Ecotoxicology and Environmental Safety 110 (2014) 288–297

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Chronic PFOS exposure alters the expression of neuronal development-related human homologues in Eisenia fetida Srinithi Mayilswami, Kannan Krishnan n, Mallavarapu Megharaj, Ravi Naidu Centre for Environmental Risk Assessment and Remediation, University of South Australia & CRC CARE, Mawson Lakes, Adelaide 5095, SA, Australia

art ic l e i nf o

a b s t r a c t

Article history: Received 26 May 2014 Received in revised form 13 September 2014 Accepted 15 September 2014

PFOS is a toxic, persistent environmental pollutant which is widespread worldwide. PFOS contamination has entered the food chain and is interfering with normal development in man and is neurotoxic, hepatotoxic and tumorigenic. The earthworm, Eisenia fetida is one of the organisms which can help to diagnose soil health and contamination at lower levels in the food chain. Studying the chronic effects of sub-lethal PFOS exposure in such an organism is therefore appropriate. As PFOS bioaccumulates and is not easily biodegraded, it is biomagnified up the food chain. Gene expression studies will give us information to develop biomarkers for early diagnosis of soil contamination, well before this contaminant passes up the food chain. We have carried out mRNA sequencing of control and chronically PFOS exposed E. fetida and reconstructed the transcripts in silico and identified the differentially expressed genes. Our findings suggest that PFOS up/down regulates neurodegenerative-related human homologues and can cause neuronal damage in E. fetida. This information will help to understand the links between neurodegenerative disorders and environmental pollutants such as PFOS. Furthermore, these up/down regulated genes can be used as biomarkers to detect a sub-lethal presence of PFOS in soil. Neuronal calcium sensor-2, nucleoside diphosphate kinase, polyadenylate-binding protein-1 and mitochondrial Pyruvate dehydrogenase protein-X component, could be potential biomarkers for sub lethal concentrations of PFOS. & 2014 Elsevier Inc. All rights reserved.

Keywords: Perfluorooctanesulfonic acid PFOS Earthworm Eisenia fetida Transcriptome assembly Differential gene expression

1. Introduction Perfluorooctanesulfonic acid (PFOS) is one of the persistent, hazardous and now widespread emerging environmental contaminants. In 2009 it was categorized at the Stockholm Convention as one of the persistent organic pollutants (POPs). It is used as a fire retardant (Key et al., 1997), a protective agent for carpets, paper and fabrics and also in cosmetic products, insecticides and as a corrosion inhibitor. Additionally, PFOS is also entering the environment from certain fluorinated materials by metabolic conversion (Tomy et al., 2003). It is being released into the environment by the disposal of these products and other industrial disposals. Due to the wide use for its unique properties, improper disposal and inadvertent release, PFOS has become detectable in natural waters, sediments, domestic sludge, dusts and even in the remote Arctic region (Noorlander et al., 2011, Kannan et al., 2005; Lechner and Knapp, 2011). PFOS disposed in sewage is absorbed by sludge and hence in agricultural lands when sludge is used as an organic amendment. As a result, PFOS can also be present in food products. Humans are exposed to PFOS via drinking water, food

n

Corresponding author. Fax: þ61 8 8302 3057. E-mail address: [email protected] (K. Krishnan).

http://dx.doi.org/10.1016/j.ecoenv.2014.09.017 0147-6513/& 2014 Elsevier Inc. All rights reserved.

and cosmetic products, dusts, and through industrial occupational exposure (Kannan et al., 2004; Begley et al., 2005). Other organisms are also exposed through similar routes. PFOS is not readily degraded biologically and has been shown to bioaccumulate and become biomagnified in the food chain and hence it is found in human serum and milk (Volkel et al., 2008) and in biota. Serum half-life has been reported to be about 5.4 years in humans (Olsen et al., 2007) and months in monkeys and rats (Seacat et al., 2002; Seacat et al., 2003). In both humans and animals PFOS exposure has been shown to cause adverse effects including hepatotoxicity, immunotoxicity, reproductive and developmental problems, neurotoxicity and potentially tumorigenicity of the liver, thyroid, pancreas, bladder and breasts (Alexander and Olsen, 2007; Ren et al., 2009). PFOS is known to bind to lipoproteins. Peroxisome proliferation, serum hypolipidemia and inhibition of gap junctional communication are some of the biological effects that have been reported (Berthiaume and Wallace, 2002; Guruge et al., 2006). Gene expression analysis has suggested that lipid metabolism pathways are altered; specifically peroxisomal fatty acid betaoxidation-related genes are being induced in hepatocytes from Atlantic salmon (Krovel et al., 2008). In monkeys and rats, subchronic dietary exposure results in disruption of both carbohydrate and lipid metabolism (Seacat et al., 2002, 2003). Acute

