all transformants but the transcript level varied. Similar to the trend of RFI data, the highest relative transcription level of eGFP gene was observed in the


Figure 4. The fluorescent emission intensity analysis of P. ostreatus transformants. (a) The fluorescent emission spectra of cell-free extracts from the transformants controlled by promoters Pogpd-1 to Pogpd-5. (b) The fluorescent emission intensities of the transformants controlled by promoters Pogpd-1 to Pogpd-5 after subtracting the background fluorescent emission of the control (non-transformed wild-type P. ostreatus strain). The values are the mean values ± SD of three independent experiments. Bars marked differ significantly (P < 0.05, Tukey’s test).

Yin et al.

transformants controlled by Pogpd-2 (795 bp). However, compared with Pogpd-2, Pogpd-1 (960 bp), Pogpd-3 (633 bp), Pogpd-4 (403 bp) and Pogpd-5 (231 bp) reduced the eGFP transcript level by 36.2, 77.4, 84.3 and 97.3%, respectively. The promoter activities of these five Pogpd promoters with different lengths were further confirmed by Western blot analysis using antiGFP antibody and antimouse HRP (Fig. 5b). The Western blot analysis data revealed that a strong band at the expected molecular weight range of 68 kDa [eGFP MW (27 kDa) + hph MW (38 kDa)] was observed in the transformants containing Pogpd-1, Pogpd-2, Pogpd-3 and Pogpd-4, thus confirming the expression and correct folding of eGFP protein. The corresponding experiments with the wild-type strain and the transformant containing Pogpd-5 did not show any bands, indicating the absence of detectable eGFP expression.

DISCUSSION Promoter is not only an important regulatory element in gene expression but also an important constituent part in the genetic engineering expression vector, and an efficient promoter is also

significant for expression proteins (Cong et al., 2014). Native promoters are the preferred promoters for genetic engineering of edible mushrooms, because they are more efficient in directing gene expression and reducing the methylation than heterologous ones in some species (Cong et al., 2014; Huang, Lu and Li 2014). In this study, we constructed five expression vectors with the full-length and truncated native Pogpd promoters to drive the eGFP expression in fusion with the hph gene in P. ostreatus. As presented above, Pogpd-2 has proved to be the highly active fragment of the Pogpd promoter. With essential binding domains of HSF, NIT2 and ADR1 as well as a C/T-rich region, Pogpd2 showed a significantly higher activity than the full-length and other truncated promoters. Interestingly, we only observed a weak green fluorescence in transformants containing Pogpd-5. These transformants did not grow in the SM medium and could only be cultured in SM medium with 200 μg mL−1 cefotaxime. So we speculated that the truncated Pogpd-5 promoter (231 bp) could not drive eGFPhph efficient expression. Compared to the Pogpd-5 promoter, a strong and bright green fluorescence in transformants containing Pogpd-4 promoter (403 bp) was observed. This showed that the deletion region from –356 to –184 containing a binding domain of the transcription factor HSF probably led to the eGFP expression obstacle. Previous studies described a number of factors for hampering transgene expression of eGFP in basidiomycetes, such as inactivation of transforming DNA by preferential methylation (Mooibroek et al., 1990), inactivation of gene expression of AT-rich sequences (Scholtmeijer et al., 2001) and need of introns for mRNA accumulation (Burns et al., 2005). But in this study, we speculate that a positive regulatory element may exist in the 173-bp region upstream of Pogpd-5 promoter. Moreover, studies have confirmed that the fungal gpd promoters usually contain two boxes, the gpd-box (a region highly conserved in A. nidulans gpd promoter) and the ct-box (a proximal C/T-rich region), which are important for their activity (Punt et al., 1990). However, only the ct-box was found in most of the fungal promoters analyzed (Kuo, Chou and Huang 2004; Nitta et al., 2004; Fei, Zhao and Li 2006; De Maeseneire et al., 2008), and few of them were observed to contain both boxes (Punt et al., 1990; Liao et al., 2008; Espinosa et al., 2011). In Pogpd promoter region, a 11-bp C/T-rich region was observed between the TATA box and the initial transcription site. A similar phenomenon also appeared in the cryparin promoter of Cryphonectria parasitica (Kwon et al., 2009). Studies have confirmed that the proximal ct-box alone seemed enough to drive the expression of a protein, but in the presence of the gpd-box, the maximal expression levels would be reached (Punt et al., 1990; Liao et al., 2008). In this study, the Pogpd-5 promoter (231 bp) which contains proximal ct-box alone could not drive eGFP expression efficiently. Thus, we considered that lack of some important regulatory elements in Pogpd promoter region will result in dysfunction in initiating the transcription of eGFP::hph fusion gene. Addtionally, the 403-bp promoter region (Pogpd-4) was sufficient in conferring the eGFP and hph gene fusion expression in P. ostreatus, suggesting that a region from –356 to +47 was required for the function of the Pogpd promoter. In other fungi, some minimal and functional gpd promoters have been reported, including the 946-bp promoter from Metarhizium acridum (Cao, Jiao and Xia 2012), the 726-bp promoter from B. bassiana (Liao et al., 2008), the 630-bp promoter from A. terreus (Huang, Lu and Li 2014), the 442-bp promoter from Lentinus edodes (Hirano et al., 2000), the 190-bp promoter from Candida bombicola (Van Bogaert et al., 2008) and the 187-bp promoter from Penicillium camemberti (Espinosa et al., 2011). The gpd promoters from


