Placenta 35 (2014) 37e43

Contents lists available at ScienceDirect

Placenta journal homepage: www.elsevier.com/locate/placenta

Cholestatic pregnancy is associated with reduced placental 11bHSD2 expression M. Martineau a, b, G. Papacleovoulou a, d, S. Abu-Hayyeh a, d, P.H. Dixon a, d, H. Ji c, R. Powrie b, L. Larson e, E.K. Chien c, C. Williamson a, d, * a

Maternal and Fetal Disease Group, Institute of Reproductive and Developmental Biology, Imperial College London, UK Division of Obstetric & Consultative Medicine, Women and Infants Hospital, Alpert Medical School of Brown University, Providence, RI, USA Division of Maternal-Fetal Medicine, Women and Infants Hospital, Alpert Medical School of Brown University, Providence, RI, USA d Women’s Health Academic Centre, Kings College London, 2nd Floor Hodgkin Building, Guy’s campus, London, UK e Division of Obstetric Medicine, Women’s Medicine Collaborative, Alpert Medical School of Brown University, Providence, RI, USA b c

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 23 October 2013

Introduction: Intrahepatic Cholestasis of Pregnancy (ICP) is associated with an increased risk of fetal morbidity and mortality and is characterised by elevated bile acids in the maternal and fetal compartments. Bile acids have been shown to attenuate renal 11bHSD2 expression and, given the protective role of placental 11bHSD2 in preventing fetal exposure to excessive maternal cortisol, we aimed to establish whether raised serum bile acids in ICP influence placental 11bHSD2 expression. Methods: Placental tissue from human and murine cholestatic pregnancy was evaluated for changes in 11bHSD2 mRNA expression compared to uncomplicated pregnancy using quantitative PCR. Parallel in vitro studies were performed using BeWo choriocarcinoma cells to assess the effect of different bile acid species on 11bHSD2 gene expression and whether concurrent UDCA administration can reverse any bile acid induced changes. Results: Placental 11bHSD2 mRNA expression was reduced in human and murine cholestatic pregnancy. In BeWo cells, treatment with the primary bile acid CDCA resulted in reduced 11bHSD2 gene expression, while treatment with other primary bile acids had no significant effect. Furthermore, the tertiary bile acid UDCA, used in the treatment of ICP did not significantly affect 11bHSD2 mRNA levels either alone, or when co-administered with CDCA. Discussion: Under cholestatic conditions placental 11bHSD2 mRNA is reduced. Studies in BeWo choriocarcinoma cells demonstrated that CDCA is likely to be the specific bile acid that mediates this effect. UDCA, the main bile acid used to treat cholestasis, did not reduce placental 11bHSD2 expression, further supporting its use in the management of ICP. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Placenta BeWo cells 11bHSD2 Bile acid Cortisol Intrahepatic cholestasis of pregnancy

1. Introduction Intrahepatic Cholestasis of Pregnancy (ICP) affects 0.7% of pregnancies and usually occurs after 30 weeks of gestation [1]. ICP is characterised by pruritus and biochemically by elevated maternal serum bile acids and liver enzymes. Raised serum bile acids are now considered to be the most suitable biochemical marker for the diagnosis and monitoring of the condition [2].

* Corresponding author. Maternal and Fetal Disease Group, Institute of Reproductive and Developmental Biology, Imperial College London, UK. Tel.: þ44 207 5942197. E-mail address: [email protected] (C. Williamson). 0143-4004/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.placenta.2013.10.019

ICP is associated with a significantly higher incidence of fetal complications, including fetal distress, spontaneous preterm labour, meconium staining of the amniotic fluid [1e3] and intrauterine death [4]. The risk of adverse pregnancy outcome is higher if the serum bile acid concentration is
40 mmol/l [2,4]. Treatment with ursodeoxycholic acid (UDCA) improves maternal pruritus, serum bile acid concentrations and liver function [3,5,6]. Two recent studies suggest that UDCA treatment may also have a beneficial effect on the rate of adverse pregnancy outcomes in ICP [3,7]. In patients with chronic liver disease, raised serum bile acids inhibit renal 11 beta hydroxysteroid dehydrogenase 2 (11bHSD2) leading to sodium and water retention [8,9]. Furthermore, reduced renal 11bHSD2 mRNA expression and enzyme activity has been reported in cholestatic rodents [10,11], and in vitro functional