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

partial life-cycle toxicity test of PFOS has been carried out in Lampsilis siliquoidea and Ligumia recta (Hazelton et al., 2012), acute and chronic toxicity tests have been carried out in Daphnia magna and Moina macrocopa (Ji et al., 2008), chronic life-cycle test has been carried out in Chironomus tentans (MacDonald et al., 2004), genotoxicity has been carried out in Paramecium caudatum (Kawamoto et al., 2010). Many studies have explored the toxicity of PFOS to rats (Wang et al., 2012), mice, fish and monkeys (Seacat et al., 2002). PFOS accumulation from polluted environment in birds has been reported (Yoo et al., 2008) and fatty acid metabolism related gene expression study has been carried out in humans (Fletcher et al., 2013). Exposure to PFOS has resulted in the reduction of body weight and serum cholesterol, an increase in live weight (Olsen et al., 2003). Due to PFOS contamination up to 410 ng/g in agricultural soils (Washington et al., 2010) and 16.7 mg/g in field soil (Das et al., 2013), it is important to study the gene expression in terrestrial soil organisms such as the earthworm, Eisenia fetida. Changes in gene expression profiles in invertebrates have been reported in response to environmental toxic chemicals (Brulle et al., 2010). The change in gene expression would show the health impact of these pollutants on living organisms and serve as a powerful tool to diagnose the existence of sub-lethal levels of toxic pollutant such as PFOS. Next generation RNA sequencing is one of the tools now available to analyse such changes in gene expression profiles. In this paper we report gene expression changes in E. fetida chronically exposed to 10 mg/kg of PFOS for a long duration, about eight months.

2. Materials and methods 2.1. Chemicals Heptadecafluorooctane sulfonic acid potassium salt (PFOS) was obtained from Sigma Aldrich, Australia (Cat # 77282-10G, Z 98.0 percent).

289

2.4. RNA isolation and next generation sequencing Total RNA was isolated using the QIAGENs Mini Kit (Cat No: 74104) and the manufacturer’s protocol. Three worms each were taken from treatment and control for mRNA isolation and mRNA was isolated separately from each worm. One mRNA prep was used for mRNA sequencing and the other two was used to check the first two over expressed genes for verification by real-time-PCR. The worms were homogenized in suspension buffer using a Ploytron homogenizer. RNA was eluted in buffer and the integrity was verified by formaldehyde agarose gel (1.5 percent). The samples were stored at  80 1C and processed for sequencing. Paired-end RNA sequencing was performed using Illumina HiSeq 2000 at the Ramaciotti Centre for Gene Function Analysis, The University Of New South Wales, Sydney. 2.5. Sequence analysis Forward and reverse raw RNA sequence reads were joined separately and analyzed using Trinity software (Grabherr et al., 2011) installed on a Bigmem-1024 server at eRSA, Adelaide. Forward and reverse libraries were used to assemble transcripts; ‘minimum reads’ to join k-mers was set at 2 and ‘glue’ was set at 4. The assembled transcripts were translated and longest possible ORFs with 4130 amino acids were selected and annotated using stand-alone BLAST (NCBI-BLAST-2.2.28þ) and the UniProt database. NPKF normalized counts were compared and the transcripts selected that were more than 4-fold higher expressed at a significance of po0.001. Transcripts expressed more than 12-fold (po0.001) were also selected for analysis. The differential expression of neuronal calcium sensor-2 (NCS-2) and nucleoside diphosphate kinase (NDK-1) expressions were verified by real-time PCR (neuronal calcium sensor: primers, NCS2-F: AAAAGGAAGCAAACCGGACT, NCS2-R: AACTCACGGAAGTCGATGCT, product size: 254. nucleoside diphosphate kinase: primers: NDK-F: CGTGTGATGTTGGGTGAGAC, NDK-R: GACCCAGCTTTCTTCCACTG, Product size: 189).

3. Results and discussion 2.2. Worm culture

3.1. Transcript assembly and annotation

Individuals of the oligochaete, E. fetida were purchased from Bunnings (Parafield, Adelaide, Australia) and were initially used to develop the laboratory cultures. Animals were maintained in compost soil supplemented with fruit and vegetable waste, at 25 71 1C, 60 to 80 percent humidity and 16:8-hours light–dark cycle. Adult worms with well-developed clitella and 250–600 mg wet weight were used in the chronic toxicity differential gene expression studies by next generation mRNA sequencing.

From the mRNA sequence read-out, transcripts were de novo assembled using Trinity software installed on a Bigmem-1024 server, at eRSA, Adelaide. These transcripts were in silico translated and the best possible ORFs selected. The total translated peptides (ORFs) were 161110, which included all the possible trans-spliced isoforms with an average transcript length of 1581.76 bases. Among these, 106161 peptides retrieved hits when subjected to BLAST search. Among the rest, 3830 of the peptides retrieved hits of signal peptides and 8525 TmHMM topology; 33064 did not retrieve any result. The transcripts that gave ORFs longer than 130 amino acids which retrieved result from the database (UniProt) were taken for further analysis. The transcripts are analysed using Panther classification system and a pie chart (Fig. 1) is generated according to the biological processes (Mi et al., 2013).

2.3. Experimental design E. fetida earthworms were introduced into a neutral soil of pH 6.4 for differential gene expression studies. Soil was collected, air dried under shade and sieved to o 2 mm-mesh. An assay using pure PFOS was performed at 10 mg/kg concentration; controls were maintained simultaneously. Before introduction of earthworms, soils were artificially contaminated by mixing with PFOS in acetone solution and shaking end-to-end overnight. The solvent was then evaporated in a fume hood. Prior to introducing earthworms, soils were wetted to 50–60 percent of water-holding capacity. Initially, 15 worms were released into each container, 40 g of fruit and vegetable waste added every week and supplemented with powdered pulses. This cycle was repeated for 8 months. Finally, the worms were removed and placed on a wet paper towel for 2 h and then used for total RNA extraction.