Figure 5. Relative transcript levels of eGFP gene and Western blot analysis of eGFP expression in P. ostreatus transformants. (a) Relative transcript levels of eGFP gene. 1 to 5 indicate transformants controlled by promoters Pogpd-1 to Pogpd-5. The expression ratios are calculated according to the 2− C t method and the expression level of eGFP in the transformant controlled by Pogpd-5 was used as a reference. Bars represent SDs of three independent replicates. In both assays, the α-tubulin gene was used as an endogenous control. (b) Western blot analysis of eGFP expression. Lane M: protein marker; Lane 1: the wild-type P. ostreatus strain, Lane 2–6: transformants controlled by promoters Pogpd-5 to Pogpd-1.

7

8


FUNDING This work was supported by grants from the National Natural Science Foundation of China (No. 31172011 and No. 30771502). Conflict of interest statement. None declared.

REFERENCES Amore A, Honda Y, Faraco V. Enhanced green fluorescent protein expression in Pleurotus ostreatus for in vivo analysis of fungal laccase promoters. Appl Biochem Biotech 2012;168:761–9. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54. Burns C, Gregory KE, Kirby M, et al. Efficient GFP expression in the mushrooms Agaricus bisporus and Coprinus cinereus requires introns. Fungal Genet Biol 2005;42:191–9. Cao Y, Jiao R, Xia Y. A strong promoter, PMagpd, provides a tool for high gene expression in entomopathogenic fungus, Metarhizium acridum. Biotechnol Lett 2012;34:557–62. Chai R, Qiu C, Liu D, et al. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping. PLoS One 2013;8:e61693. Chrapkowska KJ, Podyma W. Effect of culture conditions of Pleurotus ostreatus (Fr.) Kumm. on cellulases complexes activity in post-cultivated substrates. Acta Microbiol Pol 2000;49:149–56. Cong WR, Liu Y, Li QZ, et al. Cloning and analysis of a functional promoter of fungal immunomodulatory protein from Flammulina velutipes. Mol Biol Rep 2014;41:4381–7. DeMaeseneire SL, Dauvrin T, Jonniaux JL, et al. Cloning and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene and the use of its promoter for expression in My-