38

M. Martineau et al. / Placenta 35 (2014) 37e43

studies demonstrate that administration of CDCA reduces 11bHSD2 enzyme activity [10,11] and increases transcriptional activation of the mineralocorticoid receptor [8]. Although morphological and gene expression changes have been described in placental tissue from pregnancies complicated by ICP [12e14], to our knowledge no studies have investigated the effect of ICP on placental 11bHSD2 expression. In human pregnancy, maternal cortisol levels rise threefold, and are typically 5e10 times higher than fetal levels [15,16]. 11bHSD2 is a uni-directional enzyme that oxidises cortisol to the more inert glucocorticoid hormone cortisone. In the placenta, 11bHSD2 has been localised to the syncytiotrophoblast [17]. Placental 11bHSD2 gene expression progressively increases throughout pregnancy, plateauing from 36 weeks of gestation and beyond [18,19]. Given that elevated serum bile acids down-regulated renal 11bHSD2 mRNA expression, we investigated 11bHSD2 gene expression in human and murine cholestatic placentas as well as in placental explants and choriocarcinoma cell lines cultured in medium containing different bile acids.

(Corning). Each well contained 1.5 mls of RPMIe1640 media (including: 1% amphotericin, 1% penicillin/streptomycin and 10% fetal calf serum). Tissue was incubated under modified cell culture conditions (5% CO2, 8% Oxygen and 37  C) reflective of normal physiological conditions in the third trimester [24]. The media was changed on days 2 and 4. On day 5 the explants were washed in ice-cold PBS and exposed to differing concentrations and types of bile acids in phenol red free media for 24 h (as below). 2.3. Placental cell lines

2. Methods

Immortalised choriocarcinoma cells (Jeg, Jar, TCL1 and BeWo b30 clone) were routinely cultured using DMEM F12 media (SigmaeAldrich, Gillingham, UK) containing: 1% amphotericin, 1% penicillin/streptomycin, 1% glutamine and 10% fetal calf serum under standard cell incubation conditions (5% CO2, 21% Oxygen and 37  C). Prior to confluence the cells were harvested using 1 Trypsin EDTA for 5 min after which it was inactivated with culture medium, centrifuged, re-suspended and then seeded at a concentration of 500,000 cells per well into 6 well plates. After 24 h the cells were washed in PBS solution, serum starved for 6 h and then differentiated with forskolin (20 mmol/l), in combination with differing concentrations (0e 300 mmol/l) of unconjugated bile acids, (cholic acid (CA), chenodeoxycholic acid (CDCA) and ursodeoxycholic acid (UDCA)), or conjugated bile acids, (taurocholic acid (TCA), taurochenodeoxycholic acid (TCDCA) and tauroursodeoxycholic acid (TUDCA)) for 24 h in phenol red-free DMEM F12 medium (SigmaeAldrich, Gillingham, UK); (including 1% amphotericin, 1% penicillin/streptomycin 1% glutamine and 2.5% charcoal stripped fetal calf serum). Samples were studied in triplicate.

This study was approved by Hammersmith Hospital Research Ethics Committee (reference 97/5197), and all participants provided written informed consent.

2.4. Murine studies

2.1. Human placenta Placental 11bHSD2 gene expression was analysed in placental samples taken from 10 women with ICP delivered at Queen Charlottes Hospital and compared to placental samples taken from 11 women with uncomplicated pregnancy over the same time. Women were diagnosed as having ICP if they presented with pruritus in association with liver dysfunction and serum bile acids
40 mmol/l. Exclusion criteria for ICP were other causes of hepatic dysfunction, including pre-eclampsia, the HELLP (haemolysis, elevated liver enzymes and low platelets) syndrome, acute fatty liver of pregnancy, primary biliary cirrhosis, viral hepatitis and any ultrasound abnormality that may result in biliary obstruction. Exclusion criteria for control subjects were the same as those for cases, but also included a history of pruritus during the current or any previous pregnancy. Of the 10 women with ICP, 5 received treatment with UDCA and 5 were not treated. The clinical and demographic characteristics for pregnancies complicated by ICP are shown in Table 1. There was no significant difference in maternal age between cases 33.2 (1.3) and controls 36.2 (2.0) years. In keeping with obstetric practice at the study centre, the gestational week at delivery in the control group was higher compared to women with ICP 39.4 (03) vs 37.4 (0.1) (p  0.05). However placental 11bHSD2 gene expression does not alter from 36 weeks gestation onwards [18,19]. Samples were not matched for mode of delivery as this has not been shown to influence placental 11bHSD2 mRNA expression [19e21]. Similarly, infant gender does not influence placental 11bHSD2 mRNA expression [22,23]. Samples from whole placenta were dissected and small segments (approximately 2 cm3) were soaked in 5 times volume RNA laterÔ (Life Technologies Ltd, Paisley, UK) for 24 h, or snap frozen on dry ice within 30 min of delivery. Samples were subsequently stored at 80  C until use. 2.2. Placental explants Syncytial tissue was dissected from whole placenta under sterile conditions. Samples were placed into paired wells in 6 well plates containing netwell inserts