3.2. Differential gene expression The differential expression analysis resulted in more than 2000 differentially expressed genes which were more than 4-fold different from the control (Fig. S1). The gene cluster analysis was carried out with these genes and given in Fig. S2. When the fold change was set at 12 and a significance of po0.001, there were 246 differentially expressed transcripts retrieved. Among these, isoforms and ‘function unknown’ genes were removed. Among these differentially expressed genes, 43 were up-regulated and 51 down-regulated. The differentially

290

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

expressed transcripts were grouped according to the number of fold differences and inferences made based upon the function of these proteins, previous reports and the known toxicological effects of PFOS (Tables 1–4). Among the differentially expressed genes, top two up

regulated genes where verified by real-time PCR and the up regulation by PFOS was found to be comparable to mRNA sequencing result. 3.3. Up-regulated genes involved in calcium signalling NCS-2, SSPO, CO1A2, CO5A3 and CAD23 are all up-regulated calcium-binding proteins in response to PFOS exposure (Table 1). NCS-2 is an EF-hand calcium-binding protein which is upregulated in PFOS treated E. fetida. PFOS exposure caused the upregulation of Calcium ATC1. However, polycyclic aromatic hydrocarbons (PAHs) have been shown to inhibit SERCA activity and it has been suggested that SERCA inhibition might alter Ca2 þ homeostasis in lymphocytes and other cells (Krieger et al., 1995). SSPO is a calcium-binding secreted glycoprotein which is strongly expressed in the mammalian central nervous system and plays a major role in neuronal survival, neurite out-growth and fasciculation (Gobron et al., 2000). CO1A2 and CO5A3 are structural proteins which constitute the extracellular matrix and also bind calcium. These proteins are up-regulated in E. fetida in response to PFOS exposure. Another calcium-binding protein, CAD23 is upregulated. CAD23 is expressed in mouse and human photoreceptors (Reiners et al., 2005; Siemens et al., 2002), whereas it is not expressed in Danio rerio (Glover et al., 2012). CAD23 mutation in mouse causes improper formation of the tip-link structure in sensory hair cells which leads to improper mechanotransduction of sound waves and hence hearing loss (Siemens et al., 2004). In Danio rerio, CAD23 has been implicated in playing a crucial role in circuit formation during neural development and maintenance of connections in the mature nervous system. 3.4. Down-regulated genes involved in calcium signalling

Fig. 1. Pie charts of the functional annotation of identified transcripts from PFOS treated Eisenia fetida based on biological process.

CANB2, DUOX2, UBAP2, LIG and BMP-1 are calcium-binding proteins that are down-regulated in PFOS-treated E. fetida (Table 1). CANB2 is an EF-hand calcium-binding protein with

Table 1 Calcium binding protein transcripts that are altered by PFOS exposure in Eisenia fetida. UniProt_ID

Gene ontology

Normalized gene expression

NCS2_CAEEL ATC1_ANOGA

Molecular function: calcium ion binding Cellular component: sarcoplasmic reticulum membrane Molecular function: calcium-transporting ATPase activity Cellular component: Filopodium Molecular function: calcium ion binding Biological process: axon extension, establishment of glial blood-brain barrier, nerve maturation Cellular component: cilium, microtubule basal body, synapse Molecular function: calcium ion binding biological process:: sensory perception of light and sound stimulus Molecular function: calcium ion binding Cellular component: apical plasma membrane, integral to membrane Molecular function: calcium ion binding, heme binding Biological process: peroxidase activity, cytokine-mediated signaling pathway, hydrogen peroxide catabolic process Cellular component: extracellular space Molecular function: calcium ion binding, metalloendopeptidase activity, zinc ion binding Biological process: cell differentiation, proteolysis Cellular component: focal adhesion, Z disc Molecular function: actin binding, calcium ion binding Biological process: actin crosslink formation Molecular function: Calcium binding protein Cellular component: extracellular space Biological process: cell adhesion Cellular component: collagen type I Molecular function: metal ion binding Biological process: blood vessel development, collagen fibril organization, Rho protein signal transduction Cellular component: collagen type V, endoplasmic reticulum lumen Molecular function: collagen binding Biological process: cell-matrix adhesion, skin development Cellular component: cytoplasm Biological process: behaviour, copulation

113 35

NRG_DROME

CAD23_MOUSE

CANB2_HUMAN DUOX2_PIG

BMP1_MOUSE

ACTN_DROME

UBAP2_HUMAN SSPO_CHICK CO1A2_RAT

CO5A3_HUMAN

LIG_AEDAE

9

8

-30 -9

-60

-12

-7 13 8

5

-8

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

291

Table 2 PFOS induced genes in Eisenia fetida that are implicated in neuronal development. UniProt_ID