rothecium gramineum, a novel expression host. FEMS Microbiol Lett 2008;281:140–6. Ding Y, Liang S, Lei J, et al. Agrobacterium tumefaciens mediated fused egfp-hph gene expression under the control of gpd promoter in Pleurotus ostreatus. Microbiol Res 2011;166:314–22. Espinosa Y, Trebotich J, Sepulveda F, et al. Production of a ´ heterologous recombinant protein using fragments of the glyceraldehyde-3-phosphate dehydrogenase promoter from Penicillium camemberti. World J Microb Biot 2011;27:3019–23. Fei X, Zhao MW, Li YX. Cloning and sequence analysis of a glyceraldehyde-3-phosphate dehydrogenase gene from Ganoderma lucidum. J Microbiol 2006;44:515–22. Hamer JE, Timberlake WE. Functional organization of the Aspergillus nidulans trpC promoter. Mol Cell Biol 1987;7:2352–9. Hirano T, Sato T, Yaegashi K, et al. Efficient transformation of the edible basidiomycete Lentinus edodes with a vector using a glyceraldehyde-3-phosphate dehydrogenase promoter to hygromycin B resistance. Mol Gen Genet 2000;263:1047–52. Huang X, Lu X, Li JJ. Cloning, characterization and application of a glyceraldehyde-3-phosphate dehydrogenase promoter from Aspergillus terreus. J Ind Microbiol Biot 2014;41: 585–92. Kilaru S, Hoegger PJ, Majcherczyk A, et al. Expression of laccase gene lcc1 in Coprinopsis cinerea under control of various basidiomycetous promoters. Appl Microbiol Biot 2006;71:200–10. Kuo CY, Chou SY, Huang CT. Cloning of glyceraldehyde-3phosphate dehydrogenase gene and use of the gpd promoter for transformation in Flammulina velutipes. Appl Microbiol Biot 2004;65:593–9. Kwon BR, Kim MJ, Park JA, et al. Assessment of the core cryparin promoter from Cryphonectria parasitica for heterologous expression in filamentous fungi. Appl Microbiol Biot 2009;83:339– 48. Liao XG, Fang WG, Zhang YJ, et al. Characterization of a highly active promoter, PBbgpd, in Beauveria bassiana. Curr Microbiol 2008;57:121–6. Liu XL, Zheng XQ, Qian PZ, et al. Purification and characterization of a novel fibrinolytic enzyme from culture supernatant of Pleurotus ostreatus. J Microbiol Biotech 2014;24:245–53. Liu Y, Koh CM, Sun L, et al. Characterization of glyceraldehyde3-phosphate dehydrogenase gene RtGPD1 and development of genetic transformation method by dominant selection in oleaginous yeast Rhodosporidium toruloides. Appl Microbiol Biot 2013;97:719–29. Mazumder S, Bose S, Bandopadhyay A, et al. Study of laccase production by Pleurotus ostreatus in a 5 l bioreactor and application of the enzyme to determine the antioxidant concentration of human plasma. Lett Appl Microbiol 2008;47: 355–60. Mooibroek H, Kuipers AG, Sietsma JH, et al. Introduction of hygromycin B resistance into Schizophyllum commune: preferential methylation of donor DNA. Mol Gen Genet 1990;222:41–8. Nitta Y, Miyazaki Y, Nakamura M, et al. Molecular cloning of the promoter region of the glyceraldehyde-3-phosphate dehydrogenase gene that contributes to the construction of a new transformation system in Coriolus versicolor. Mycoscience 2004;45:131–6. Pezzella C, Lettera V, Piscitelli A, et al. Transcriptional analysis of Pleurotus ostreatus laccase genes. Appl Microbiol Biot 2013;97:705–17. Punt PJ, Dingemanse MA, Kuyvenhoven A, et al. Functional elements in the promoter region of the Aspergillus nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase. Gene 1990;93:101–9.


different microorganisms seem to have different regulatory characteristics. Furthermore, truncating Pogpd-2 to Pogpd-3 caused a drastic RFI reduction of 72.8% in transgenic colonies, indicating that a positive regulatory element might exist in the 162-bp region upstream of Pogpd-3. Sequence analysis showed that two binding domains (HSF and NIT2) were located in this deletion region. Wang, Ying and Feng (2013) confirmed that mutation of the NIT2 binding domain of B. bassiana hydrophobin gene promoter caused a 51% RFI decrease. So we considered that the HSF and NIT2 binding domains were important in regulating the gene expression. However, the deletion from –586 to –356 resulted in a slight reduction of RFI compared with the Pogpd-3 transformant, showing that the regulatory element ADR1 located between –586 and –356 nt was not a strong positive regulator. Besides, the fulllength Pogpd-1 was much less efficient in driving eGFP expression than the truncated Pogpd-2, suggesting possible existence of negative repressive element(s) in the 165-bp region upstream of Pogpd-2. A motif search found a CAAT box located in this region. Hamer and Timberlake (1987) reported that truncation of the CAAT motif does not influence its gene expression in Aspergillus nidulans, implying that there were some other regions for the negative regulation of eGFP expression in P. ostreatus. In summary, Pogpd-2 could drive the expression of eGFP gene much more efficiently than the full-length and other truncated Pogpd promoters. This showed that Pogpd-2 is the highly active fragment of the Pogpd promoter and has a great potential for high expression of target genes in P. ostreatus. The results from this research broaden the repertoire of fungal promoters for biotechnology application.