Animal treatments were conducted in accordance with the Animals (Scientific Procedures) Act 1986 and the guidelines of The Centre of Biomedical Science, Imperial College, London. Procedures were approved by the Imperial College London ethical treatment of animals committee as previously described [25]. C57BL6 wild type mice were purchased from Harlan Laboratories (UK). Pre-conception, dietary supplementation with 0.5% cholic acid was assigned to one group (resulting in serum bile acids >100 mmol/), the other group was maintained on a standardised diet as previously described [25]. Humane killing was performed on the 18th day of gestation [25]. Placental tissue was then harvested, snap frozen in liquid nitrogen and stored at 80  C. 2.5. Reverse transcription and Q PCR Human and murine placental tissue was homogenised in 350 ml of betamercaptoethanol/RLT lysis buffer and RNA extracted using RNeasy mini kitÔ columns (Qiagen, Crawley, UK) in accordance to the manufacturer’s instructions. RNA Integrity Number values for human placentas ranged from 5.3 to 8.0. 1 ml of TrizolÔ (InvitrogeneLife Technologies, Paisley, UK) was added to wells containing placental explants and choriocarcinoma cells and the RNA extracted in accordance with the manufacturer’s instructions. cDNA was synthesised as previously described [26]. Gene expression was studied in triplicate using 384 and 96 RT PCR well plates on the 7900 Real Time PCR system (Life Technologies). A total reaction volume of 8e25 ml, including 10e40 ng of cDNA respectively, was used in conjunction with Sybr green jump startÔ (Sigmae Aldrich, Gillingham, UK). PCR analysis was performed under the following thermocycler conditions: 10 min 95  C and 40 cycles of 15 s at 95  C and 1 min at 60  C. Relative gene expression was calculated as 2DDCt, where DDCt ¼ DCt of the sample  DCt of the calibrator gene: Human 18S RNA (18S), L19 or Murine cyclophilin (mCyclo). In human placenta, quantification of syncytial tissue was made with reference to gene expression of beta human chorionic gonadotropin (behCG); a hormone whose expression is not affected by cholestasis [27] and relative 11bHSD2

Table 1 Maternal demographic data in ICP cases. Data expressed as mean values (SEM). CTG ¼ fetal cardiotocograph abnormality in (labour), EL CS ¼ Elective Caesarean Section, ICP ¼ Intrahepatic Cholestasis of Pregnancy, IOL ¼ Induction of Labour, MEC ¼ Meconium-stained amniotic fluid, NA ¼ Not applicable, PNS ¼ Post natal seizure, SROM ¼ Spontaneous Rupture of Membranes, VD ¼ Vaginal Delivery. ICP

Gestation age (weeks)

Mode of delivery

SBA at delivery (mmol/l)

ALT at delivery (IU/)

Maternal age (years)

Adverse fetal outcome

1 2 3 4 5 6 7 8 9 10 Mean

37.0 37.7 38.1 37.3 36.9 37.4 38.0 36.9 37.3 36.9 37.4 (0.1)

(IOL) VD (IOL) VD (IOL) VD El CS El CS (IOL) VD (IOL) VD (SROM) VD (IOL) VD El CS NA

120 43 96 54 100 103 56 92 101 69 83.4 (8.2)

370 85 491 65 496 284 41 24 187 532 275.5 (64.4)

34 30 34 32 36 29 36 31 31 36 33.2 (1.3)

