J BIOCHEM MOLECULAR TOXICOLOGY Volume 29, Number 7, 2015
Chloroquine and Hydroxychloroquine Increase Retinal Pigment Epithelial Layer Permeability Nicoline M. Korthagen,1 Jeroen Bastiaans,1 Jan C. van Meurs,2,3 Kiki van Bilsen,4 P. Martin van Hagen,1,2,4 and Willem A. Dik1 1 Department 2 The
of Immunology, Erasmus MC, University Medical Center, P.O. Box 2060, 3000 CB Rotterdam, The Netherlands
Rotterdam Eye Hospital, P.O. Box 70030, 3000 LM Rotterdam, The Netherlands
3 Department
of Ophthalmology, Erasmus MC, University Medical Center, Rotterdam, The Netherlands
4 Department
of Internal Medicine, Erasmus MC, University Medical Center, Rotterdam, The Netherlands
Received 4 January 2015; accepted 22 January 2015
ABSTRACT: Antimalarials chloroquine (CQ) and hydroxychloroquine (HCQ) are widely used as antiinflammatory drugs, but side effects include retinopathy and vision loss. The objective of this study was to examine the effect of CQ and HCQ on the barrier integrity of retinal pigment epithelial (RPE) cell monolayers in vitro. Permeability of ARPE-19 cell monolayers was determined using Fluorescein isothiocyanate (FITC)labeled dextran. The influence of CQ and HCQ on cell death and the expression tight junction molecules was examined. CQ and HCQ significantly increased ARPE19 monolayer permeability after 3 and 18 h, respectively, and enhanced mRNA levels for claudin-1 and occludin. Cytotoxicity was only observed after 18 h exposure. Thus, CQ and HCQ rapidly enhance RPE barrier permeability in vitro, independent of cytotoxicity or loss of zonula occludens-1, claudin-1, and occludin expression. Our findings suggest that CQ/HCQ-induced permeability of the RPE layer may contribute to blood– retinal barrier breakdown in case of CQ/HCQ-induced C 2015 Wiley Periodicals, Inc. J Biochem retinopathy. Mol Toxicol 29:299–304, 2015; View this article online at wileyonlinelibrary.com. DOI 10.1002/jbt.21696
KEYWORDS: retinal pigment epithelial cell; barrier function; chloroquine; hydroxychloroquine; Transwell; tight-junctions
INTRODUCTION R The antimalarial drugs chloroquine (CQ: Aralen ) R and hydroxychloroquine (HCQ: Plaquenil ) are
Correspondence to: W. A. Dik. [email protected] Contract Grant Sponsor: Combined Ophthalmic Research Rotterdam (CORR-Project Code: 3.5.0). The authors have no conflict of interest to declare. C 2015 Wiley Periodicals, Inc.
widely used in the treatment of immune-mediated inflammatory diseases (IMIDs) such as rheumatoid arthritis, systemic lupus erythematosus (SLE), ¨ Sjogren’s syndrome, and sarcoidosis, where they exert beneficial effects on skin and joint symptoms. Moreover, HCQ therapy has been shown to prevent organ damage and reduces mortality in SLE patients [1]. So, long-standing maintenance therapy with these antimalarials is required in the majority of SLE patients. CQ and HCQ treatment is associated with limited side effects, which mainly include nausea and diarrhoea. However, one serious complication of CQ and HCQ treatment is the risk of developing irreversible macular retinopathy and vision loss, which is a major concern for both doctors and patients [2, 3]. Retinopathy occurs in ∼10–20% of patients treated with CQ and in ∼0.5–3.5% of patients treated with HCQ, and mostly affects the macular region, ranging from fine mottling to typical bull’s eye maculopathy [4–8]. However, functional loss may occur before changes in the retina can be detected and regular screening by an ophthalmologist does not always prevent vision loss [9]. The development of retinopathy due to CQ or HCQ treatment is clearly related to dosage and treatment duration [2, 10], but the underlying pathogenic mechanisms are so far poorly understood. CQ strongly accumulates in the pigmented ocular structures as a consequence of its affinity for melanin, but the drug-induced retinal toxicity is most likely unrelated to melanin binding [7, 11, 12]. CQ-induced retinopathy is associated with breakdown of the blood–retinal barrier (BRB), and the retinal pigment epithelium (RPE) that forms the outer layer of the BRB is considered an important target of CQ and HCQ toxicity [13–16]. As the RPE monolayer is central in maintaining the metabolism of the overlying 299
300
KORTHAGEN ET AL.
neuroretina and the metabolic demands are greatest in the macular region due to the high concentration of photoreceptors, it is conceivable that metabolic equilibrium disturbances first become manifest in the macula, resulting in the typical bull’s eye maculopathy. It has been demonstrated that in vitro exposure of human RPE cells to high concentrations of CQ (>100 μM) leads to the development of cytosolic vacuoles within 1 h and lysosomal dysfunction and cell lysis after 24 h [14, 16]. The retinal toxic effects of HCQ are far less clear, but HCQ has been found to interfere less with lysosomal degradation capacity of photoreceptor outer segments in bovine RPE cells than CQ [15]. The frequent use of CQ and HCQ in IMID management, together with the serious concerns of retinopathy development and our limited mechanistic insight, warrants further studies that explore the mechanisms underlying CQ and HCQ retinotoxicity. Eventually such studies may provide insight to guide the development of protective measures. We hypothesized that both CQ and HCQ have direct disrupting effects on RPE barrier function, which may contribute to loss of BRB with secondary changes in the overlying photoreceptors or neuroretina resulting in vision loss. In the present study, we therefore examined the effect of CQ and HCQ on the barrier integrity of retinal pigment epithelial cell monolayers (cell line ARPE-19) in vitro by measuring permeability to dextran molecules in a Transwell culture system. In addition, the effect of CQ and HCQ on the expression of the tight junction proteins zonula occludens-1 (ZO-1; tight junction protein-1), claudin-1, and occludin was examined.
MATERIALS AND METHODS Cell Culture ARPE-19 cells were obtained from ATCC (Manassas, VA) and were cultured in Dulbecco’s modified Eagle’s medium/Ham’s F12 (1:1) containing L-glutamine and 4-(4-hydroxyethyl)-I-piperazine-ethanesulfonic acid (HEPES; Thermo Scientific, Waltham, MA) and supplemented with penicillin/streptomycin (Lonza, Walkersville, MD) and 10% heat-inactivated fetal calf serum (FCS; Lonza).