Gene ontology

NDKA_DROME

Normalized gene expression

Cellular component: cytoplasm and microtubule associated complex Molecular function: ATP and GTP binding, magnesium ion binding, nucleoside diphosphate kinase activity Biological process: adherens junction organization PRDX6_BOVIN Cellular component: cytoplasmic membrane-bounded vesicle Molecular function: peroxidase activity Biological process: response to reactive oxygen species SCA_DROME Cellular component: extracellular region Molecular function: signal transducer activity Biological process: female meiosis chromosome segregation, Notch signaling pathway ALDOA_RAT Cellular component: flagellum, membrane, mitochondrion Molecular function: fructose-bisphosphate aldolase activity Biological process: glycolysis, response to estrogen stimulus, response to hypoxia CYB5_RAT Cellular component: endoplasmic reticulum membrane Molecular function: electron carrier activity Molecular function: heme binding ADK_RAT Cellular component: cytosol and nucleus Molecular function: adenosine kinase activity, ATP binding, metal ion binding Biological process: positive regulation of cardiac muscle hypertrophy, positive regulation of T cell proliferation, type B pancreatic cell proliferation ALDH2_BOVIN Cellular component: mitochondrial matrix Molecular function: aldehyde dehydrogenase (NAD) activity Biological process: ethanol catabolic process APLP1_HUMAN Cellular component: basement membrane Molecular function: heparin binding, transition metal ion binding Biological process: apoptotic process, nervous system development, organ morphogenesis FLNA_DROME Cellular component: actin cytoskeleton Molecular function: actin binding Biological process: cytoplasmic transport, nurse cell to oocyte, motor neuron axon guidance, negative regulation of lamellocyte differentiation, olfactory learning CNN3_HUMAN Cellular component: neuronal cell body, postsynaptic density Molecular function: calmodulin binding Molecular function: tropomyosin binding Biological process: negative regulation of ATPase activity ACTZ_RAT Cellular component: centrosome Molecular function: ATP binding PCM1_CHICK Cellular component: centriolar satellite Biological process: cilium assembly DOXA1_XENLA Cellular component: endoplasmic reticulum membrane Biological process: protein transport ACBG2_XENLA Cellular component: cytoplasm Molecular function: ATP binding, long-chain fatty acid-CoA ligase activity Biological_process: long-chain fatty acid metabolic process DLDH_PIG Cellular component: mitochondrial matrix Molecular function: dihydrolipoyl dehydrogenase activity, flavin adenine dinucleotide binding Biological process: cell redox homeostasis CUL1_PONAB Cellular_component: SCF ubiquitin ligase complex Biological_process: apoptotic process, cell proliferation, organ morphogenesis, protein monoubiquitination DYHC2_TRIGR Cellular component: cilium axoneme, cytoplasm, dynein complex and microtubule Molecular function: ATPase activity, microtubule motor activity Biological_process: cell projection assembly, ciliary or flagellar motility, multicellular organismal development SC6A9_XENLA Cellular component: integral to plasma membrane Molecular function: neurotransmitter:sodium symporter activity, sodium:amino acid symporter activity A4_CAEEL Cellular component: cytoplasmic vesicle, neuron projection Molecular function: transition metal ion binding Biological process: body morphogenesis, growth, locomotion, nematode larval development, nervous system development, reproduction BZW2_DANRE Biological process: cell differentiation, nervous system development, RNA metabolic process MYO6_HUMAN Cellular component: apical part of cell, axon, cell cortex, neuronal cell body Molecular function: actin filament binding, ADP & ATP binding, calmodulin binding Biological process: regulation of synaptic plasticity, synapse assembly, synaptic transmission, inner ear morphogenesis, sensory perception of sound

myristoylation. It is a regulatory subunit of calcineurin which is involved in T-cell activation and the target for immunosuppressant drugs such as cyclosporine (Liu et al., 1991). Calcineurin activity is important for axonal guidance and reinforcing synaptic connections in neurons, important for learning and memory (Winder et al., 1998). DUOX2 is an EF-hand calcium-binding NADPH oxidase which plays a critical role in generating H2O2 for the biosynthesis of thyroid hormone. It plays a key role in the host defence system

80

31

29

26

19

19

14

14

13

9

7 5 9  18

-18

-10 -3

11 10

 64 27

of the respiratory epithelium and the gastrointestinal tract (Caillou et al., 2001; Bae et al., 2010). DUOX2 has been shown to be expressed at elevated levels in prostate, lung, colon and breast tumours and is expressed with lower frequencies in brain tumors and lymphomas (Wu et al., 2013). UBAP2 has been identified as a contributor to risk for alcohol dependence in human and non-human species (Zuo et al., 2013). LIG is a cytoplasmic calcium-binding protein which has been

292

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

Table 3 PFOS induced gene expression in Eisenia fetida that are involved in reproduction. UniProt_ID

Gene ontology

Normalized gene expression

IF4G3_MOUSE

Molecular function: DNA binding, translation initiation factor activity Biological process: meiotic prophase I, positive regulation of protein phosphorylation, RNA metabolic process, spermatogenesis H2AX_HUMAN Cellular component: condensed nuclear chromosome, male germ cell nucleus Molecular function: damaged DNA binding Biological process: double-strand break repair via homologous recombination, spermatogenesis KDM3A_RAT Cellular component: cytoplasm, nucleus Molecular function: metal ion binding, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen Biological process: cell differentiation, chromatin modification, regulation of transcription, DNA-dependent, spermatogenesis, transcription, DNA-dependent BTG1_RAT Cellular component: cytoplasm, nucleus Molecular function: enzyme binding Biological process: negative regulation of cell proliferation, positive regulation of angiogenesis, regulation of apoptotic process, response to oxidative stress, spermatid development TSSK1_BOVIN Cellular component: acrosomal vesicle, flagellum Molecular function: ATP binding, metal ion binding, protein serine/threonine kinase activity Biological process: multicellular organismal development, spermatid development USP9X_HUMAN Cellular component: apical part of cell, cytosol Molecular function: cysteine-type endopeptidase activity, ubiquitin thiolesterase activity Biological process: BMP signaling pathway, chromosome segregation, female gamete generation, mitosis, negative regulation of transcription from RNA polymerase II promoter, protein deubiquitination, transforming growth factor beta receptor signaling pathway SPEF1_XENLA Cellular component: cilium axoneme, cytoplasm, cytoskeleton