Yin et al.

Punt PJ, van Biezen N, Conesa A, et al. Filamentous fungi as cell factories for heterologous protein production. Trends Biotechnol 2002;20:200–6. Salame TM, Knop D, Levinson D, et al. Redundancy among manganese peroxidases in Pleurotus ostreatus. Appl Environ Microb 2013;79:2405–15. ¨ Scholtmeijer K, Wosten HA, Springer J, et al. Effect of introns and AT-rich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schizophyllum commune. Appl Environ Microb 2001;67:481–3. Sun SJ, Chen DX, Xie BG, et al. Isolation of GPD promoter from Tremella fuciformis and driving expression of EGFP gene. DNA Cell Biol 2009;28:65–70. Sun Y, Liu J. Purification, structure and immunobiological activity of a water-soluble polysaccharide from the fruiting body of Pleurotus ostreatus. Bioresource Technol 2009;100: 983–6.

9

Van Bogaert IN, De Maeseneire SL, Develter D, et al. Cloning and characterisation of the glyceraldehyde 3-phosphate dehydrogenase gene of Candida bombicola and use of its promoter. J Ind Microbiol Biot 2008;35:1085–92. Wang ZL, Ying SH, Feng MG. Recognition of a core fragment of Beauveria bassiana hydrophobin gene promoter (Phyd1) and its special use in improving fungal biocontrol potential. Microb Biotechnol 2013;6:27–35. Ward OP. Production of recombinant proteins by filamentous fungi. Biotechnol Adv 2012;30:1119–39. Yin C, Zhao W, Zheng L, et al. High-level expression of a manganese superoxide dismutase (PoMn-SOD) from Pleurotus ostreatus in Pichia pastoris. Appl Biochem Biotech 2014a;174:259– 69. Yin C, Zheng L, Chen L, et al. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus. Appl Biochem Biotech 2014b;172:2119–31.


Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

A cytolytic protein from the edible mushroom, Pleurotus ostreatus.

Iron bioaccumulation in mycelium of Pleurotus ostreatus.

Detoxification of 5-hydroxymethylfurfural by the Pleurotus ostreatus lignolytic enzymes aryl alcohol oxidase and dehydrogenase.

Degradation of Green Polyethylene by Pleurotus ostreatus.

Somatic transposition and meiotically driven elimination of an active helitron family in Pleurotus ostreatus.

Somatic transposition and meiotically driven elimination of an active helitron family in Pleurotus ostreatus.

Identification and Characterization of Small Noncoding RNAs in Genome Sequences of the Edible Fungus Pleurotus ostreatus.

Purification and characterization of a veratryl alcohol oxidase enzyme from the lignin degrading basidiomycete Pleurotus ostreatus.

Potential of Pleurotus ostreatus mycelium for selenium absorption.

Differential Expression of Laccase Genes in Pleurotus ostreatus and Biochemical Characterization of Laccase Isozymes Produced in Pichia pastoris.

Biosynthesis and characterization of silver nanoparticles produced by Pleurotus ostreatus and their anticandidal and anticancer activities.

On the specificity of mushroom Pleurotus ostreatus and Pleurotus spodoleucus extracts.

Effects of processing on carbendazim residue in Pleurotus ostreatus.

Purification and characterization of an extracellular laccase from solid-state culture of Pleurotus ostreatus HP-1.

Baculovirus expression of the glycoprotein gene of Lassa virus and characterization of the recombinant protein.

High-level expression of a manganese superoxide dismutase (PoMn-SOD) from Pleurotus ostreatus in Pichia pastoris.

New lipases by mining of Pleurotus ostreatus genome.

Characterization of an Anti-gout Xanthine Oxidase Inhibitor from Pleurotus ostreatus.

A novel strategy for production of a highly expressed recombinant protein in an active form.

Recombinant expression and characterization of biologically active protein delta homolog 1.

Construction of a Synthetically Engineered nirB Promoter for Expression of Recombinant Protein in Escherichia coli.

Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR.

Cholesterol-lowering effect of the mushroom Pleurotus ostreatus in hereditary hypercholesterolemic rats.