RPE Monolayer Permeability Analysis ARPE-19 monolayers were established on 12-mm diameter polyester Transwell inserts with 0.4 μm pore size (Corning, NY). The Transwell inserts were coated with 5 μg/mL fibronectin (BD Biosciences, San Jose, CA) for at least 2 h and washed with phosphate
Volume 29, Number 7, 2015
buffered saline (PBS). Subsequently, cells were seeded at 1 × 105 cells/well in medium containing 10% FCS. At least twice a week, fresh culture medium containing 1% FCS was added. Transepithelial resistance (TER) was measured using the EVOM epithelial tissue voltohmmeter, and the net TER (·cm2 ) was calculated by subtracting the value from a control insert without cells and multiplication by the effective growth area (1.12 cm2 ). Transwell plates with ARPE-19 cell monolayers with TER values of at least 35 ·cm2 were used for subsequent experiments. Cells were exposed for 3, 5, or 18 h to 100 μM of CQ or HCQ (Sigma-Aldrich, St. Louis, MO) or an equal volume of diluent in medium containing 1% FCS. Hereafter, the medium was replaced with assay buffer (Hanks balanced salt solution [Sigma-Aldrich, St. Louis, MO] with 10 mM HEPES buffer [Gibco, Waltham, Massachusetts, USA]) and 250 μg/mL of Fluorescein isothiocyanate (FITC)-labeled dextran molecules (40 or 150 kDa; Sigma-Aldrich) was added to the apical compartment. Following 1 h incubation, supernatants from the basolateral compartment were harvested and the amount of FITC–dextran present was measured in duplicate using a FLUOSTAR Optima (BMG Labtech, Offenburg, Germany) with excitation at 480 nm and emission at 520 nm. Values were expressed as a percentage of the average control value.
Cytotoxicity Assay Potential cytotoxic effects of CQ and HCQ were determined by measuring lactate dehydrogenase (LDH) release after incubation periods of 3, 5, or 18 h. Hereto, cells were seeded at 2.5 × 105 cells/well in 12-wells plates (Nunc, Roskilde, Denmark) and allowed to adhere overnight. After incubation with medium containing 100 μM CQ, HCQ, or an equal volume of diluent, culture supernatants were collected, centrifuged (1500 rpm; 10 min) and LDH levels were measured using a Cytotoxicity Detection Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s recommendations. Cytotoxicity was expressed as a percentage relative to LDH release induced by total cell lysis with medium containing 1% Triton-X 100 (Sigma-Aldrich).
Detection of ZO-1, Claudin1, and Occludin mRNA Levels by Real-Time Quantitative Polymerase Chain Reaction ARPE-19 cells were exposed to 100 μM CQ or HCQ or an equal volume of diluent for 3, 5, or 18 h in medium containing 1% FCS. Messenger RNA was isolated using a GenElute total RNA miniprep kit (Sigma-Aldrich) and reverse transcribed into cDNA. Transcript levels of TJP1 (encoding ZO-1), CLDN1 J Biochem Molecular Toxicology
DOI 10.1002/jbt
Volume 29, Number 7, 2015
ANTIMALARIALS AFFECT THE RETINAL BARRIER
301
TABLE 1. PCR Primer and Probe Sequences Gene
Forward Primer 5’–3’
ABL
Reverse Primer 5’–3’ GATGTAGTTGCTTGGGACCCA
TJP1
TGGAGATAACATCTA AGCATAACTAAAGGT GAGACGCTGGAACTGACCAA
CLDN1 OCLN
TACTCCTATGCCGGCGACA CCAATGTCGAGGAGTGGGTTA
CCATCAAGGCACGGGTTG AAAACCGCTTGTCATTCACTTTG
TGTTTGTCTTGATCTATGATTTGCTT
(encoding claudin-1), and OCLN (encoding occludin) were determined by real-time quantitative polymerase chain reaction (RQ-PCR; 7700 PCR system; Applied Biosystems [ABI], Foster City, CA) and normalized to the control gene ABL, as described previously [17]. Subsequently, mRNA levels were expressed relative to unstimulated ARPE-19 cells. Primers and probes used for RQ-PCR are shown in Table 1.
Immunofluorescence Microscopic Analysis of ZO-1 Expression ARPE-19 monolayers on Transwell inserts were fixed with 4% paraformaldehyde solution, incubated for 5 min with PBS containing 0.3 M glycine and subsequently blocked for 1 h with PBS containing 1% bovine serum albumin. Thereafter, membranes were R incubated overnight at 4°C with an Alexa Fluor 488-labeled rabbit-anti-human ZO-1 antibody (Invitrogen, Waltham, Massachusetts, USA; 1:50 dilution). The membranes were removed from the inserts with a scalpel and mounted in 80% glycerol/Tris containing 0.4 μg/mL of the nuclear stain 4’,6-diamidino-2phenylindole (DAPI; Invitrogen).
Statistical Analysis Statistical analyses were performed using GraphPad Prism version 5.03 (San Diego, CA). For Transwell experiments, results from at least three separate experiments were compared using a Student’s t-test. If the variance between groups was not equal, a Welsh correction was applied. For LDH release and mRNA expression experiments, ANOVA with Bonferroni correction was used to compare data. A value of p < 0.05 was considered statistically significant.
RESULTS The Effect of CQ and HCQ on Monolayer Permeability CQ and HCQ significantly increased the permeability of the ARPE-19 cell monolayers for the dextran J Biochem Molecular Toxicology
DOI 10.1002/jbt
Probe 5’–3’ AGCTCTGGCATTATTCGCC TGCATACA AGCTCTGGCATTATTCGCC TGCATACA CGTGACCGCCCAGGCCATG TGACAGTCCCATGGCA TACTCTTCCAATG
molecules in a time-dependent manner (Figure 1A). The largest effects were observed after 18 h incubation with CQ, which caused a permeability for 40 kDa dextran of 205% compared to control and a permeability of 268% for 150 kDa dextran compared to control (Figure 1A). Significant effects of CQ on monolayer permeability were also observed after 3 and 5 h (Figure 1A). HCQ also significantly increased monolayer permeability after 18 h incubation, but not after 3 and 5 h (Figure 1B). In addition, after 18 h the permeabilityinducing effect of HCQ was less than that of CQ, with a permeability of 135% for 40 kDa dextran and 179% for 150 kDa dextran, compared to control (Figure 1B). These data indicate that CQ and HCQ rapidly increase the permeability of ARPE-19 cell monolayers.
