ARTICLE IN PRESS Developmental and Comparative Immunology ■■ (2015) ■■–■■

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.)

1 2 3 4 5

Zhangang Xiao a,b,*, Jing Shen b, Hong Feng a, Hong Liu c, Yaping Wang a, Rong Huang a,**, Q3 Qionglin Guo a a

6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, NT, Hong Kong c Key Laboratory of Aquatic Animal Diseases, Shenzhen Exit & Entry Inspection and Quarantine Bureau, Shenzhen 518001, China b

A R T I C L E

I N F O

Article history: Received 27 November 2014 Revised 2 January 2015 Accepted 8 January 2015 Available online Keywords: prothymosin alpha (ProTα) beta thymosin (Tβ) Common carp Spring viraemia of carp virus (SVCV)

A B S T R A C T

Prothymosin alpha (ProTα) and thymosin beta (Tβ) belong to thymosin family, which consists of a series of highly conserved peptides involved in stimulating immune responses. ProTα b and Tβ are still poorly studied in teleost. Here, the full-length cDNAs of ProTα b and Tβ-like (Tβ-l) were cloned and identified in common carp (Cyprinus carpio L.). The expressions of carp ProTα b and Tβ-l exhibited rise-fall pattern and then trended to be stable during early development. After spring viraemia of carp virus (SVCV) infection, the carp ProTα b and Tβ-l transcripts were significantly up-regulated in some immune-related organs. When transiently over-expressed carp ProTα b and Tβ-l in zebrafish, these two proteins upregulated the expressions of T lymphocytes-related genes (Rag 1, TCR-γ, CD4 and CD8α). These results suggest that carp ProTα b and Tβ may ultimately enhance the immune response during viral infection and modulate the development of T lymphocytes in teleost. © 2015 Published by Elsevier Ltd.

35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63

1. Introduction Since 1965, many research groups have dedicated to the study of thymosins, a mixture of small polypeptides ranging from 1 to 15 kDa in mammals (Goodall et al., 1986). According to the different isoelectric points, thymosins are classified into three categories: α-thymosins (pH < 5.0), β-thymosins (5.0 < pH < 7.0) and γ-thymosins (pH > 7.0) (Hannappel and Huff, 2003). Prothymosin alpha (ProTα), the precursor of α-thymosins, is a small acidic nuclear protein, containing 109–113 amino acids depending on the species, consisting mainly of aspartic and glutamic acid residues (more than 50%) with few hydrophobic amino acids and without any aromatic or sulfur amino acids (Gast et al., 1995). Beta thymosins (Tβs) are a family of highly conserved polar 5-kDa polypeptides consisting of 40–44 amino acid residues. More than 15 kinds of Tβs have been reported (Huff et al., 2001). ProTα is widely distributed and highly conserved in mammalian tissues and cells (Pineiro et al., 2000). More than 10,000 copies per cell of ProTα are found in kidney, liver, spleen, normal lymphocytes

Q1 Q2

Abbreviations: ProTα, Prothymosin alpha; Tβ, Thymosin beta; SVCV, spring viraemia of carp virus; pf, post-fertilization. * Corresponding author. The Chinese University of Hong Kong, Lo Kwee-Seong Integrated Biomedical Sciences Building, Rm 507, Hong Kong. Tel.: +852 6763 0498. E-mail address: [email protected] (Z. Xiao). ** Corresponding author. Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China. Tel: +86 027 68780023.

(predominantly T cells), human T-cell leukemia virus-infected T cells and myeloma cells (B-cell lineage) (Eschenfeldt and Berger, 1986). Several studies have demonstrated ProTα’s function in immune regulatory activity and potentiation of the immune system (Cordero et al., 1991; Oates et al., 1988). Recent studies documented that ProTα also played a regulatory role in apoptosis because of the significance of this process in development, cell turnover, and tumorigenesis (Emmanouilidou et al., 2013; Jiang et al., 2003; Qi et al., 2010; Tripathi et al., 2011). First identified from a cytokine-like activity, Tβs play significant roles in various physiological processes. (Low et al., 1981). Later studies showed that Tβs’ mRNA and protein levels were changed rapidly during differentiation or by different stimuli (Hall, 1991; Huff et al., 2001). Meanwhile, the archetypical Tβ, Tβ4 was found to play a fundamental role in the host defense mechanism (Gondo et al., 1987). Li et al. (2007) reported that human recombinant Tβ4 can promote lymphocyte proliferation and differentiation. Lee et al. (2009) suggested that Tβ4 was a key activator of NK cell cytotoxicity. Two types of Tβ isolated from Chinese mitten crab were also proved to induce human cell proliferation (Gai et al., 2009). A recent study indicated that Tβ homolog may be involved in the immune response in abalone (Kasthuri et al., 2013). All these studies indicated that ProTα and Tβ play important roles in physiological regulation of immunity. To date, ProTα and Tβ genes have been well studied in mammals. However, in teleost, the ProTα gene has only been reported in zebrafish (Danio rerio) and spotted ray (Torpedo marmorata) (Donizetti et al., 2008; Prisco et al., 2009). Interestingly, Donizetti et al. showed that ProTα was duplicated in zebrafish (ProTα a and

http://dx.doi.org/10.1016/j.dci.2015.01.003 0145-305X/© 2015 Published by Elsevier Ltd.

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

ARTICLE IN PRESS Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66

spleen and head kidney tissues confirmed that the experimental carp were infected by SVCV (figure not shown). The SVCV-infected carp at 0 d, 1 d, 3 d, 5 d, 7 d, 10 d after infection (3 infected carp as a group, n = 3) and the various tissue samples of control (n = 3) were immediately removed and frozen in liquid nitrogen, and/or stored at −80 °C for RNA isolation.