MEC/CTG MEC e e MEC e e PNS e e NA

M. Martineau et al. / Placenta 35 (2014) 37e43 Table 2 Human and Murine Q PCR primers: (Final reaction concentration of 0.4 mmol/l). Forward 50 e30 Human primer b11HSD2 GCTCATCACCGGGTGTGACT bHCG GCTACTGCCCCACCATGACC 18S RNA CGCCGCTAGAGGTGAAATTC L19 CCAACTCCCGTCAGCAGATC SHP GGCTTCAATGCTGTCTGGAGT PXR GCCCAGTGTCAACGCAGAT FXR TCTCCTGGGTCGCCTGACT CAR AGAGCTGATCCGGACACTCCT RARa ACCGGGACAAGAACTGCATC HNF1a CCTGTCCCAACACCTCAACAA TGR5 CCTGCTCCCAACAGCCATCGAA VDR CTTCTGTCGGGGCGCCTTGG GGCTCCAGGCGGTGCTTGTTC TNFa Murine primer b11HSD2 TCATCACCGGTTGTGACACT mCyclo TGGAGAGCACCAAGACAGACA

Reverse 50 e30 GGGCTGTTCAACTCCAATACG ATGGACTCGAAGCGCACATC TTGGCAAATGCTTTCGCTC CAAGGTGTTTTTCCGGCATC CCCTTTCAGGCAGGCATATT GGCCCTCCTGAAAAAGCC ACTGCACGTCCCAGATTTCAC GGAGGCCTAAACTGCACAAACT TTGGACATGCCCACTTCAAA TTGAAACGGTTCCTCCGC ATGGGGCTGCAGGTCGTGTC ACCCAAAGGCTTCCTCCACTCCA AGACGGCGATGCGGCTGATG TCTAGGGCACCAGGGCTATT TGCCGGAGTCGACAATGAT

expression was normalised to behCG expression. Q PCR primers are shown in Table 2. Data from each Q PCR experiment were combined and are presented as means and standard error of the mean (SEM). The numbers of replicate experiments are denoted by the number (n) given in Figure legends and text. Statistical analysis was performed using one-way analysis of variance (ANOVA) with the GraphPad Prism 5.0 software (GraphPad Software Inc., San Diego, USA). For single comparisons of placenta tissue gene expression, data were analysed using two-tailed non parametric testing (ManneWhitney U). Paired Student t-tests were performed for single comparisons of 11bHSD2 gene expression in differentiated BeWo cells with repeated measures ANOVA and NewmaneKeuls post-hoc testing run for multiple comparisons. In order to avoid any potential bias yielded by transformations through the equation 2DDCt, all statistical analysis of gene expression was performed at the DCt level (raw data). A p-value 20 mmol/l prior to parturition (mean duration 10 days) and a mean bile acid concentration of 83 mmol/l at delivery (range 43e120 mmol/l). The incidence of adverse fetal outcomes was 40% (Table 1). No cases of fetal asphyxia [2] were recorded, all umbilical artery cord pH levels were
7.2 and APGAR scores were
9 at one and 5 min respectively.

39

Despite normal APGAR scores at delivery one infant had two seizures 6 h post delivery, with elevated blood ammonia levels. With the exception of one arterial cord pH 36/40 weeks gestation). 11bHSD2 expression was normalised to 18S and bHCG; a marker of syncytiotrophoblast tissue. Comparable findings were found using L19 as a reference gene. (B) Murine placenta from mice fed a standard diet (n ¼ 9) or 0.5% cholic acid enriched diet (n ¼ 10) were harvested on day 18 of pregnancy. Gene expression was assayed using Q PCR. *p¼ 40 mmol/l at the time of delivery have reduced placental 11bHSD2 expression. Repression of 11bHSD2 mRNA was also reproduced in vitro following exposure of BeWo cells to increasing concentrations of CDCA. Other primary bile acids and the tertiary bile acid UDCA that is used to treat ICP did not influence 11bHSD2 expression. A strength of the study design was that all the ICP placenta samples analysed were from well phenotyped cases that had significantly prolonged cholestasis and severe disease at delivery (maternal serum bile acids >40 mmol/l) [2]. Consistent with previous studies [2,4] ICP cases were delivered earlier than controls. However, although studies have shown that 11bHSD2 mRNA expression changes with advancing gestation, it plateaus at 36 weeks and beyond [18,19]. Therefore gestational week at delivery is unlikely to have influenced this study because the placental tissue was obtained from women who were more than 36 weeks pregnant. The results are consistent with previous studies of the effect of elevated serum levels of CDCA on renal 11bHSD2 [8e11]. They are likely to represent a genuine repression of placental 11bHSD2 mRNA expression in ICP cases as repression of 11bHSD2 mRNA was observed both in vitro and in vivo under cholestatic conditions. A limitation to our study is that analysis of placental 11bHSD2 mRNA was not undertaken from multiple sample sites. An alternative explanation for the reduction of 11bHSD2 mRNA is ICP-induced fetal hypoxia, as placental 11bHSD2 expression is oxygen dependent [28] and there are reports of low cord pH in babies born to mothers with ICP [2]. However given that reciprocal changes in gene expression of 11bHSD2 were observed in vitro following exposure to CDCA under normoxic conditions this is unlikely to provide a full explanation for the changes described here. Furthermore, no ICP cases had reduced umbilical cord pH or low APGAR scores in this study. Alternatively, repression of placental 11bHSD2 may be attributable to bile acid-induced oxidative stress or secondary to their direct detergent actions on plasma membranes, both of which have been previously reported [29e31]. However, CDCA-mediated reduction in 11bHSD2 expression in the current study occurred at a concentration lower than would be expected to have a toxic detergent effect. The mechanism through which CDCA influences 11bHSD2 mRNA is unconfirmed. Placental gene expression of the key receptors involved in bile acid homeostasis (FXR, SHP, PXR and CAR) is very low [32]; and we found expression of FXR, SHP, PXR, CAR, VDR, TGR5, and HNF1a, to be very low in BeWo cells. Furthermore although RAR was expressed (CT 25  1.0), it was unaffected by