The Effect of CQ and HCQ on Cell Death To rule out the possibility that the increase in monolayer permeability was due to cytotoxic effects LDH release was determined. CQ and HCQ at a concentration of 100 μM did not induce LDH release by ARPE-19 after 3 or 5 h incubation when compared to unstimulated controls (Figure 2). After 18 h, LDH release by ARPE-19 cells was slightly but significantly (p < 0.01) increased for both CQ (3.4% ± 1.0%; mean ± standard deviation) and HCQ (4.9% ± 1.3%) (Figure 2).
The Effect of CQ and HCQ on Gene Expression of Tight Junction Molecules To analyze whether CQ and HCQ affected tight junctions TJP1, CLDN1, and OCLN mRNA levels were determined. Neither CQ nor HCQ influenced TJP1 mRNA expression level by ARPE-19 at any of the time points examined (Figure 3). CLDN1 and OCLN mRNA expression significantly (p < 0.001) increased in ARPE19 cells after 18 h incubation with CQ or HCQ (Figure 3).
The Effect of CQ and HCQ on ZO-1 Protein Distribution in ARPE-19 Cells To examine a possible effect of CQ and HCQ on tight junction protein distribution, ZO-1 expression
302
KORTHAGEN ET AL.
Volume 29, Number 7, 2015
FIGURE 1. ARPE-19 monolayer permeability for dextran after 3, 5, or 18 h incubation with 100 μM CQ (A) or HCQ (B). Fluorescence was measured in the basal compartment of Transwell plates. Values from at least three independent experiments are expressed as a percentage of control. Bars represent mean ± SEM.
FIGURE 2. ARPE-19 cells were exposed for 3, 5, or 18 h to 100 μM CQ (A) or HCQ (B). Cytotoxicity was determined using a LDH detection kit. Values are represented as a percentage of the exposure to 1% Triton-X-100. *** p < 0.001.
by ARPE-19 cells was examined. ZO-1 distribution in control ARPE-19 monolayers showed the characteristic honeycomb distribution indicative of cellular membrane localization (Figure 4A). Exposure of the monolayers to CQ for a time period of 18 h did not influence this distribution, nor did it appear to change the abundance of ZO-1 (Figure 4B). Similarly, no effect of HCQ on ZO-1 distribution was observed (results not shown).
DISCUSSION Retinal toxicity is a serious side effect of CQ and HCQ treatment and is associated with breakdown of the BRB [13]. Under normal physiological conditions, the integrity of the outer BRB is controlled by the RPE cell layer [18]. Our current study is the first to show that CQ and HCQ can rapidly disrupt the barrier function
J Biochem Molecular Toxicology
DOI 10.1002/jbt
Volume 29, Number 7, 2015
ANTIMALARIALS AFFECT THE RETINAL BARRIER
303
FIGURE 3. Tight junction molecule mRNA expression in ARPE-19 cells. Expression of TJP1, CLDN1, and OCLN after exposure to 100 μM CQ (A) or HCQ (B) for 3, 5, or 18 h. Data are presented as relative expression compared to unstimulated cells. Bars represent mean ± SEM.
FIGURE 4. ZO-1 immunofluorescence of ARPE-19 cell monolayers. Representative image of control monolayer (A) and a monolayer exposed to 100 μM CQ for 18 h (B). ARPE-19 cells were grown on Transwell filters and stained for ZO-1 (green) and nucleus (DAPI; blue). Scale bar = 10 μm.
of human RPE cells. We found that CQ and HCQ cause a rapid increase in ARPE-19 monolayer permeability, which occurs within 5 h and is not associated with early cytotoxicity. HCQ had a less pronounced effect on ARPE-19 barrier disruption than CQ, whereas both compounds appeared to be equally cytotoxic to ARPE19 cells. Therefore, the lower incidence of retinopathy in HCQ-treated patients compared to CQ-treated patients is most likely not related to differences in direct cytotoxic effects on RPE cells. Epithelial tight junctions play a crucial role in maintaining epithelial integrity and barrier function J Biochem Molecular Toxicology
DOI 10.1002/jbt
[19]. Occludin and the members of the claudin family are transmembrane proteins that are essential components of tight junctions, and they interact with cytoplasmic scaffolding proteins like ZO-1 [20]. However, in our study short-term (less than 5 h) incubation of ARPE19 cells with CQ or HCQ did not influence mRNA expression levels of the tight junction proteins ZO-1, occludin, and claudin and neither did it influence the protein abundance and cellular distribution of ZO-1. Prolonged exposure of ARPE-19 to CQ and HCQ increased mRNA expression of occludin and claudin-1. This increased expression of tight junction molecules may be indicative of a stress response aimed at maintaining RPE monolayer integrity, which is in line with previous observations [21, 22]. The CQ and HCQ concentrations used in our experiments are similar to previous studies that found a cytotoxic effect of CQ on ARPE-19 cells [14]. The concentration CQ and HCQ used in this study is approximately 200 times higher than plasma levels measured in patients treated with CQ/HCQ [23, 24]. However, owing to accumulation over time, the concentration present in tissues can be much higher. For instance, it was shown in rats that local CQ concentrations in the eye can be as high as 500 mg/kg, more than 1000-fold
304
KORTHAGEN ET AL.
higher than in plasma and 10 times higher than the concentration used in this study [25]. To avoid visual loss, patients treated with longstanding high dose antimalarials are seen by an ophthalmologist on a regular basis. However, regular screening does not necessarily preclude visual loss as functional loss can occur before biomicroscopic changes are visible within the RPE layer [9]. By the time, bull’s eye maculopathy has developed, the damage is usually irreversible, and continuing functional loss can occur, even when treatment is ceased [26]. Further studies to unravel the cellular and molecular mechanisms underlying CQ- and HCQ-induced retinopathy are required as this may provide insight to guide the development of protective measures. In conclusion, our study is the first to demonstrate that CQ and HCQ rapidly induce permeability of RPE monolayers in vitro. Although the exact mechanism is unclear so far, this rapid increase in RPE monolayer permeability appears not to be related to cytotoxicity nor decreased expression of tight junction proteins. Our findings suggest that CQ/HCQ-induced permeability of the RPE layer may contribute to BRB breakdown in case of CQ/HCQ-induced retinopathy.