ProTα a b). Tβ isoforms have also been identified from several fishes including trout (Salmo gairdneri) (thymosin β11 and thymosin β12), perch (Perca fluviatilis ) (thymosin β12) and paradise fish (Macropodus opercularis) (β-thymosin) (Anathy et al., 2003; Erickson-Viitanen and Horecker, 1984; Low et al., 1992). ProTα was reported to inhibit the replication of virus, and it increased the expression of MHC I which presented endogenous peptides to cytotoxic T cells to kill the virally infected cells and some cancer cells (Baxevanis et al., 1994, 1995; Haritos et al., 1985; Romani et al., 2004). A study reported one of the Tβs, Tβ4, was a key activator of NK cell cytotoxicity (Lee et al., 2009). These studies indicated that carp ProTα b and Tβ-l genes may also play important roles in NK/Tc-mediated cytolysis in viral clearance. Here, we reported the structure and organization of carp (Cyprinus carpio L.) ProTα b and Tβ-l genes and determined their dynamic expression during early development and expression changes after the SVCV infection. We also examined the expression of several immune-related genes in zebrafish model in which carp ProTα b or Tβ-l proteins were over-expressed. Our study will provide insights into the molecular structure and organization of ProTα b and Tβ-l genes and their biological functions in teleost.

Total RNA from different treated tissues was isolated using Trizol Reagent according to the procedure provided by the manufacturer (Invitrogen). Total RNA concentration was measured by BioPhotometer (Eppendorf), and the 260/280 nm absorbance ratio at 1.8:2.0 was accepted as good quality total RNA. The total RNA was stored at −80 °C until use. One microgram RNA was treated with Dnase I, Rnase-free (Fermentas) to avoid the genome contamination. The treated RNA was used to synthesize cDNA with oligo (dT)18 primer using the RevertAidTM First Strand cDNA Synthesis Kit (Fermentas) following the manufacturer’s protocol. The cDNA was stored at −20 °C until use.

2. Materials and methods

2.5. Full length cDNA of carp ProTα b and Tβ-l

2.1. Experimental carp Common carp (Cyprinus carpio L.) at the age of 9 months were supplied by the Henan Institute of Aquaculture, Henan, China. These experimental carps were transported to the laboratory, and transferred to large indoor tanks (1000 L) equipped with a recirculating water system and maintained under water temperature (15– 18 °C) conditions, then acclimated to laboratory conditions for at least 3 days (3 d). The gill, spleen, thymus, head kidney, kidney, intestine, liver, peripheral blood, muscle and skin were collected from three healthy carp and stored at −80 °C for RNA isolation.

The partial cDNA sequences of carp ProTα b and Tβ-l were obtained from the carp head kidney cDNA library constructed by our laboratory. To obtain the full length cDNA of the ProTα b and Tβ-l, the SMARTTM RACE cDNA amplification kit (Clontech) together with the PrimeScriptTM Reverse Transcriptase (Takara) was used following our previous description (Xiao et al., 2010). All primers used in this paper were included in Table 1. The PCR products were cloned to pMD18-T vector (Takara) and the recombinant plasmids were sequenced by the dideoxy chain termination method with M13 universal primers. The sequences were automatically collected on the ABI PRISM 3730 Genetic Analyzer.

2.2. Early development of the carp

2.6. Bioinformatic analysis

The sperms and eggs of carp were supplied by the Laboratory of Fish Gene Engineering, Institute of Hydrobiology, Chinese Academy of Sciences, China. Thawed sperm was added to dry eggs and was followed by water, then, fertilized eggs were incubated in Zug jars with the re-circulated tap water. Temperature was maintained at around 25 °C. The embryos hatched at 2–3 days post-fertilization (pf). And the embryos and larvae during different developmental stages were respectively collected at 4 hour (h), 8 h, 16 h, 24 h, 48 h, 72 h, 1 week (w), 1 month (1 m) pf (60–100 embryos or larvae as a group, n = 60–100), then immediately frozen in liquid nitrogen and/ or stored at −80 °C for RNA isolation.

DNA sequences were analyzed for similarity with other known sequences by BLAST program and the multiple sequence alignments were generated using CLUSTALW program. The protein family signature was identified by InterPro (Mulder et al., 2002) program. The phylogenetic tree was constructed based on the full-length amino acid sequences of partially known ProTαs and Tβs using neighbor-joining algorithm within MEGA version 3.1 (Kumar et al., 2001).

2.3. Viral infection of carp

In order to over-express common carp proTα b and Tβ-l proteins in zebrafish, two recombinant plasmids were constructed using pEGFPN1 vector, which was driven by the cytomegalovirus (CMV) immediate early promoter. Briefly, the inserts coding ProTα b (107 aa) and Tβ-l (43 aa) were obtained by PCR with the respective primers (Table 1). PCR amplifications were performed for one cycle of 94 °C denaturation for 2 min, 30 cycles of 94 °C 30 s; 58 °C 30 s; 72 °C 30 s; and 72 °C elongation for 6 min. Purified fragments were all digested with BamH I and Hind III restriction enzyme, ligated into the pEGFPN1 vector, and transformed into E. coli Top10 cells for adequate recombinant plasmid purification. The recombinant plasmids were confirmed by sequencing and stored at −20 °C until use. The fertilized eggs of zebrafish were supplied by the Laboratory of Fish Gene Engineering, Institute of Hydrobiology, Chinese Academy of Sciences, China. Zebrafish fertilized eggs were divided into four batches with an average of around 500 embryos per batch.