41

exposure to CDCA. TNFa has been shown to repress 11bHSD2 expression and activity in placental tissue [33]. Endogenous TNFa gene expression has been observed in purified term trophoblast and differentiated BeWo cells [34] and protein expression of placental TNFa has been reported to be significantly increased in ICP placentas [35]. However, TNFa mRNA expression in BeWo cells exposed to 50 mmol/l of CDCA was low, suggesting that any significant influence of TNFa would have to have been exerted by posttranscriptional modification of the protein rather than up regulation of gene expression. Bile acids are also known to interact with various additional signalling pathways including calcium mobilization or protein kinase activation [36]. It is therefore possible that an alternative, as yet unidentified pathway is involved in bile acid induced 11bHSD2 gene repression in the placenta. Possible explanations for the less marked reduction in murine placental 11bHSD2 expression include differences in the bile acid pool between mice and humans, or the fact that uncomplicated murine pregnancy is mildly cholestatic [25] potentially reducing the comparative difference in murine placental 11bHSD2 gene expression between the two groups. The reduction in 11bHSD2 expression is likely to reflect an associated reduction in enzyme activity. A direct relationship between placental 11bHSD2 mRNA levels and activity has been reported [37e39] in which 11bHSD2 mRNA and activity were both found to be reduced. Similar observations have also been reported in vitro [28,40]. The consequences of ‘programming’, whereby a stimulus or insult at a sensitive period of early life may have a permanent and detrimental effect on the structure, physiology or metabolism of the offspring is now well accepted [41]. It is possible that reduced 11bHSD2 gene expression in ICP will result in the exposure of the fetus to increased concentrations of maternal glucocorticoids, which may impact upon metabolic homeostasis [42]. Indeed a recent study reported increased fasting insulin levels, dyslipidaemia, BMI and adipose tissue distribution in teenage offspring of pregnancies complicated by ICP [43]. Within the developing fetal brain, the hippocampus, is thought to be particularly sensitive to the effects of excessive glucocorticoid exposure [44]. In addition reduced placental 11bHSD2 activity has been associated with alterations in the behaviour of affected offspring, with increased rates of anxiety and impaired cognitive and behavioural development [45]. The above findings suggest that babies born to mothers whose pregnancy is complicated by ICP may be exposed to increased concentrations of maternal cortisol in utero and this may have important sequelae with regard to long-term health. 5. Conclusion In summary, we have shown that placental 11bHSD2 expression is significantly reduced in pregnancies complicated by ICP. In vitro studies using BeWo choriocarcinoma cells cultured with different primary bile acids suggest that CDCA is the main bile acid involved in 11bHSD2 repression. However currently the signalling pathway involved remains uncertain. Importantly UDCA appeared to have no influence on 11bHSD2 gene expression but was also not able to rescue 11bHSD2 expression from CDCA-mediated repression. Further studies are warranted to evaluate the relationship between bile acid-induced repression of placental 11bHSD2 mRNA expression and fetal well being in order to explore both the short and long term effects that cholestatic pregnancy may have on the offspring. Funding This study was supported by the Genesis Research Trust, UK, The Department of Obstetric Medicine at The Women and Infants