REFERENCES 1. Alarcon GS, McGwin G, Bertoli AM, Fessler BJ, CalvoAl´en J, Bastian HM, Vil´a LM, Reveille JD; LUMINA Study Group. Effect of hydroxychloroquine on the survival of patients with systemic lupus erythematosus: data from LUMINA, a multiethnic US cohort (LUMINA L). Ann Rheum Dis 2007;66(9):1168–1172. 2. Easterbrook M. The ocular safety of hydroxychloroquine. Semin Arthritis Rheum 1993;23(2, Suppl. 1):62–67. 3. Hobbs HE, Orsby A, Freedman A. Retinopathy following chloroquine therapy. Lancet 1959;2(7101):478–480. 4. Rynes RI. Ophthalmologic safety of long-term hydroxychloroquine sulfate treatment. Am J Med 1983;75(1A):35– 39. 5. Finbloom DS, Silver K, Newsome DA, Gunkel R. Comparison of hydroxychloroquine and chloroquine use and the development of retinal toxicity. J Rheumatol 1985;12(4):692–694. 6. Mavrikakis M, Papazoglou S, Sfikakis PP, Vaiopoulos G, Rougas K. Retinal toxicity in long term hydroxychloroquine treatment. Ann Rheum Dis 1996;55(3):187–189. 7. Bernstein HN. Ophthalmologic considerations and testing in patients receiving long-term antimalarial therapy. Am J Med 1983;75(1A):25–34. 8. Browning DJ. Hydroxychloroquine and chloroquine retinopathy: screening for drug toxicity. Am J Ophthalmol 2002;133(5):649–656. 9. Marmor MF, Kellner U, Lai TY, Lyons JS, Mieler WF. Revised recommendations on screening for chloroquine and hydroxychloroquine retinopathy. Ophthalmology 2011;118(2):415–422.
Volume 29, Number 7, 2015
10. Mackenzie AH. Dose refinements in long-term therapy of rheumatoid arthritis with antimalarials. Am J Med 1983;75(1A):40–45. 11. Rosenthal AR, Kolb H, Bergsma D, Huxsoll D, Hopkins JL. Chloroquine retinopathy in the rhesus monkey. Invest Ophthalmol Vis Sci 1978;17(12):1158–1175. 12. Leblanc B, Jezequel S, Davies T, Hanton G, Taradach C. Binding of drugs to eye melanin is not predictive of ocular toxicity. Regul Toxicol Pharmacol 1998;28(2):124– 132. 13. Raines MF, Bhargava SK, Rosen ES. The blood-retinal barrier in chloroquine retinopathy. Invest Ophthalmol Vis Sci 1989;30(8):1726–1731. 14. Yoon YH, Cho KS, Hwang JJ, Lee SJ, Choi JA, Koh JY. Induction of lysosomal dilatation, arrested autophagy, and cell death by chloroquine in cultured ARPE-19 cells. Invest Ophthalmol Vis Sci 2010;51(11):6030–6037. 15. Sundelin SP, Terman A. Different effects of chloroquine and hydroxychloroquine on lysosomal function in cultured retinal pigment epithelial cells. APMIS 2002;110(6):481–489. 16. Chen PM, Gombart ZJ, Chen JW. Chloroquine treatment of ARPE-19 cells leads to lysosome dilation and intracellular lipid accumulation: possible implications of lysosomal dysfunction in macular degeneration. Cell Biosci 2011;1(1):10. 17. Bastiaans J, van Meurs JC, Holten-Neelen C, Nagtzaam NM, van Hagen PM, Chambers RC, Hooijkaas H, Dik WA. Thrombin induces epithelial-mesenchymal transition and collagen production by retinal pigment epithelial cells via autocrine PDGF-receptor signaling. Invest Ophthalmol Vis Sci 2013;54(13):8306–8314. 18. Strauss O. The retinal pigment epithelium in visual function. Physiol Rev 2005;85(3):845–881. 19. Rizzolo LJ. Development and role of tight junctions in the retinal pigment epithelium. Int Rev Cytol 2007;258:195– 234. 20. Van Itallie CM, Anderson JM. Claudins and epithelial paracellular transport. Annu Rev Physiol 2006;68:403– 429. 21. Abe T, Sugano E, Saigo Y, Tamai M. Interleukin-1b and barrier function of retinal pigment epithelial cells (ARPE19): aberrant expression of junctional complex molecules. Invest Ophthalmol Vis Sci 2003;44(9):4097–4104. 22. Yoshikawa T, Ogata N, Izuta H, Shimazawa M, Hara H, Takahashi K. Increased expression of tight junctions in ARPE-19 cells under endoplasmic reticulum stress. Curr Eye Res 2011;36(12):1153–1163. 23. Miller DR, Fiechtner JJ, Carpenter JR, Brown RR, Stroshane RM, Stecher VJ. Plasma hydroxychloroquine concentrations and efficacy in rheumatoid arthritis. Arthritis Rheum 1987;30(5):567–571. 24. Wollheim FA, Hanson A, Laurell CB. Chloroquine treatment in rheumatoid arthritis. Correlation of clinical response to plasma protein changes and chloroquine levels. Scand J Rheumatol 1978;7(3):171–176. 25. McChesney EW, Banks WF Jr., Fabian RJ. Tissue distribution of chloroquine, hydroxychloroquine, and desethylchloroquine in the rat. Toxicol Appl Pharmacol 1967;10(3):501–513. 26. Mititelu M, Wong BJ, Brenner M, Bryar PJ, Jampol LM, Fawzi AA. Progression of hydroxychloroquine toxic effects after drug therapy cessation: new evidence from multimodal imaging. JAMA Ophthalmol 2013;131(9):1187–1197.