shown to be necessary for initiation and termination of copulatory behaviour in Drosophila melanogaster. It is expressed in the central nervous system (CNS) during the late third-instar larva. It also has been shown with a reporter gene that LIG is expressed in the larval brain, in all glial cells and in clusters of contra-laterally projected neurons, the larval ventral ganglion, subperineurial glia, peripheral exit glia, and a number of interneurons but not in motor neurons (Kuniyoshi et al., 2003). BMP-1 is a metalloproteinase of the astacin family which has been shown to biosynthetically process collagen types I (Kessler et al., 1996), type V (Kessler et al., 2001) precursors into mature functional proteins in the formation of the extracellular matrix. In agreement with this, in PFOS-treated E. fetida, CO1A2 and CO5A3 are both up-regulated. The role of BMP signalling in hippocampal neurogenesis has been established in a knockout mouse model. In mice, the cortical hem generates bone morphogenetic (BMP) proteins to organize the hippocampus (Caronia et al., 2010). BMP-1 has been shown to be expressed in the ovary of sheep at both the mRNA and protein levels and in BMP1-like protease activity in follicular fluids. However, its exact physiological role is unknown (Canty-Laird et al., 2010). 3.5. Oxidative damage response genes ALDOA and PRDX6 are oxidative stress response related genes which are up-regulated in E. fetida in response to PFOS. PRDX6 is an antioxidant which is induced by oxidative stress and protects cells from oxidative stress-induced apoptosis, whereas in cultured cancer cells, it causes cell cycle arrest and apoptosis. 3.6. Fertility related genes H2AX is up-regulated and is involved in double strand break repair by modulating both homologous recombination and nonhomologous end joining pathways in double strand DNA breaks (Bassing et al., 2002). In PFOS treated E. fetida, H2AX is upregulated which is consistent with the report that PFOS cause DNA damage in earthworms (Xu et al., 2013). Furthermore, H2AX is involved in spermatogenesis; lysine-specific demethylase 3A is involved in spermatogenesis in mammals which is up-regulated in

-7

12

3

-11

-15

-5

-37

PFOS-treated E. fetida. IF4G3, BTG-1, TSSK1 and SPEF1 are involved in fertility and down-regulated in E. fetida exposed to PFOS (Table 3). 3.7. Gene involved in apoptosis APLP-1 is involved in apoptotic process which is up-regulated in PFOS-treated E. fetida. Cullin-1, Integrin alpha-6, BTG-1 and 4.5 LIM domains protein-2 are involved in apoptosis and downregulated in E. fetida in response to PFOS. BTG-1, Cullin-1 and Integrin alpha-6 are positive regulators of apoptosis whereas 4.5 LIM domains protein-2 is a negative regulator of apoptotic process. 3.8. PFOS toxicity In Atlantic salmon, PFOS has been shown to induce disulfide isomerase associated-3, an endoplasmic reticulum (ER) stress protein which can be induced by oxidative stress in mammals (Huang et al., 2009). Using artificial soils and contact filter paper studies, it has been shown in E. fetida that PFOS causes general growth inhibition. PFOS-induced oxidative stress in earthworms has been suggested based on the initial activation of the antioxidants such as superoxide dismutase, peroxidase, catalase and glutathione peroxidase and later, inhibition. Moreover, reduced glutathione content has been observed over the duration of the exposure. Furthermore, PFOS-induced DNA damage has also been reported (Xu et al., 2013). Brachionus calyciflorus showed a 24-h acute toxicity LC50 value of 61.8 mg/L for PFOS. Chronic toxicity tests with concentrations far lower than for lethality have shown reduced body and egg sizes. Furthermore, a prolonged duration of the juvenile period, reduced growth rate, reduced reproductive rat and population density and increased mictic ratio of the rotifers population have also been observed (Zhang et al., 2013). PFOS exposure has been shown to be positively correlated with the expression of genes involved in both cholesterol mobilization and transport in women but not in men (Fletcher et al., 2013). Gene expression profiling of gestational rat lungs has revealed that PFOS dose-dependently up-regulated 21 to 43 genes. It has been

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

Table 4 Ungrouped gene transcripts that are altered by PFOS exposure in Eisenia fetida.

Table 4 (continued ) UniProt_ID

UniProt_ID

Gene ontology

TXL_EISFO

Cellular component:: integral to membrane Biological process: cytolysis, defense response to bacterium, ion transport Cellular component:: intermediate filament Molecular function: structural molecule activity Cellular component: SCF ubiquitin ligase complex Biological process: protein ubiquitination Cellular component: ribosome Molecular function: structural constituent of ribosome Biological process: translation