42

M. Martineau et al. / Placenta 35 (2014) 37e43

Hospital Providence RI. USA, and the NIHR Biomedical Research Centre at Imperial College London. Acknowledgements The authors would like to thank Professor David Sullivan at the John Hopkins Bloomberg Malaria Research Institute, Baltimore, USA for supplying the BeWo cells. We are grateful to Dr. Mark Sullivan Imperial College London for facilitating our experiments and Jenny Chambers, Mavis Machirori, Nicole King, Imperial College London who facilitated placental sample collection as well as the women who gave placental samples for analysis. We would also like to acknowledge The Genesis Research Trust, Brown University and the NIHR Biomedical Research Centre at Imperial College London for funding this study. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.placenta.2013.10.019. References [1] Geenes V, Williamson C. Intrahepatic cholestasis of pregnancy. World J Gastroenterol: WJG 2009;15(17):2049e66. Epub 2009/05/07. [2] Glantz A, Marschall HU, Mattsson LA. Intrahepatic cholestasis of pregnancy: relationships between bile acid levels and fetal complication rates. Hepatology 2004;40(2):467e74. Epub 2004/09/16. [3] Chappell LC, Gurung V, Seed PT, Chambers J, Williamson C, Thornton JG. Ursodeoxycholic acid versus placebo, and early term delivery versus expectant management, in women with intrahepatic cholestasis of pregnancy: semifactorial randomised clinical trial. BMJ 2012;344:e3799. Epub 2012/06/15. [4] Geenes V, Chappell LC, Seed PT, Steer PJ, Knight M, Williamson C. Association of severe intrahepatic cholestasis of pregnancy with adverse pregnancy outcomes: a prospective population-based case-control study. Hepatology 2013. http://dx.doi.org/10.1002/hep.26617. [5] Zapata R, Sandoval L, Palma J, Hernandez I, Ribalta J, Reyes H, et al. Ursodeoxycholic acid in the treatment of intrahepatic cholestasis of pregnancy. A 12-year experience. Liver Int Official J Int Assoc Study Liver 2005;25(3):548e 54. Epub 2005/05/25. [6] Palma J, Reyes H, Ribalta J, Hernandez I, Sandoval L, Almuna R, et al. Ursodeoxycholic acid in the treatment of cholestasis of pregnancy: a randomized, double-blind study controlled with placebo. J Hepatol 1997;27(6):1022e8. Epub 1998/02/07. [7] Bacq Y, Sentilhes L, Reyes HB, Glantz A, Kondrackiene J, Binder T, et al. Efficacy of ursodeoxycholic acid in treating intrahepatic cholestasis of pregnancy: a meta-analysis. Gastroenterology 2012;143(6):1492e501. Epub 2012/08/16. [8] Stauffer AT, Rochat MK, Dick B, Frey FJ, Odermatt A. Chenodeoxycholic acid and deoxycholic acid inhibit 11 beta-hydroxysteroid dehydrogenase type 2 and cause cortisol-induced transcriptional activation of the mineralocorticoid receptor. J Biol Chem 2002;277(29):26286e92. Epub 2002/05/17. [9] Quattropani C, Vogt B, Odermatt A, Dick B, Frey BM, Frey FJ. Reduced activity of 11 beta-hydroxysteroid dehydrogenase in patients with cholestasis. J Clin Invest 2001;108(9):1299e305. Epub 2001/11/07. [10] Ackermann D, Vogt B, Escher G, Dick B, Reichen J, Frey BM, et al. Inhibition of 11beta-hydroxysteroid dehydrogenase by bile acids in rats with cirrhosis. Hepatology 1999;30(3):623e9. Epub 1999/08/26. [11] Escher G, Nawrocki A, Staub T, Vishwanath BS, Frey BM, Reichen J, et al. Down-regulation of hepatic and renal 11 beta-hydroxysteroid dehydrogenase in rats with liver cirrhosis. Gastroenterology 1998;114(1):175e84. Epub 1998/01/15. [12] Geenes VL, Lim YH, Bowman N, Tailor H, Dixon PH, Chambers J, et al. A placental phenotype for intrahepatic cholestasis of pregnancy. Placenta 2011;32(12):1026e32. Epub 2011/10/22. [13] Wei J, Wang H, Yang X, Dong M, Wang Z. Altered gene profile of placenta from women with intrahepatic cholestasis of pregnancy. Arch Gynecol Obstet 2010;281(5):801e10. Epub 2009/07/01. [14] Wikstrom Shemer E, Thorsell M, Ostlund E, Blomgren B, Marschall HU. Stereological assessment of placental morphology in intrahepatic cholestasis of pregnancy. Placenta 2012;33(11):914e8. Epub 2012/10/02. [15] Predine J, Merceron L, Barrier G, Sureau C, Milgrom E. Unbound cortisol in umbilical cord plasma and maternal plasma: a reinvestigation. Am J Obstet Gynecol 1979;135(8):1104e8. Epub 1979/12/15. [16] Campbell AL, Murphy BE. The maternal-fetal cortisol gradient during pregnancy and at delivery. J Clin Endocrinol Metab 1977;45(3):435e40. Epub 1977/09/01.