J Biochem Molecular Toxicology
DOI 10.1002/jbt
Chloroquine and Hydroxychloroquine Increase Retinal Pigment Epithelial Layer Permeability Nicoline M. Korthagen,1 Jeroen Bastiaans,1 Jan C. van Meurs,2,3 Kiki van Bilsen,4 P. Martin van Hagen,1,2,4 and Willem A. Dik1 1 Department 2 The
of Immunology, Erasmus MC, University Medical Center, P.O. Box 2060, 3000 CB Rotterdam, The Netherlands
Rotterdam Eye Hospital, P.O. Box 70030, 3000 LM Rotterdam, The Netherlands
3 Department
of Ophthalmology, Erasmus MC, University Medical Center, Rotterdam, The Netherlands
4 Department
of Internal Medicine, Erasmus MC, University Medical Center, Rotterdam, The Netherlands
Received 4 January 2015; accepted 22 January 2015
ABSTRACT: Antimalarials chloroquine (CQ) and hydroxychloroquine (HCQ) are widely used as antiinflammatory drugs, but side effects include retinopathy and vision loss. The objective of this study was to examine the effect of CQ and HCQ on the barrier integrity of retinal pigment epithelial (RPE) cell monolayers in vitro. Permeability of ARPE-19 cell monolayers was determined using Fluorescein isothiocyanate (FITC)labeled dextran. The influence of CQ and HCQ on cell death and the expression tight junction molecules was examined. CQ and HCQ significantly increased ARPE19 monolayer permeability after 3 and 18 h, respectively, and enhanced mRNA levels for claudin-1 and occludin. Cytotoxicity was only observed after 18 h exposure. Thus, CQ and HCQ rapidly enhance RPE barrier permeability in vitro, independent of cytotoxicity or loss of zonula occludens-1, claudin-1, and occludin expression. Our findings suggest that CQ/HCQ-induced permeability of the RPE layer may contribute to blood– retinal barrier breakdown in case of CQ/HCQ-induced C 2015 Wiley Periodicals, Inc. J Biochem retinopathy. Mol Toxicol 29:299–304, 2015; View this article online at wileyonlinelibrary.com. DOI 10.1002/jbt.21696
KEYWORDS: retinal pigment epithelial cell; barrier function; chloroquine; hydroxychloroquine; Transwell; tight-junctions
INTRODUCTION R The antimalarial drugs chloroquine (CQ: Aralen ) R and hydroxychloroquine (HCQ: Plaquenil ) are
Correspondence to: W. A. Dik. [email protected] Contract Grant Sponsor: Combined Ophthalmic Research Rotterdam (CORR-Project Code: 3.5.0). The authors have no conflict of interest to declare. C 2015 Wiley Periodicals, Inc.
widely used in the treatment of immune-mediated inflammatory diseases (IMIDs) such as rheumatoid arthritis, systemic lupus erythematosus (SLE), ¨ Sjogren’s syndrome, and sarcoidosis, where they exert beneficial effects on skin and joint symptoms. Moreover, HCQ therapy has been shown to prevent organ damage and reduces mortality in SLE patients [1]. So, long-standing maintenance therapy with these antimalarials is required in the majority of SLE patients. CQ and HCQ treatment is associated with limited side effects, which mainly include nausea and diarrhoea. However, one serious complication of CQ and HCQ treatment is the risk of developing irreversible macular retinopathy and vision loss, which is a major concern for both doctors and patients [2, 3]. Retinopathy occurs in ∼10–20% of patients treated with CQ and in ∼0.5–3.5% of patients treated with HCQ, and mostly affects the macular region, ranging from fine mottling to typical bull’s eye maculopathy [4–8]. However, functional loss may occur before changes in the retina can be detected and regular screening by an ophthalmologist does not always prevent vision loss [9]. The development of retinopathy due to CQ or HCQ treatment is clearly related to dosage and treatment duration [2, 10], but the underlying pathogenic mechanisms are so far poorly understood. CQ strongly accumulates in the pigmented ocular structures as a consequence of its affinity for melanin, but the drug-induced retinal toxicity is most likely unrelated to melanin binding [7, 11, 12]. CQ-induced retinopathy is associated with breakdown of the blood–retinal barrier (BRB), and the retinal pigment epithelium (RPE) that forms the outer layer of the BRB is considered an important target of CQ and HCQ toxicity [13–16]. As the RPE monolayer is central in maintaining the metabolism of the overlying 299
300
KORTHAGEN ET AL.
neuroretina and the metabolic demands are greatest in the macular region due to the high concentration of photoreceptors, it is conceivable that metabolic equilibrium disturbances first become manifest in the macula, resulting in the typical bull’s eye maculopathy. It has been demonstrated that in vitro exposure of human RPE cells to high concentrations of CQ (>100 μM) leads to the development of cytosolic vacuoles within 1 h and lysosomal dysfunction and cell lysis after 24 h [14, 16]. The retinal toxic effects of HCQ are far less clear, but HCQ has been found to interfere less with lysosomal degradation capacity of photoreceptor outer segments in bovine RPE cells than CQ [15]. The frequent use of CQ and HCQ in IMID management, together with the serious concerns of retinopathy development and our limited mechanistic insight, warrants further studies that explore the mechanisms underlying CQ and HCQ retinotoxicity. Eventually such studies may provide insight to guide the development of protective measures. We hypothesized that both CQ and HCQ have direct disrupting effects on RPE barrier function, which may contribute to loss of BRB with secondary changes in the overlying photoreceptors or neuroretina resulting in vision loss. In the present study, we therefore examined the effect of CQ and HCQ on the barrier integrity of retinal pigment epithelial cell monolayers (cell line ARPE-19) in vitro by measuring permeability to dextran molecules in a Transwell culture system. In addition, the effect of CQ and HCQ on the expression of the tight junction proteins zonula occludens-1 (ZO-1; tight junction protein-1), claudin-1, and occludin was examined.
MATERIALS AND METHODS Cell Culture ARPE-19 cells were obtained from ATCC (Manassas, VA) and were cultured in Dulbecco’s modified Eagle’s medium/Ham’s F12 (1:1) containing L-glutamine and 4-(4-hydroxyethyl)-I-piperazine-ethanesulfonic acid (HEPES; Thermo Scientific, Waltham, MA) and supplemented with penicillin/streptomycin (Lonza, Walkersville, MD) and 10% heat-inactivated fetal calf serum (FCS; Lonza).