MUG1_MOUSE

NF70_DORPE

SKP1_XENLA

RL27_DANRE

TPM_BRABE CYSP1_HOMAM

CD63_HUMAN

GDIR1_RAT

CO6A6_HUMAN

PPN_DROME

TTLL3_DANRE

TMED4_MOUSE

HDC_HUMAN GRB14_HUMAN

AMPE_RAT

CC113_BOVIN PLCL_MYTGA

Molecular function: cysteine-type peptidase activity Biological process: proteolysis Cellular component: cell surface, endosome membrane, integral to plasma membrane, protein complex Biological process: cellular protein localization, epithelial cell differentiation, negative regulation of epithelial cell migration Cellular component: cytoplasm, immunological synapse Molecular function: GTPase activator activity, Rho GDP-dissociation inhibitor activity Biological process: positive regulation of GTPase activity, regulation of protein localization, Rho protein signal transduction Cellular component: collagen, extracellular matrix Biological process: cell adhesion Cellular component: basement membrane Molecular function: extracellular matrix structural constituent, metalloendopeptidase activity, zinc ion binding Biological process: extracellular matrix organization, multicellular organismal development Cellular component: cilium axoneme, cytoplasm, microtubule Molecular function: protein-glycine ligase activity, initiating Biological process: axoneme assembly, cilium assembly, protein polyglycylation Cellular component: endoplasmic reticulum membrane Molecular function: signal transducer activity Biological process: positive regulation of I-kappaB kinase/NF-kappaB cascade, protein transport Biological process: respiratory tube development Cellular component: cytosol, endosome membrane, Golgi membrane Molecular function: phospholipid binding, blood coagulation, leukocyte migration Cellular component: integral to membrane, vesicle lumen Molecular function: metalloaminopeptidase activity, peptide binding, zinc ion binding Biological process: cell proliferation, cell migration Cellular component: protein complex Cellular component: extracellular region Molecular function: carbohydrate binding

Gene ontology

Normalized gene expression 61

59

29

22

21 20

19

19

18

16

15

15

13 13

12

11 8

293

Cellular component: extracellular space Molecular function: serine-type endopeptidase inhibitor activity Biological process: negative regulation of endopeptidase activity INF2_XENLA Biological process: actin cytoskeleton organization TB22B_HUMAN Cellular component: intracellular Molecular function: Rab GTPase activator activity Biological process: positive regulation of Rab GTPase activity QRIC2_HUMAN No known function CECR5_HUMAN Cellular component: mitochondrion Molecular function: hydrolase activity SELS_RAT Cellular component: integral to endoplasmic reticulum membrane Molecular function: selenium binding Biological process: intracellular protein transport, negative regulation of interleukin- production and tumor necrosis factor production VWDE_HUMAN Cellular component: extracellular region PHLB2_MOUSE Cellular component: cytoplasm, intermediate filament cytoskeleton, plasma membrane Molecular function: phospholipid binding ODPX_MOUSE Cellular component: mitochondrial matrix Molecular function: transferase activity, transferring acyl groups MON1A_MOUSE Biological process: cellular iron ion homeostasis, protein secretion ENOF1_XENLA Cellular component: mitochondrion Molecular function: isomerase activity, metal ion binding RSPH9_DANRE Cellular component: cilium axoneme, cytoplasm, cytoskeleton, motile cilium Biological process: cilium axoneme assembly, cilium movement IF2B2_MOUSE Cellular component: cytoplasm, cytoskeletal part, nucleus Molecular function: mRNA’-UTR binding Biological process: regulation of translation SART3_PONAB Cellular component: cytoplasm, nuclear speck Molecular function: nucleotide binding, RNA binding Biological process: RNA processing GBB_PINFU Cellular component: cytoplasm Molecular function: signal transducer activity KDM5B_CHICK Cellular component: nucleus Molecular function: DNA binding, metal ion binding Biological process: regulation of transcription, DNA-dependent ZN710_MOUSE Cellular component: nucleus Molecular function: DNA binding, zinc ion binding Biological process: regulation of transcription, DNA-dependent, HMG2_DROME Cellular component: nucleus, polytene chromosome, single-stranded DNA binding Biological process: chromatin remodelling, negative regulation of antimicrobial humoral response, negative regulation of RNA polymerase II transcriptional preinitiation complex assembly SART3_HUMAN Cellular component: cytoplasm, intracellular membrane-bounded organelle, nuclear speck Molecular function: nucleotide binding Biological process: RNA processing

Normalized gene expression 7

6 9

 11 9  22

 11 4

 77

9  18

 13

 12

 13

5

9

 36

 13

294

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

Table 4 (continued )

Table 4 (continued )

UniProt_ID

Gene ontology

PL8L1_MOUSE AT8A1_MOUSE

No known function Cellular component: chromaffin granule membrane, endoplasmic reticulum Molecular function: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, Mg2 þ binding Biological process: cation transport Cellular component: cAMP-dependent protein kinase complex, cytosol, nucleus Molecular function: cAMP-dependent protein kinase activity, Mg2 þ binding Biological process: negative regulation of meiotic cell cycle Cellular component: clathrin adaptor complex, COPI vesicle coat Biological process: intra-Golgi vesiclemediated transport, intracellular protein transport, retrograde vesicle-mediated transport, Golgi to ER Biological process: response to stress Cellular component: chromatin, cytoplasm, nucleus, site of double-strand break Molecular function: ATPase activity, lipid binding, double-strand break repair Biological process: protein N-linked glycosylation via asparagine, protein ubiquitination Cellular component: integrin complex, plasma membrane Molecular function: metal ion binding Biological process: blood coagulation, cell adhesion, hemidesmosome assembly, integrin-mediated signaling pathway, leukocyte migration, negative regulation of apoptotic process, positive regulation of apoptotic process, positive regulation of transcription from RNA polymerase II promoter Cellular component: nucleolus Molecular function: DNA binding Cellular component: catalytic step spliceosome, cytoplasmic stress granule Molecular function: nucleotide binding, translation activator activity, mRNA splicing, via spliceosome, translational initiation No known function Molecular function: aspartic-type endopeptidase activity, endonuclease activity Biological process: nucleic acid phosphodiester bond hydrolysis, proteolysis, RNA-dependent DNA replication Cellular component: intracellular, plasma membrane Molecular function: GTP binding Biological process: small GTPase mediated signal transduction Cellular component: extracellular space Molecular function: cysteine-type endopeptidase inhibitor activity Biological process: blood coagulation, inflammatory response, vasodilation Cellular component: nucleus Molecular function: nucleotide binding, RNA binding Biological process: anatomical structure morphogenesis, erythrocyte maturation, mRNA processing, regulation of cell differentiation