[17] Krozowski Z, MaGuire JA, Stein-Oakley AN, Dowling J, Smith RE, Andrews RK. Immunohistochemical localization of the 11 beta-hydroxysteroid dehydrogenase type II enzyme in human kidney and placenta. J Clin Endocrinol Metab 1995;80(7):2203e9. Epub 1995/07/01. [18] Schoof E, Girstl M, Frobenius W, Kirschbaum M, Repp R, Knerr I, et al. Course of placental 11beta-hydroxysteroid dehydrogenase type 2 and 15hydroxyprostaglandin dehydrogenase mRNA expression during human gestation. Eur J Endocrinol/Eur Fed Endocr Soc 2001;145(2):187e92. Epub 2001/07/17. [19] Murphy VE, Clifton VL. Alterations in human placental 11beta-hydroxysteroid dehydrogenase type 1 and 2 with gestational age and labour. Placenta 2003;24(7):739e44. Epub 2003/07/11. [20] Sun K, Yang K, Challis JR. Differential expression of 11 beta-hydroxysteroid dehydrogenase types 1 and 2 in human placenta and fetal membranes. J Clin Endocrinol Metab 1997;82(1):300e5. Epub 1997/01/01. [21] Lopez Bernal A, Anderson AB, Turnbull AC. The lack of influence of labor on human placental 11 beta-hydroxysteroid dehydrogenase activity. J Clin Endocrinol Metab 1982;54(6):1251e4. Epub 1982/06/01. [22] O’Donnell KJ, Bugge Jensen A, Freeman L, Khalife N, O’Connor TG, Glover V. Maternal prenatal anxiety and downregulation of placental 11beta-HSD2. Psychoneuroendocrinology 2012;37(6):818e26. Epub 2011/10/18. [23] Mericq V, Medina P, Kakarieka E, Marquez L, Johnson MC, Iniguez G. Differences in expression and activity of 11beta-hydroxysteroid dehydrogenase type 1 and 2 in human placentas of term pregnancies according to birth weight and gender. Eur J Endocrinol/Eur Fed Endocr Soc 2009;161(3):419e25. Epub 2009/06/23. [24] Sullivan M, Galea P, Latif S. What is the appropriate oxygen tension for in vitro culture? Mol Hum Reprod 2006;12(11):653. Epub 2006/09/30. [25] Milona A, Owen BM, van Mil S, Dormann D, Mataki C, Boudjelal M, et al. The normal mechanisms of pregnancy-induced liver growth are not maintained in mice lacking the bile acid sensor Fxr. Am J Physiol Gastrointest Liver Physiol 2010;298(2):G151e8. Epub 2009/10/10. [26] Owen BM, Milona A, van Mil S, Clements P, Holder J, Boudjelal M, et al. Intestinal detoxification limits the activation of hepatic pregnane X receptor by lithocholic acid. Drug Metab Dispos: Biol Fate Chem 2010;38(1):143e9. Epub 2009/10/03. [27] Eloranta ML, Heinonen S, Kirkinen P. Intrahepatic cholestasis of pregnancy has no effect on maternal serum second trimester alpha-fetoprotein and hCG. Acta Obstet Gynecol Scand 2000;79(7):548e52. Epub 2000/08/10. [28] Homan A, Guan H, Hardy DB, Gratton RJ, Yang K. Hypoxia blocks 11betahydroxysteroid dehydrogenase type 2 induction in human trophoblast cells during differentiation by a time-dependent mechanism that involves both translation and transcription. Placenta 2006;27(8):832e40. Epub 2005/11/08. [29] Billington D, Evans CE, Godfrey PP, Coleman R. Effects of bile salts on the plasma membranes of isolated rat hepatocytes. Biochem J 1980;188(2):321e 7. Epub 1980/05/15. [30] Faubion WA, Guicciardi ME, Miyoshi H, Bronk SF, Roberts PJ, Svingen PA, et al. Toxic bile salts induce rodent hepatocyte apoptosis via direct activation of Fas. J Clin Invest 1999;103(1):137e45. Epub 1999/01/12. [31] Reinehr R, Graf D, Haussinger D. Bile salt-induced hepatocyte apoptosis involves epidermal growth factor receptor-dependent