RPE Monolayer Permeability Analysis ARPE-19 monolayers were established on 12-mm diameter polyester Transwell inserts with 0.4 μm pore size (Corning, NY). The Transwell inserts were coated with 5 μg/mL fibronectin (BD Biosciences, San Jose, CA) for at least 2 h and washed with phosphate
Volume 29, Number 7, 2015
buffered saline (PBS). Subsequently, cells were seeded at 1 × 105 cells/well in medium containing 10% FCS. At least twice a week, fresh culture medium containing 1% FCS was added. Transepithelial resistance (TER) was measured using the EVOM epithelial tissue voltohmmeter, and the net TER (·cm2 ) was calculated by subtracting the value from a control insert without cells and multiplication by the effective growth area (1.12 cm2 ). Transwell plates with ARPE-19 cell monolayers with TER values of at least 35 ·cm2 were used for subsequent experiments. Cells were exposed for 3, 5, or 18 h to 100 μM of CQ or HCQ (Sigma-Aldrich, St. Louis, MO) or an equal volume of diluent in medium containing 1% FCS. Hereafter, the medium was replaced with assay buffer (Hanks balanced salt solution [Sigma-Aldrich, St. Louis, MO] with 10 mM HEPES buffer [Gibco, Waltham, Massachusetts, USA]) and 250 μg/mL of Fluorescein isothiocyanate (FITC)-labeled dextran molecules (40 or 150 kDa; Sigma-Aldrich) was added to the apical compartment. Following 1 h incubation, supernatants from the basolateral compartment were harvested and the amount of FITC–dextran present was measured in duplicate using a FLUOSTAR Optima (BMG Labtech, Offenburg, Germany) with excitation at 480 nm and emission at 520 nm. Values were expressed as a percentage of the average control value.
Cytotoxicity Assay Potential cytotoxic effects of CQ and HCQ were determined by measuring lactate dehydrogenase (LDH) release after incubation periods of 3, 5, or 18 h. Hereto, cells were seeded at 2.5 × 105 cells/well in 12-wells plates (Nunc, Roskilde, Denmark) and allowed to adhere overnight. After incubation with medium containing 100 μM CQ, HCQ, or an equal volume of diluent, culture supernatants were collected, centrifuged (1500 rpm; 10 min) and LDH levels were measured using a Cytotoxicity Detection Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s recommendations. Cytotoxicity was expressed as a percentage relative to LDH release induced by total cell lysis with medium containing 1% Triton-X 100 (Sigma-Aldrich).
Detection of ZO-1, Claudin1, and Occludin mRNA Levels by Real-Time Quantitative Polymerase Chain Reaction ARPE-19 cells were exposed to 100 μM CQ or HCQ or an equal volume of diluent for 3, 5, or 18 h in medium containing 1% FCS. Messenger RNA was isolated using a GenElute total RNA miniprep kit (Sigma-Aldrich) and reverse transcribed into cDNA. Transcript levels of TJP1 (encoding ZO-1), CLDN1 J Biochem Molecular Toxicology
DOI 10.1002/jbt
Volume 29, Number 7, 2015
ANTIMALARIALS AFFECT THE RETINAL BARRIER
301
TABLE 1. PCR Primer and Probe Sequences Gene
Forward Primer 5’–3’
ABL
Reverse Primer 5’–3’ GATGTAGTTGCTTGGGACCCA
TJP1
TGGAGATAACATCTA AGCATAACTAAAGGT GAGACGCTGGAACTGACCAA
CLDN1 OCLN
TACTCCTATGCCGGCGACA CCAATGTCGAGGAGTGGGTTA
CCATCAAGGCACGGGTTG AAAACCGCTTGTCATTCACTTTG
TGTTTGTCTTGATCTATGATTTGCTT
(encoding claudin-1), and OCLN (encoding occludin) were determined by real-time quantitative polymerase chain reaction (RQ-PCR; 7700 PCR system; Applied Biosystems [ABI], Foster City, CA) and normalized to the control gene ABL, as described previously [17]. Subsequently, mRNA levels were expressed relative to unstimulated ARPE-19 cells. Primers and probes used for RQ-PCR are shown in Table 1.
Immunofluorescence Microscopic Analysis of ZO-1 Expression ARPE-19 monolayers on Transwell inserts were fixed with 4% paraformaldehyde solution, incubated for 5 min with PBS containing 0.3 M glycine and subsequently blocked for 1 h with PBS containing 1% bovine serum albumin. Thereafter, membranes were R incubated overnight at 4°C with an Alexa Fluor 488-labeled rabbit-anti-human ZO-1 antibody (Invitrogen, Waltham, Massachusetts, USA; 1:50 dilution). The membranes were removed from the inserts with a scalpel and mounted in 80% glycerol/Tris containing 0.4 μg/mL of the nuclear stain 4’,6-diamidino-2phenylindole (DAPI; Invitrogen).
Statistical Analysis Statistical analyses were performed using GraphPad Prism version 5.03 (San Diego, CA). For Transwell experiments, results from at least three separate experiments were compared using a Student’s t-test. If the variance between groups was not equal, a Welsh correction was applied. For LDH release and mRNA expression experiments, ANOVA with Bonferroni correction was used to compare data. A value of p < 0.05 was considered statistically significant.
RESULTS The Effect of CQ and HCQ on Monolayer Permeability CQ and HCQ significantly increased the permeability of the ARPE-19 cell monolayers for the dextran J Biochem Molecular Toxicology
DOI 10.1002/jbt
Probe 5’–3’ AGCTCTGGCATTATTCGCC TGCATACA AGCTCTGGCATTATTCGCC TGCATACA CGTGACCGCCCAGGCCATG TGACAGTCCCATGGCA TACTCTTCCAATG
molecules in a time-dependent manner (Figure 1A). The largest effects were observed after 18 h incubation with CQ, which caused a permeability for 40 kDa dextran of 205% compared to control and a permeability of 268% for 150 kDa dextran compared to control (Figure 1A). Significant effects of CQ on monolayer permeability were also observed after 3 and 5 h (Figure 1A). HCQ also significantly increased monolayer permeability after 18 h incubation, but not after 3 and 5 h (Figure 1B). In addition, after 18 h the permeabilityinducing effect of HCQ was less than that of CQ, with a permeability of 135% for 40 kDa dextran and 179% for 150 kDa dextran, compared to control (Figure 1B). These data indicate that CQ and HCQ rapidly increase the permeability of ARPE-19 cell monolayers.