KAPCB_RAT

COPD_BOVIN

YXIE_BACSU TERA_XENLA

ITA6_HUMAN

NUCL_XENLA PABP1_HUMAN

SR2A_PHYPO POL3_DROME

RHO_APLCA

KNG2_BOVIN

PTBP3_HUMAN

Normalized gene expression 9  14

6

8

 11 8

 11

 23  127

 29  20

UniProt_ID

Gene ontology

DDAH1_HUMAN Cellular component: mitochondrion Molecular function: amino acid binding, dimethylargininase activity, metal ion binding Biological process: arginine catabolic process, citrulline metabolic process, nitric oxide mediated signal transduction, positive regulation of angiogenesis, positive regulation of nitric oxide biosynthetic process, regulation of systemic arterial blood pressure FHL2_RAT Cellular component: actin cytoskeleton, focal adhesion, M band, nucleus, Z disc Molecular function: transcription factor binding, zinc ion binding Biological process: negative regulation of apoptotic process, response to hormone stimulus, transcription, DNA-dependent ITIH2_PIG Cellular component: extracellular region Molecular function: serine-type endopeptidase inhibitor activity Biological process: hyaluronan metabolic process CP089_DANRE Cellular component: extracellular region

Normalized gene expression  15

 23

7

9

demonstrated that in utero PFOS exposure resulted in upregulation of genes involved in cytoskeletal structure, extracellular matrix remodelling, lipid metabolism and secreted proteins in the fetal rat lung (Ye et al., 2012). Similarly, in our study, extra -cellular matrix proteins such as CO6A6, PPN, APLP1, CO1A2 and CO5A3 are up-regulated, the lipid metabolizing protein CYB5 is up-regulated and phospholipid translocating ATPases, AT8A1 are downregulated (Table 1). Proteomics analysis of Anguilla anguilla peripheral blood mononuclear cells treated with PFOS showed up-regulation of actinin alpha-1 and transitional endoplasmic reticulum ATPase and downregulation of the WD repeat domain 1, adenosine kinase, aldehyde dehydrogenase family 7, member A1 homolog and enolase A. Proteins such as Rho GDP dissociation inhibitor beta- and nonmuscle tropomyosin are down-regulated at lower PFOS concentrations and up-regulated in higher PFOS concentration treatments. Nevertheless, tropomyoson alpha-3 chain and actininalpha-1 variant are up-regulated at low concentrations and down-regulated in higher concentrations of PFOS (Roland et al., 2013). In the case of E. fetida, ACTN-alpha, ENOF1, TERA and GBB are down-regulated and ALDH2, TPM and GDIR1 are up-regulated. Hence, ENOF1 and GBB show similar results but other results are contradictory.

 26

3.9. Neuronal damage caused by PFOS  23

 16

PFOS has been shown to induce apoptosis in cerebellar granule cells via the ROS-mediated PKC signalling pathway (Lee et al., 2012). In contrast, in E. fetida, PKC is down-regulated (Table 2). PFOS causes disruption of tight junctions in brain micro-vascular endothelial cells (Wang et al., 2011). In primary cultured rat hippocampal neurons, PFOS has been shown to affect ion channels and glutamate-activated currents (Liao et al., 2009). Neonatal exposure of mice to PFOS alters the expression of CaMKII, GAP-43 and synaptophysin in the hippocampus, and synaptophysin and tau in the cerebral cortex which are important for neuronal growth and synaptogenesis during brain