CD95 tyrosine phosphorylation. Gastroenterology 2003;125(3):839e53. Epub 2003/09/02. [32] Geenes VL, Dixon PH, Chambers J, Raguz S, Marin JJ, Bhakoo KK, et al. Characterisation of the nuclear receptors FXR, PXR and CAR in normal and cholestatic placenta. Placenta 2011;32(7):535e7. Epub 2011/05/21. [33] Chisaka H, Johnstone JF, Premyslova M, Manduch Z, Challis JR. Effect of proinflammatory cytokines on expression and activity of 11beta-hydroxysteroid dehydrogenase type 2 in cultured human term placental trophoblast and human choriocarcinoma JEG-3 cells. J Soc Gynecol Investig 2005;12(5):303e9. Epub 2005/ 06/28. [34] Knofler M, Kiss H, Mosl B, Egarter C, Husslein P. Interleukin-1 stimulates tumor necrosis factor-alpha (TNF-alpha) release from cytotrophoblastic BeWo cells independently of induction of the TNF-alpha mRNA. FEBS Lett 1997;405(2):213e8. Epub 1997/03/24. [35] Zhang SJ. Immunohistochemical study on the expression of TNF alpha in placenta in intrahepatic cholestasis of pregnancy. Acta Acad Med Xuzhou 2007;27(7):451e2. [36] Nguyen A, Bouscarel B. Bile acids and signal transduction: role in glucose homeostasis. Cell Signal 2008;20(12):2180e97. Epub 2008/07/19. [37] Struwe E, Berzl GM, Schild RL, Beckmann MW, Dorr HG, Rascher W, et al. Simultaneously reduced gene expression of cortisol-activating and cortisolinactivating enzymes in placentas of small-for-gestational-age neonates. Am J Obstet Gynecol 2007;197(1):43.e1-6. Epub 2007/07/10. [38] Wachter R, Masarik L, Burzle M, Mallik A, von Mandach U. Differential expression and activity of 11beta-hydroxysteroid dehydrogenase in human placenta and fetal membranes from pregnancies with intrauterine growth restriction. Fetal Diagn Ther 2009;25(3):328e35. Epub 2009/09/25. [39] Causevic M, Mohaupt M. 11beta-Hydroxysteroid dehydrogenase type 2 in pregnancy and preeclampsia. Mol Aspects Med 2007;28(2):220e6. Epub 2007/05/29. [40] Sharma A, Guan H, Yang K. The p38 mitogen-activated protein kinase regulates 11beta-hydroxysteroid dehydrogenase type 2 (11beta-HSD2) expression in human trophoblast cells through modulation of 11beta-HSD2 messenger ribonucleic acid stability. Endocrinology 2009;150(9):4278e86. Epub 2009/06/06. [41] Gluckman PD, Hanson MA, Bateson P, Beedle AS, Law CM, Bhutta ZA, et al. Towards a new developmental synthesis: adaptive developmental plasticity and human disease. Lancet 2009;373(9675):1654e7. Epub 2009/05/12.

M. Martineau et al. / Placenta 35 (2014) 37e43 [42] Dalziel SR, Walker NK, Parag V, Mantell C, Rea HH, Rodgers A, et al. Cardiovascular risk factors after antenatal exposure to betamethasone: 30-year follow-up of a randomised controlled trial. Lancet 2005;365(9474):1856e62. Epub 2005/06/01. [43] Papacleovoulou G, Shadi A-H, Nikolopoulou E, Briz O, Owen BM, Nikolova V, et al. Maternal cholestasis during pregnancy programs metabolic disease in offspring. J Clin Invest 2013;123(7):3172e81. Epub 2013/07/01.

43

[44] Mesquita AR, Wegerich Y, Patchev AV, Oliveira M, Leao P, Sousa N, et al. Glucocorticoids and neuro- and behavioural development. Semin Fetal Neonatal Med 2009;14(3):130e5. Epub 2008/12/17. [45] Raikkonen K, Pesonen AK, Heinonen K, Lahti J, Komsi N, Eriksson JG, et al. Maternal licorice consumption and detrimental cognitive and psychiatric outcomes in children. Am J Epidemiol 2009;170(9):1137e46. Epub 2009/ 10/08.