The Effect of CQ and HCQ on Cell Death To rule out the possibility that the increase in monolayer permeability was due to cytotoxic effects LDH release was determined. CQ and HCQ at a concentration of 100 μM did not induce LDH release by ARPE-19 after 3 or 5 h incubation when compared to unstimulated controls (Figure 2). After 18 h, LDH release by ARPE-19 cells was slightly but significantly (p < 0.01) increased for both CQ (3.4% ± 1.0%; mean ± standard deviation) and HCQ (4.9% ± 1.3%) (Figure 2).
The Effect of CQ and HCQ on Gene Expression of Tight Junction Molecules To analyze whether CQ and HCQ affected tight junctions TJP1, CLDN1, and OCLN mRNA levels were determined. Neither CQ nor HCQ influenced TJP1 mRNA expression level by ARPE-19 at any of the time points examined (Figure 3). CLDN1 and OCLN mRNA expression significantly (p < 0.001) increased in ARPE19 cells after 18 h incubation with CQ or HCQ (Figure 3).
The Effect of CQ and HCQ on ZO-1 Protein Distribution in ARPE-19 Cells To examine a possible effect of CQ and HCQ on tight junction protein distribution, ZO-1 expression
302
KORTHAGEN ET AL.
Volume 29, Number 7, 2015
FIGURE 1. ARPE-19 monolayer permeability for dextran after 3, 5, or 18 h incubation with 100 μM CQ (A) or HCQ (B). Fluorescence was measured in the basal compartment of Transwell plates. Values from at least three independent experiments are expressed as a percentage of control. Bars represent mean ± SEM.
FIGURE 2. ARPE-19 cells were exposed for 3, 5, or 18 h to 100 μM CQ (A) or HCQ (B). Cytotoxicity was determined using a LDH detection kit. Values are represented as a percentage of the exposure to 1% Triton-X-100. *** p < 0.001.
by ARPE-19 cells was examined. ZO-1 distribution in control ARPE-19 monolayers showed the characteristic honeycomb distribution indicative of cellular membrane localization (Figure 4A). Exposure of the monolayers to CQ for a time period of 18 h did not influence this distribution, nor did it appear to change the abundance of ZO-1 (Figure 4B). Similarly, no effect of HCQ on ZO-1 distribution was observed (results not shown).
DISCUSSION Retinal toxicity is a serious side effect of CQ and HCQ treatment and is associated with breakdown of the BRB [13]. Under normal physiological conditions, the integrity of the outer BRB is controlled by the RPE cell layer [18]. Our current study is the first to show that CQ and HCQ can rapidly disrupt the barrier function
J Biochem Molecular Toxicology
DOI 10.1002/jbt
Volume 29, Number 7, 2015
ANTIMALARIALS AFFECT THE RETINAL BARRIER
303
FIGURE 3. Tight junction molecule mRNA expression in ARPE-19 cells. Expression of TJP1, CLDN1, and OCLN after exposure to 100 μM CQ (A) or HCQ (B) for 3, 5, or 18 h. Data are presented as relative expression compared to unstimulated cells. Bars represent mean ± SEM.
FIGURE 4. ZO-1 immunofluorescence of ARPE-19 cell monolayers. Representative image of control monolayer (A) and a monolayer exposed to 100 μM CQ for 18 h (B). ARPE-19 cells were grown on Transwell filters and stained for ZO-1 (green) and nucleus (DAPI; blue). Scale bar = 10 μm.
of human RPE cells. We found that CQ and HCQ cause a rapid increase in ARPE-19 monolayer permeability, which occurs within 5 h and is not associated with early cytotoxicity. HCQ had a less pronounced effect on ARPE-19 barrier disruption than CQ, whereas both compounds appeared to be equally cytotoxic to ARPE19 cells. Therefore, the lower incidence of retinopathy in HCQ-treated patients compared to CQ-treated patients is most likely not related to differences in direct cytotoxic effects on RPE cells. Epithelial tight junctions play a crucial role in maintaining epithelial integrity and barrier function J Biochem Molecular Toxicology
DOI 10.1002/jbt
[19]. Occludin and the members of the claudin family are transmembrane proteins that are essential components of tight junctions, and they interact with cytoplasmic scaffolding proteins like ZO-1 [20]. However, in our study short-term (less than 5 h) incubation of ARPE19 cells with CQ or HCQ did not influence mRNA expression levels of the tight junction proteins ZO-1, occludin, and claudin and neither did it influence the protein abundance and cellular distribution of ZO-1. Prolonged exposure of ARPE-19 to CQ and HCQ increased mRNA expression of occludin and claudin-1. This increased expression of tight junction molecules may be indicative of a stress response aimed at maintaining RPE monolayer integrity, which is in line with previous observations [21, 22]. The CQ and HCQ concentrations used in our experiments are similar to previous studies that found a cytotoxic effect of CQ on ARPE-19 cells [14]. The concentration CQ and HCQ used in this study is approximately 200 times higher than plasma levels measured in patients treated with CQ/HCQ [23, 24]. However, owing to accumulation over time, the concentration present in tissues can be much higher. For instance, it was shown in rats that local CQ concentrations in the eye can be as high as 500 mg/kg, more than 1000-fold
304
KORTHAGEN ET AL.
higher than in plasma and 10 times higher than the concentration used in this study [25]. To avoid visual loss, patients treated with longstanding high dose antimalarials are seen by an ophthalmologist on a regular basis. However, regular screening does not necessarily preclude visual loss as functional loss can occur before biomicroscopic changes are visible within the RPE layer [9]. By the time, bull’s eye maculopathy has developed, the damage is usually irreversible, and continuing functional loss can occur, even when treatment is ceased [26]. Further studies to unravel the cellular and molecular mechanisms underlying CQ- and HCQ-induced retinopathy are required as this may provide insight to guide the development of protective measures. In conclusion, our study is the first to demonstrate that CQ and HCQ rapidly induce permeability of RPE monolayers in vitro. Although the exact mechanism is unclear so far, this rapid increase in RPE monolayer permeability appears not to be related to cytotoxicity nor decreased expression of tight junction proteins. Our findings suggest that CQ/HCQ-induced permeability of the RPE layer may contribute to BRB breakdown in case of CQ/HCQ-induced retinopathy.