SVCV strain SVC-10/3 (supplied by Office International des Epizooties Reference Laboratory, Shenzhen, China) was propagated in EPC (Nielsen and Buchmann, 2000) cells at 15–18 °C. Cells were grown in TC199 containing 10% fetal calf serum (FCS) and standard concentration of antibiotics. The virus titers, given as tissue culture infective dose (TCID 50/0.1 mL), were calculated by the method of Reed and Muench (Reed, 1938). Nine-month-old carp at an average weight of 100–150 g were raised in clean tanks at 15 °C. This temperature is optimal for SVCV infectivity (Ahne et al., 2002). Sixty carps were randomly divided into two groups, control and SVCV-infection. In the SVCV-infection group, each fish was intraperitoneally injected with 250–300 μL SVCV at a dosage of approximately 107 TCID50/kg body weight. Fishes in the control group were injected with the same amount of saline. At 5 days postinfection, RT-PCR and nested PCR reactions (Koutna et al., 2003) in

2.4. Total RNA and cDNA preparation

2.7. Plasmid construction and carp ProTα b, Tβ-l over-expressed zebrafish model

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132

ARTICLE IN PRESS Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

3

Table 1 Primers used for cloning and expression studies (F: forward primer, R: reverse primer). Primers

Sequence ( 5′–3′)

Application

Thymosin β-3-1: Thymosin β-3-2: Prothymosin α b-3-1: Prothymosin α b-3-2: 3′ Adapter UPM Prothymosin α b F1: Prothymosin α b R1: Thymosin β-F1 Thymosin β-R1 Prothymosin α b-QF1: Prothymosin α b-QR1 Thymosin β-QF1 Thymosin β-QR1 Rag1 QF-1 Rag1 QR-1 CD8α QF1 CD8α QR1 CD4 QF1 CD4 QR1 TCRγ QF1 TCRγ QR1 Common carp β-actin-QF Common carp β-actin-QR Zebrafish β-actin-QF Zebrafish β-actin-QF Oligo dT-adaptor

CAGGCGTCCTCGTGAAGACACAAGC GGGATGAGCCAACCCTCTAGCAACA ATGGCAGACACGAAGGTTGACTCCG TAGGTGGAGGAACAAAACGGGCTG GGCCACGCGTCGACTAGTAC CTAATACGACTCACTATAGGGC CCCAAGCTTATGGCAGACACGAAGGTTG CGCGGATCCCGATCATCATCATCTGTCTTCTGC CCCAAGCTTATGTCTGACAAACCAAACC CGCGGATCCCGCGAGGACGCCTGCTTCTCC ATGGCAGACACGAAGGTTG CCTCATCCACCTCATCGTC CTGACAAACCAAACCTTGAGG CACGAGGACGCCTGCTTC AATACCCGAATCCCAGAC GACGAGTCCCTCCTGAAT CGTCAGGCACCATAACAT TCCGCTGTCTGTCCTTTT TCTTCCTCGTCCTGTATC CAGTGTAAGCCTTCGTCT GGTGCTGTCACTTACGAT ACTGTCCTTCCCAGGTTC CAGATCATGTTTGAGACC ATTGCCAATGGTGATGAC TTCCTTCCTGGGTATGGAATC GCACTGTGTTGGCATACAGG GGCCACGCGTCGACTAGTAC(T)17

3′ RACE first round PCR 3′RACE second round PCR 3′ RACE first round PCR 3′RACE second round PCR 3′ RACE PCR 5′ RACE PCR Plasmid construction Plasmid construction Plasmid construction Plasmid construction RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR internal control RT-qPCR internal control RT-qPCR internal control RT-qPCR internal control First strand cDNA synthesis

31 32 33 34 35 36 37

Three batches were microinjected with ProTα b-pEGFPN1, Tβ-lpEGFPN1 and pEGFPN1 blank vector respectively. Another batch was considered as the parental control without any treatment. The embryos and larvae were collected at 1 w pf (60–100 embryos or larvae as a group, n = 60–100), then were immediately frozen in liquid nitrogen and stored at −80 °C for RNA isolation and cDNA preparation.

38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61

2.8. Analysis of gene expression We exploited RT-qPCR to identify the expressions of carp ProTα b, Tβ-l in different tissues, in early development and after virus infection. The expression of Rag1, TCR-γ, CD4 and CD8α in ProTα b and Tβ-l over-expressed zebrafish and normal zebrafish were also detected. The cDNAs from different samples were collected following the methods mentioned earlier. Specific primers for the genes of interest were designed based on the sequences available in GenBank (Table 1). RT-qPCR was performed using SYBR Green PCR master mix (TaKaRa, Dalian, China) on the 7900 HT Fast Real-Time PCR System (Applied Biosystems). The carp β-actin and zebrafish β-actin were used as the endogenous control. All samples were normalized to internal controls and fold changes were calculated by relative quantification (2−ΔΔCt) (Livak and Schmittgen, 2001; Winer et al., 1999; Xiao et al., 2014). For the analysis of proTα b and Tβ-l expression levels, the gill was used as calibrator organ for analyzing differential expression in organs from healthy fish, the organs from the control fish were used as calibrators for analyzing of the expression in virus-infected fish, the 4 h pf carp embryos were used as the calibrator for analyzing the expression in the early development. To analyze the expression of Rag1, TCR-γ, CD4 and CD8α, the organs from the normal zebrafish were used as the calibrator.

62 63 64 65 66 67 68

2.9. Statistics GraphPad Prism 5 (GraphPad Software, La Jolla, CA) was used for statistical analysis. Two tailed Student’s t test was applied for data analysis. Data were presented as mean ± SD. P values less than 0.05 were considered statistically significant.

3. Results 3.1. Characteristics of carp ProTα b and Tβ-l genes The full-length cDNA of carp ProTα b was 1059 base pair (bp) (GenBank accession no. KJ586576) containing an open reading frame that encoded for 107 amino acids. Four RNA instability motifs (ATTA, ATTTA, AT**TA) were presented in the 3′-UTR. The polyadenylation signal AATAA was 50 bp upstream of poly (A) (Fig. 1A). Amino acid sequence analysis indicated that 53% amino acid residues were acidic and no aromatic amino acid was found in the polypeptide. The theoretical isoelectric point of carp ProTα b was 3.73, and its molecular mass was 12.01 kDa. PROSITE analysis illustrated that carp ProTα b contained a thymosin α domain, an acidic domain and a nuclear location signal motif. These domains were all well conserved (Fig. 2A). The amino acid sequence alignments showed that the carp ProTα b shared 82% identity to Danio rerio ProTα b, 49% identity to Salmo salar ProTα b, 47% identity to Ictalurus punctatus ProTα b, 51% to the bird (chicken) ProTα, 48% identity to the amphibian ProTα and 45– 47% identity to the mammalian ProTαs. The carp Tβ-l cDNA sequence was 1087 bp (GenBank accession no. KJ586575), containing a 132 bp open reading frame that encoded for 43 amino acids. Four RNA instability motifs (ATTA, ATTTA, AT**TA) were also presented in the 3′-UTR of carp Tβ-l cDNA. Two polyadenylation AATAA signals were 16 bp and 85 bp upstream of poly (A) respectively (Fig. 1B). Amino acid sequence analysis indicated that the theoretical isoelectric point of carp Tβ-l was 5.29, and its molecular mass was 4.92 kDa. PROSITE analysis illustrated that carp Tβ-l had the typical characteristics of the Tβs that contained a conserved helix-forming region, an actin binding domain followed by another helix-forming region (Fig. 2B). The amino acid sequence alignments showed that carp Tβ-l showed 79–95% sequence identity to the teleost Tβs, 65–77% sequence identity to the mammalian Tβs and 61–72% sequence identity to the invertebrate Tβs. To further analyze the relationships of carp ProTα b and Tβ-l with other vertebrate or invertebrate ProTαs and Tβ-ls, the phylogenetic tree was constructed using the neighbor-joining method within

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106

ARTICLE IN PRESS Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

4

1 2 3

Fig. 1. The sequences of the carp ProTα b (A) and Tβ-l (B). The UTR, ORF, and predicted amino acid sequences are shown in upper case. The start codon (ATG) and the stop codon (TAA) are marked by the box. The mRNA destabilization motif ATTTA and ATTTATTTA are indicated in boldface. The polyadenylation signal ATTAAA is in bold and in italics.

4 5 6 7 8 9 10 11

the MEGA program (Kumar et al., 2001). As shown in Fig. 3, phylogenetic analysis revealed that the fish ProTα b and Tβ-l encoding genes both formed the exclusive groups respectively, as opposed to higher vertebrates or invertebrates with high bootstrap probability. The different degrees of divergence among reptilian, mammalian, avian, teleost ProTαs and the vertebrates or invertebrates Tβs may reflect their phylogenetic differences.

12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

3.2. Tissue distribution of carp ProTα b and Tβ-l The carp ProTα b and Tβ-l mRNA distributions were examined using RT-qPCR (Fig. 4A, B). The expression levels of ProTα b and Tβ-l were examined in ten tissues from three healthy carp with β-actin as internal reference gene and the gill as calibrator organ. The carp ProTα b and Tβ-l genes were detectable in all examined tissues. ProTα b was predominantly detected in liver, head kidney, skin and intestine, followed by gill and kidney, lower expression levels in spleen, thymus, peripheral blood and muscle. Meanwhile, Tβ-l was predominantly detected in intestine and skin, followed by head kidney, kidney, thymus, liver, and gill, lower expression level was detected in spleen, peripheral blood and muscle. No ProTα b and Tβ-l transcripts were detected in negative controls.

3.4. SVCV infection The relative expression levels of ProTα b and Tβ-l mRNA were analyzed by RT-qPCR in various carp organs during infection with SVCV which is a rhabdovirus associated with systemic illness and high mortality in cyprinids (Shivappa et al., 2008). Some symptoms appeared in the SVCV infected carp, such as a hyperaemia in skin and caudal/ventral fin, a marked inflammatory in gill and intestine. After virus infection, the ProTα b mRNA levels were significantly elevated at 1 d in kidney (1.9-fold) (P < 0.05) and peripheral blood (1.88-fold) (P < 0.05). In spleen and intestine the ProTα b mRNA levels were greatly induced during 3–5 d, reaching up to 5.4-fold (P < 0.01) and 3.6-fold (P < 0.01) respectively. However, there was no significant increase in gill, skin, thymus, head, kidney and liver (Fig. 6A). The expression of Tβ-l after virus infection was quite similar to that of ProTα b. Tβ-l mRNA levels were significantly increased and reached the maximum in intestine (2.91-fold) (P < 0.01), peripheral blood (2.93-fold) (P < 0.01) and liver (2.3-fold) (P < 0.01). After that, it started to decrease or returned to the control levels. However, in spleen, the expression of Tβ-l continuously increased until 10 d; there were no significant increase in gill, skin, thymus, head, kidney and liver (Fig. 6B).

27 28 29 30 31 32 33 34 35 36

37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.3. Development The expression levels of carp ProTα b and Tβ-l genes at different developmental stages (embryos and larvae) were examined by RT-qPCR. The levels of both two genes increased at first, then decreased and trended to be stable at last. The ProTα b got the maximum expression levels at 16 h pf which was 9.13-fold to the expression levels at 4 h pf, while the Tβ-l had the maximum expression levels (29.18-fold) at 72 h pf (Fig. 5).