REFERENCES 1. Alarcon GS, McGwin G, Bertoli AM, Fessler BJ, CalvoAl´en J, Bastian HM, Vil´a LM, Reveille JD; LUMINA Study Group. Effect of hydroxychloroquine on the survival of patients with systemic lupus erythematosus: data from LUMINA, a multiethnic US cohort (LUMINA L). Ann Rheum Dis 2007;66(9):1168–1172. 2. Easterbrook M. The ocular safety of hydroxychloroquine. Semin Arthritis Rheum 1993;23(2, Suppl. 1):62–67. 3. Hobbs HE, Orsby A, Freedman A. Retinopathy following chloroquine therapy. Lancet 1959;2(7101):478–480. 4. Rynes RI. Ophthalmologic safety of long-term hydroxychloroquine sulfate treatment. Am J Med 1983;75(1A):35– 39. 5. Finbloom DS, Silver K, Newsome DA, Gunkel R. Comparison of hydroxychloroquine and chloroquine use and the development of retinal toxicity. J Rheumatol 1985;12(4):692–694. 6. Mavrikakis M, Papazoglou S, Sfikakis PP, Vaiopoulos G, Rougas K. Retinal toxicity in long term hydroxychloroquine treatment. Ann Rheum Dis 1996;55(3):187–189. 7. Bernstein HN. Ophthalmologic considerations and testing in patients receiving long-term antimalarial therapy. Am J Med 1983;75(1A):25–34. 8. Browning DJ. Hydroxychloroquine and chloroquine retinopathy: screening for drug toxicity. Am J Ophthalmol 2002;133(5):649–656. 9. Marmor MF, Kellner U, Lai TY, Lyons JS, Mieler WF. Revised recommendations on screening for chloroquine and hydroxychloroquine retinopathy. Ophthalmology 2011;118(2):415–422.
Volume 29, Number 7, 2015
10. Mackenzie AH. Dose refinements in long-term therapy of rheumatoid arthritis with antimalarials. Am J Med 1983;75(1A):40–45. 11. Rosenthal AR, Kolb H, Bergsma D, Huxsoll D, Hopkins JL. Chloroquine retinopathy in the rhesus monkey. Invest Ophthalmol Vis Sci 1978;17(12):1158–1175. 12. Leblanc B, Jezequel S, Davies T, Hanton G, Taradach C. Binding of drugs to eye melanin is not predictive of ocular toxicity. Regul Toxicol Pharmacol 1998;28(2):124– 132. 13. Raines MF, Bhargava SK, Rosen ES. The blood-retinal barrier in chloroquine retinopathy. Invest Ophthalmol Vis Sci 1989;30(8):1726–1731. 14. Yoon YH, Cho KS, Hwang JJ, Lee SJ, Choi JA, Koh JY. Induction of lysosomal dilatation, arrested autophagy, and cell death by chloroquine in cultured ARPE-19 cells. Invest Ophthalmol Vis Sci 2010;51(11):6030–6037. 15. Sundelin SP, Terman A. Different effects of chloroquine and hydroxychloroquine on lysosomal function in cultured retinal pigment epithelial cells. APMIS 2002;110(6):481–489. 16. Chen PM, Gombart ZJ, Chen JW. Chloroquine treatment of ARPE-19 cells leads to lysosome dilation and intracellular lipid accumulation: possible implications of lysosomal dysfunction in macular degeneration. Cell Biosci 2011;1(1):10. 17. Bastiaans J, van Meurs JC, Holten-Neelen C, Nagtzaam NM, van Hagen PM, Chambers RC, Hooijkaas H, Dik WA. Thrombin induces epithelial-mesenchymal transition and collagen production by retinal pigment epithelial cells via autocrine PDGF-receptor signaling. Invest Ophthalmol Vis Sci 2013;54(13):8306–8314. 18. Strauss O. The retinal pigment epithelium in visual function. Physiol Rev 2005;85(3):845–881. 19. Rizzolo LJ. Development and role of tight junctions in the retinal pigment epithelium. Int Rev Cytol 2007;258:195– 234. 20. Van Itallie CM, Anderson JM. Claudins and epithelial paracellular transport. Annu Rev Physiol 2006;68:403– 429. 21. Abe T, Sugano E, Saigo Y, Tamai M. Interleukin-1b and barrier function of retinal pigment epithelial cells (ARPE19): aberrant expression of junctional complex molecules. Invest Ophthalmol Vis Sci 2003;44(9):4097–4104. 22. Yoshikawa T, Ogata N, Izuta H, Shimazawa M, Hara H, Takahashi K. Increased expression of tight junctions in ARPE-19 cells under endoplasmic reticulum stress. Curr Eye Res 2011;36(12):1153–1163. 23. Miller DR, Fiechtner JJ, Carpenter JR, Brown RR, Stroshane RM, Stecher VJ. Plasma hydroxychloroquine concentrations and efficacy in rheumatoid arthritis. Arthritis Rheum 1987;30(5):567–571. 24. Wollheim FA, Hanson A, Laurell CB. Chloroquine treatment in rheumatoid arthritis. Correlation of clinical response to plasma protein changes and chloroquine levels. Scand J Rheumatol 1978;7(3):171–176. 25. McChesney EW, Banks WF Jr., Fabian RJ. Tissue distribution of chloroquine, hydroxychloroquine, and desethylchloroquine in the rat. Toxicol Appl Pharmacol 1967;10(3):501–513. 26. Mititelu M, Wong BJ, Brenner M, Bryar PJ, Jampol LM, Fawzi AA. Progression of hydroxychloroquine toxic effects after drug therapy cessation: new evidence from multimodal imaging. JAMA Ophthalmol 2013;131(9):1187–1197.
J Biochem Molecular Toxicology
DOI 10.1002/jbt