3.5. The potential immunomodulatory role of ProTα b and Tβ-l in zebrafish model The constructed plasmids which co-expressed ProTα b or Tβ-l proteins with green fluorescent protein (GFP) were shown in Fig. 7A. In ProTα b or Tβ-l over-expressed zebrafish, the GFP were detected at 1 w pf while there was no GFP in the control batch (Fig. 7B). RTqPCR results showed that compared with the control group overexpression of both ProTα b and Tβ-l increased the expression

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

61 62 63 64 65 66 67 68 69

ARTICLE IN PRESS Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

1 2 3 4 5 6 7 8 9

5

Fig. 2. Multiple alignments of the known ProTα (A) and Tβ (B) molecules. The dashes in the amino acid sequences indicate gaps introduced to maximize alignment. The thymosin α domain, acidic domain, nuclear location signal motif of ProTα and the conserved helix-forming region, actin binding domain, helix-forming region of Tβ-l are all marked in the box. Amino acid sequence identity comparison of the carp ProTα b (A) and Tβ-l (B) proteins with other vertebrate ProTα (A) and Tβ (B) proteins are also listed followed the alignments. GenBank accession numbers are as follows, ProTα genes: Homo sapiens, NM_002823; Danio rerio, NM_194376; Ictalurus punctatus, BE470115; Rana esculenta, CAC39397; Xenopus laevis, BC044709; Gallus gallus, DN830020; Bostaurus, NM_001039953; Mus musculus, BC085171; Salmo salar, ACM09466.1 and Common carp (KJ586576) (unpublished). Tβ genes: Danio rerio, XP_001332706.1; Oncorhynchus mykiss, NP_001117822.1; Ictalurus punctatus, ABC75563.1; Xenopus tropicalis, NP_001037883.1; Bos Taurus, NP_777048.1; Salmo salar, ACI69756.1; Macropodus opercularis, AAL47854.1; Lymnaea stagnalis, ABB85285.1; Equus caballus, AAP78720.1; Branchiostoma belcheri, AAK72482.1; Haliotis diversicolor, ABU53029.1; Paralichthys olivaceus, ACB97647.1; Homo sapiens, NP_898870.1; Rattus norvegicus, NP_775435.1; and Common carp (KJ586575) (unpublished).

10 11 12 13 14 15 16 17 18 19 20 21 22

of Rag 1, TCR-γ, CD4 and CD8α at 1w pf after transfection. The expression levels of Rag 1 were increased to 6.4-fold (P < 0.01) and 5-fold (P < 0.01). The expression levels of TCR-γ were increased to 7.1-fold (P < 0.01) and 13.5-fold (P < 0.01). The expression levels of CD4 were increased to 4.2-fold (P < 0.01) and 6.6-fold (P < 0.01) and the expression levels of CD8α were increased to 2.3-fold (P < 0.05) and 2.1-fold (P < 0.05) respectively (Fig. 7C). 4. Discussion The discovery of thymosins in the mid 1960s emerged from investigations of the role of the thymus in the development of the

vertebrate immune system (Goldstein et al., 1966). These small proteins have been well studied as particularly attractive molecules for stimulating immune responses in mammals thereafter, and some of which have already progressed from the laboratory to the clinic (Goldstein, 2007; Goldstein and Badamchian, 2004). Until now, the roles and functions of thymosins in teleost are still poorly explored. Our demonstration of carp ProTα b and Tβ-l will fill crucial knowledge gaps of thymosins in teleost. Analysis of the deduced amino acids of carp ProTα b gene showed the presence of a thymosin α domain, an acidic domain and a KKQK nuclear location signal motif, which were all conserved from fish to mammals. The existence of nuclear location signal motif and its

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

23 24 25 26 27 28 29 30 31 32 33 34

ARTICLE IN PRESS 6

1 2

Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Fig. 3. Phylogenetic analysis of ProTα and Tβ-l proteins. Neighbor-joining tree was constructed with Mega3.1 program. The numbers on the branches represent the confidence level of 10,000 bootstrap replications.

3 4 5 6 7 8

extremely acidic character suggested that ProTα has an intranuclear site of actin (Carpintero et al., 1996). Analysis of the deduced amino acids of carp Tβ-l gene revealed the existence of conserved actin binding LKKTET motif and two helix motifs. The highest similarity of amino acid sequences was found in those motifs of all

known Tβs indicating that carp Tβ-l may play an important role in maintaining cellular functions, such as cell morphology, proliferation and locomotion (Huff et al., 2001). ProTα b and Tβ-l were both expressed in the ten tissues we examined, but their expression abundance was quite different. The

18

9

10 11 12

13 14 15 16 17

Fig. 4. Expression analysis of carp ProTα b and Tβ-l genes in different tissues by RTqPCR. The relative expression levels of ProTα and Tβ-l genes were normalized with the expression level of carp β-actin. Data are expressed as the mean ± S.D. (n = 3).

Fig. 5. Expression pattern of carp ProTα b and Tβ-l genes at different development stages by RT-qPCR. The expression of carp β-actin was a control of RT-qPCR in the assay. Data are expressed as the mean ± S.D. (n = 3).

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

19 20 21

ARTICLE IN PRESS Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

1 2 3

7

Fig. 6. Carp ProTα b (A) and Tβ-l (B) expression patterns after SVCV infection, β-actin were used as internal control. The SVCV-infected carp at 0 d was set as the control group when compared carp ProTα b (A) and Tβ-l (B) expression levels. Data are expressed as the mean ± S.D. (n = 3). The significant differences to the control (P < 0.05, P < 0.01 and P < 0.001) are denoted with ‘*’, ‘**’ and ‘***’ respectively.

4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32

highest expression of carp ProTα was found in liver. In mammals, the liver has a strong regeneration and recovery capabilities which were unmatched by other organs (Fausto et al., 2006). Meanwhile, previous studies suggested a vital role of ProTα in cell proliferation. It was reported that the expression of ProTα was higher in proliferative cells than that in quiescent cells. And in adults, the more proliferative tissues exhibited higher levels of ProTα (Haritos et al., 1985). All these studies suggest that carp ProTα may exhibit similar function in carp liver as that in mammals, which needs to be further studied. The highest expression of carp Tβ-l was found in skin and intestine. Since skin and intestine are two important entry sites of pathogens (Wang and Secombes, 2008), the high expression of Tβ-l at these two sites indicated that the carp Tβ-l gene may have a role in host defense of teleost. Moreover, the expression levels of carp ProTα b and Tβ-l were lower in thymus when compared with that of other tissues. It seems to be controversial with previous study in which high expression of thymosins were found in mammalian thymus (Haritos et al., 1984). Although thymosins were firstly isolated from mammalian thymus tissue preparations, their occurrences were not tissue-specific and they were even present in different types of cells (Mihelic and Voelter, 1994). These studies suggested that multiple roles of thymosins may exist in teleosts and mammals, which needs further investigation. Then we analyzed the expression of carp ProTα b and Tβ-l genes at early developmental stages. The results showed that the expression of carp ProTα b gradually increased starting from 4 h pf, reached maximum at 16 h pf, then decreased and kept at a certain stable level. It suggested that ProTα b was important for carp’s early

embryogenesis, which was also proved in recent study by knocking down ProTα b in zebrafish (Emmanouilidou et al., 2013). This result was also consistent with the previous study that ProTα mRNA was preferentially expressed before puberty while it significantly decreased in the adult rats (Dosil et al., 1990). It suggested that fish ProTαs, like the mammalian ProTαs, may also participate in developmental processes including cell proliferation and/or differentiation. Meanwhile, the expression of carp Tβ-l started to increase at 24 h pf and gradually increased up to 72 h pf, then began to decrease at later developmental stages. Previous study found that the expression levels of Tβs were initially high in rat immature granule cells, diminished as they migrate and differentiate and ceased altogether by postnatal day 21 (Voisin et al., 1995). These studies indicate that Tβ-l may play a similar role with mammalian homolog in development. SVCV infection could induce the expressions of carp ProTα b and Tβ-l genes. The expression of ProTα b during infection was significantly up-regulated in spleen which was the main peripheral immune organ in carp, followed in kidney, intestine and peripheral blood which were all immune-related organs. Since 1994, ProTα has been reported to inhibit the replication of virus and the reproduction of cancer cells by inducing immune cells (Baxevanis et al., 1994, 1995; Haritos et al., 1985; Romani et al., 2004). Thymosin α1, corresponding to the first 28 amino acid residues of ProTα, was reported to increase the expression of MHC I which presented endogenous peptides to cytotoxic T cells to kill the virally infected cells as well as some cancer cells (Giuliani et al., 2000). It was also reported that Thymosin α1 inhibited viral replication in hepatitis virus B-transfected HepG2 tumor cells (Moshier et al., 1996). From these results, we speculate that carp ProTα

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ARTICLE IN PRESS 8

1 2 3 4 5

Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Fig. 7. Comparing the immune system-related gene expression levels in carp ProTα b, Tβ-l, over-expressed zebrafish. (A) The plasmid construction for establishing zebrafish model. The full length open reading frames (ORF) of ProTα b and Tβ-l were cloned into pGFPN1 which could co-express ProTα b-GFP or Tβ-l-GFP respectively. (B) Overexpression of carp ProTα b or Tβ-l was validated by expressing GFP in zebrafish. (C) The expression levels of Rag1, TCR-γ, CD4 and CD8α in zebrafish model. The zebrafish transfected with blank vectors were set as the control groups when compared the expressions of zebrafish Rag 1, TCR-γ, CD4 and CD8α. Data are expressed as the mean ± S.D. (n = 3). The significant differences to blank control (P < 0.05 and P < 0.001) are denoted with ‘*’, and ‘***’ respectively.

6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

b may also have an antiviral function and specific antiviral mechanism (by inducing immune cells or enhancing antigen presenting) which requires a more in-depth study next. The significant up-regulation followed by returning to the almost control expression levels of Tβ-l appeared in intestine, liver and peripheral blood. A study reported that one of the Tβs, Tβ4, was a key activator of NK cell cytotoxicity (Lee et al., 2009), indicating that carp Tβ-l may also play an important role in NK/ Tc-mediated cytolysis in viral clearance. Altogether, SVCV infection leads to the increased expression of carp ProTα b and Tβ-l, which indicates that these two genes are both involved in the immune response associated with viral infection. To further study the immunopotentiating roles of carp ProTα b and Tβ-l genes, we transiently over-expressed these two genes in zebrafish. After that, the expression levels of four important T lymphocytes-related genes were examined. They were one gene involved in the development of lymphocytes (Rag1), and three genes coding for membrane receptors of T cells (TCR-γ, CD4 and CD8α). Rag1 is involved in the maturation of B and T lymphocytes (Petrie-Hanson et al., 2009). TCR-γ, CD4 and CD8α are surface marker genes of epithelial γδT cells, Th and Tc cells. Expression of CD4 and

CD8 genes are essential for cell-mediated immune response and the development of T lymphocytes (Suetake et al., 2004). Up-regulation of these lymphocytes-related gene expression indicated that overexpression of carp ProTα b and Tβ-l may induce the development of T lymphocytes, and ultimately enhance the cell mediated immune response. In conclusion, we reported the cloning and characteristics of carp ProTα and Tβ-l genes. Although the functions of these two genes are not identical, they may both induce the development of T lymphocytes, and ultimately enhance the cell mediated immune response during viral infection. The present study provides new clues toward understanding the basic immunology function of ProTα and Tβ-l in teleost. The specific mechanism of carp ProTα and Tβ-l induced lymphocyte development remains to be further studied. Acknowledgements This work was supported by the National Natural Science Foundation of China (Grant Nos. 30671599, 30871912), and the National Basic Research Program of China (Grant No. 2009CB118704). We

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

ARTICLE IN PRESS Z. Xiao et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70

would like to thank Prof. Pin Nie and Xudong Xu (Institute of Hydrobiology, Chinese Academy of Sciences) for technical supports and valuable advices. References Ahne, W., Bjorklund, H.V., Essbauer, S., et al., 2002. Spring viremia of carp (SVC). Dis. Aquat. Organ. 52, 261–272. Anathy, V., Kirankumar, S., Pandian, T.J., 2003. Enhanced expression of beta-thymosin mRNA in the ovary of GnRH analog or estradiol-17beta-treated paradise fish, Macropodus opercularis. Comp. Biochem. Physiol. A. Mol Integr. Physiol. 134, 639–645. Baxevanis, C.N., Gritzapis, A.D., Dedoussis, G.V., et al., 1994. Induction of lymphokineactivated killer activity in mice by prothymosin alpha. Cancer Immunol. Immunother. 38, 281–286. Baxevanis, C.N., Gritzapis, A.D., Spanakos, G., et al., 1995. Induction of tumor-specific T lymphocyte responses in vivo by prothymosin alpha. Cancer Immunol. Immunother. 40, 410–418. Carpintero, P., Franco del Amo, F., Anadon, R., et al., 1996. Thymosin beta10 mRNA expression during early postimplantation mouse development. FEBS Lett. 394, 103–106. Cordero, O.J., Sarandeses, C.S., Lopez, J.L., et al., 1991. Prothymosin alpha enhances interleukin 2 receptor expression in normal human T-lymphocytes. Int. J. Immunopharmacol. 13, 1059–1065. Donizetti, A., Liccardo, D., Esposito, D., et al., 2008. Differential expression of duplicated genes for prothymosin alpha during zebrafish development. Dev. Dyn. 237, 1112–1118. Dosil, M., Freire, M., Gomez-Marquez, J., 1990. Tissue-specific and differential expression of prothymosin alpha gene during rat development. FEBS Lett. 269, 373–376. Emmanouilidou, A., Karetsou, Z., Tzima, E., et al., 2013. Knockdown of prothymosin alpha leads to apoptosis and developmental defects in zebrafish embryos. Biochem. Cell Biol. 91, 325–332. Erickson-Viitanen, S., Horecker, B.L., 1984. Thymosin beta 11: a peptide from trout liver homologous to thymosin beta 4. Arch. Biochem. Biophys. 233, 815–820. Eschenfeldt, W.H., Berger, S.L., 1986. The human prothymosin alpha gene is polymorphic and induced upon growth stimulation: evidence using a cloned cDNA. Proc. Natl. Acad. Sci. U.S.A. 83, 9403–9407. Fausto, N., Campbell, J.S., Riehle, K.J., 2006. Liver regeneration. Hepatology 43, S45–S53. Gai, Y., Zhao, J., Song, L., et al., 2009. Two thymosin-repeated molecules with structural and functional diversity coexist in Chinese mitten crab Eriocheir sinensis. Dev. Comp. Immunol. 33, 867–876. Gast, K., Damaschun, H., Eckert, K., et al., 1995. Prothymosin alpha: a biologically active protein with random coil conformation. Biochemistry 34, 13211–13218. Giuliani, C., Napolitano, G., Mastino, A., et al., 2000. Thymosin-alpha1 regulates MHC class I expression in FRTL-5 cells at transcriptional level. Eur. J. Immunol. 30, 778–786. Goldstein, A.L., 2007. History of the discovery of the thymosins. Ann. N. Y. Acad. Sci. 1112, 1–13. Goldstein, A.L., Badamchian, M., 2004. Thymosins: chemistry and biological properties in health and disease. Expert Opin. Biol. Ther. 4, 559–573. Goldstein, A.L., Slater, F.D., White, A., 1966. Preparation, assay, and partial purification of a thymic lymphocytopoietic factor (thymosin). Proc. Natl. Acad. Sci. U.S.A. 56, 1010–1017. Gondo, H., Kudo, J., White, J.W., et al., 1987. Differential expression of the human thymosin-beta 4 gene in lymphocytes, macrophages, and granulocytes. J. Immunol. 139, 3840–3848. Goodall, G.J., Dominguez, F., Horecker, B.L., 1986. Molecular cloning of cDNA for human prothymosin alpha. Proc. Natl. Acad. Sci. U.S.A. 83, 8926–8928. Hall, A.K., 1991. Differential expression of thymosin genes in human tumors and in the developing human kidney. Int. J. Cancer 48, 672–677. Hannappel, E., Huff, T., 2003. The thymosins. Prothymosin alpha, parathymosin, and beta-thymosins: structure and function. Vitam. Horm. 66, 257–296. Haritos, A.A., Tsolas, O., Horecker, B.L., 1984. Distribution of prothymosin alpha in rat tissues. Proc. Natl. Acad. Sci. U.S.A. 81, 1391–1393. Haritos, A.A., Salvin, S.B., Blacher, R., et al., 1985. Parathymosin alpha: a peptide from rat tissues with structural homology to prothymosin alpha. Proc. Natl. Acad. Sci. U.S.A. 82, 1050–1053. Huff, T., Muller, C.S., Otto, A.M., et al., 2001. beta-Thymosins, small acidic peptides with multiple functions. Int. J. Biochem. Cell Biol. 33, 205–220.

9

Jiang, X., Kim, H.E., Shu, H., et al., 2003. Distinctive roles of PHAP proteins and prothymosin-alpha in a death regulatory pathway. Science 299, 223–226. Kasthuri, S.R., Premachandra, H.K., Umasuthan, N., et al., 2013. Structural characterization and expression analysis of a beta-thymosin homologue (Tbeta) in disk abalone, Haliotis discus discus. Gene 527, 376–383. Koutna, M., Vesely, T., Psikal, I., et al., 2003. Identification of spring viraemia of carp virus (SVCV) by combined RT-PCR and nested PCR. Dis. Aquat. Organ. 55, 229–235. Kumar, S., Tamura, K., Jakobsen, I.B., et al., 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17, 1244–1245. Lee, H.R., Yoon, S.Y., Kang, H.B., et al., 2009. Thymosin beta 4 enhances NK cell cytotoxicity mediated by ICAM-1. Immunol. Lett. 123, 72–76. Li, X., Zheng, L., Peng, F., et al., 2007. Recombinant thymosin beta 4 can promote full-thickness cutaneous wound healing. Protein Expr. Purif. 56, 229–236. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T) method. Methods 25, 402–408. Low, T.L., Hu, S.K., Goldstein, A.L., 1981. Complete amino acid sequence of bovine thymosin beta 4: a thymic hormone that induces terminal deoxynucleotidyl transferase activity in thymocyte populations. Proc. Natl. Acad. Sci. U.S.A. 78, 1162–1166. Low, T.L., Liu, D.T., Jou, J.H., 1992. Primary structure of thymosin beta 12, a new member of the beta-thymosin family isolated from perch liver. Arch. Biochem. Biophys. 293, 32–39. Mihelic, M., Voelter, W., 1994. Distribution and biological activity of beta-thymosins. Amino Acids 6, 1–13. Moshier, J.A., Mutchnick, M.G., Dosescu, J., et al., 1996. Thymosin-alpha 1, but not interferon-alpha, specifically inhibits anchorage-independent growth of hepatitis B viral transfected HepG2 cells. J. Hepatol. 25, 814–820. Mulder, N.J., Apweiler, R., Attwood, T.K., et al., 2002. InterPro: an integrated documentation resource for protein families, domains and functional sites. Brief. Bioinform. 3, 225–235. Nielsen, C.V., Buchmann, K., 2000. Prolonged in vitro cultivation of Ichthyophthirius multifiliis using an EPC cell line as substrate. Dis. Aquat. Organ. 42, 215–219. Oates, K.K., Ginsburg, G.T., Naylor, P.H., et al., 1988. Identification and distribution of thymosin alpha 1-like immunoreactivity. Dev. Comp. Immunol. 12, 397–402. Petrie-Hanson, L., Hohn, C., Hanson, L., 2009. Characterization of rag1 mutant zebrafish leukocytes. BMC Immunol. 10, 8. Pineiro, A., Cordero, O.J., Nogueira, M., 2000. Fifteen years of prothymosin alpha: contradictory past and new horizons. Peptides 21, 1433–1446. Prisco, M., Donizetti, A., Aniello, F., et al., 2009. Expression of Prothymosin alpha during the spermatogenesis of the spotted ray Torpedo marmorata. Gen. Comp. Endocrinol. 164, 70–76. Qi, X., Wang, L., Du, F., 2010. Novel small molecules relieve prothymosin alphamediated inhibition of apoptosome formation by blocking its interaction with Apaf-1. Biochemistry 49, 1923–1930. Reed, A.F., 1938. A left superior vena cava draining the blood from a closed coronary sinus. J. Anat. 73, 195–197. Romani, L., Bistoni, F., Gaziano, R., et al., 2004. Thymosin alpha 1 activates dendritic cells for antifungal Th1 resistance through toll-like receptor signaling. Blood 103, 4232–4239. Shivappa, R.B., Savan, R., Kono, T., et al., 2008. Detection of spring viraemia of carp virus (SVCV) by loop-mediated isothermal amplification (LAMP) in koi carp, Cyprinus carpio L. J. Fish Dis. 31, 249–258. Suetake, H., Araki, K., Suzuki, Y., 2004. Cloning, expression, and characterization of fugu CD4, the first ectothermic animal CD4. Immunogenetics 56, 368–374. Tripathi, S.C., Matta, A., Kaur, J., et al., 2011. Overexpression of prothymosin alpha predicts poor disease outcome in head and neck cancer. PLoS ONE 6, e19213. Voisin, P.J., Pardue, S., Morrison-Bogorad, M., 1995. Developmental characterization of thymosin beta 4 and beta 10 expression in enriched neuronal cultures from rat cerebella. J. Neurochem. 64, 109–120. Wang, T., Secombes, C.J., 2008. Rainbow trout suppressor of cytokine signalling (SOCS)-1, 2 and 3: molecular identification, expression and modulation. Mol. Immunol. 45, 1449–1457. Winer, J., Jung, C.K., Shackel, I., et al., 1999. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270, 41–49. Xiao, Z., Ching Chow, S., Han Li, C., et al., 2014. Role of microRNA-95 in the anticancer activity of Brucein D in hepatocellular carcinoma. Eur. J. Pharmacol. 728C, 141–150. Xiao, Z.G., Liu, H., Fu, J.P., et al., 2010. Cloning of common carp SOCS-3 gene and its expression during embryogenesis, GH-transgene and viral infection. Fish Shellfish Immunol. 28, 362–371.

Please cite this article in press as: Zhangang Xiao, et al., Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.), Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.01.003

71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142