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

development (Johansson et al., 2009). Wan Ibrahim et al. (2013) has shown that 50 nM PFOS induces differtiation in primary rat embryonic neural stem cells via peroxisome Proliferator activated receptorgamma, however, in case of Eisenia fetida, PPAR-ϒ could not be found. 3.10. Over-expressed genes that are involved in neuronal development NDKA is expressed during neuronal development and overexpression in neuronal cells has been demonstrated to result in increased neurite outgrowth. Extracellular NDKA is a stimulator for neurite outgrowth in a concentration-dependent manner in chick and rat dorsal root ganglia explants (Wright et al., 2010). Oxidative modification of NDPK could lead to decreased activity of NDPK and, consequently, influence several neuronal functions in neurodegenerative diseases (Kim et al., 2002). The over-expression of Prdx6 has been shown to cause a decrease in memory function in Aβ1-42-infused mice and also to increase amyloidogenesis and oxidative stress (Yun et al., 2013). PRDX6 has been demonstrated to be primarily expressed in astrocytes with very low levels in neurons and elevated in astrocytes in both white and grey matter in AD (Power et al., 2008). During embryogenesis in Drosophila, the expression dynamics of SCA are associated with neural development and during imaginal development; SCA is expressed in R8 photoreceptor and sensory organ precursor cells. Based on mutation, localization and structural studies, it has been proposed that SCA is involved in lateral inhibition within individual domains of the developing nervous system (Mlodzik et al., 1990). Skp1 has been shown to play a fundamental role in DA neuron viability via cell cycle arrest and differentiation. Its deficiency has been correlated with PD risk (Fishman-Jacob et al., 2009). ALDOA has been found as a target antigen in AD CNS (Mor et al., 2005). CYB5, a ubiquitous electron transport haemoprotein, has been shown to be increased in PINK1-deficient and in DJ-1-deficient dopaminergic neuronal cells (Shim et al., 2011). It also has been shown that CYB5 interacts with one of the neuronal calcium sensor protein and murine visinin-like protein-3 in B6RVTC1 thymoma cells (Oikawa et al., 2004). Pharmacological inhibitors of ADK suppress epilepsy over-expression of ADK in the hippocampus in model organisms suggesting it aggravates epilepsy (Gouder et al., 2004). ALDH2 protects neurons from neurotoxicity induced by 4-hydroxynonenal which is significantly increased in the ventricular fluid and brain of AD patients and in the neurons of PD patients and causes neurotoxicity (Bai and Mei, 2011). APLP1 has been identified as a major component of the amyloid plaques of AD and during mammalian brain development. It has been shown to play an important role in the proper migration of neuronal precursors into the cortical plate (Young-Pearse et al., 2007). FLNA is an actin crosslinking protein which is expressed in the CNS and clinical studies have linked its mutation to periventricular nodular heterotopia. It is required for the actin cytoskeleton remodelling events required for migration initiation for the expansion of cortex (Sarkisian et al., 2008). SCO-Spondin is a calcium-binding secreted glycoprotein which is strongly expressed during development of the mammalian central nervous system and plays a major role in neuronal survival, neurit outgrowth and fasciculation (Gobron et al., 2000). CNN3 levels increase in the temporal neocortices of patients with drug-resistant epilepsy and in the cortices of the temporal lobes of pilocarpine-treated rats (Han et al., 2012). In Drosophila, the neuroglian is a central coordinator of synapse growth, function and stability and is involved in the balance of synapse growth and stability at the neuromuscular junction (Enneking et al., 2013). Neuronal development and maintenance of connection in the mature nervous system in Danio rerio (Glover et al., 2012). ACTZ is involved

295

in several functions including cellular, organelle and nuclear motility and has been shown to be significantly reduced in fetal Down Syndrome cortical cells (Gulesserian et al., 2002). PCM1, a protein associated with schizophrenia involved in pericentriolar satellitemediated protein trafficking, is essential for maintenance of proper centrosome function in neural progenitors (Ge et al., 2010). 3.11. Down-regulated genes involved in neuronal development BMP signalling is involved in the generation of neurons in adult hippocampus (Caronia et al., 2010). Calcineurin is involved in axonal guidance and reinforcing synaptic connections in neurons which is crucial for learning and memory (Winder et al., 1998). In the human brain, nucleolin is present in neuronal cytoplasm and co-localizes with NFT in AD (Dranovsky et al., 2001). Nucleolin expression levels were shown to be reduced in the substantia nigra pars compacta of a human PD subject. Nucleolin over-expression in an in vitro PD model has caused alterations in the generation of oxidative stress and proteasomal inhibition (Caudle et al., 2009). ACBG2 expression is confined to the testis and brain stem and has been found to be localized in testicular sertoli cells, large motoneurons in the medulla oblongata and the cervical spinal cord (Pei et al., 2006). It is noteworthy that decreases in the activity of the DLDH-associated complexes a-ketoglutarate dehydrogenase and pyruvate dehydrogenase, in the brain, represent a common element in several age-associated neurodegenerative diseases, including AD and PD (Sullivan and Brown, 2005; Gibson et al., 2000). It has been shown that Cullin-1-mediated protein degradation plays an essential role in the correct allocation of neural crest fates during embryogenesis (Voigt and Papalopulu, 2006). DOXA1 is highly expressed in mouse neuronal stem cells with intensive nuclear localization and DOXA1 has been identified as a p53regulated neurogenic factor which is involved in p53-dependent neuronal differentiation (Ostrakhovitch and Semenikhin, 2011). KIF24 has been suggested to be a likely risk factor for sporadic frontotemporal lobar degeneration, particularly in the female population. However, this has to be confirmed (Venturelli et al., 2010). Dynein 2 is most abundant in ciliated epithelia and in the connecting cilia of photoreceptor cells. Immunocytochemistry of cultured cells revealed a clear staining of primary cilia, but no specific association with the Golgi apparatus. These data favour a major role for dynein 2 in transport within ciliated structures in the brain and elsewhere and indicate that the function of dynein 2 is evolutionarily conserved between vertebrates and invertebrates (Mikami et al., 2002).

4. Conclusions Chronic exposure of E. fetida to PFOS alters the expression of calcium homeostasis-related and neuronal development-related genes. Other than the genes that are reported to be expressed in other animals in response to PFOS, E. fetida expresses predominantly neuronal development and degeneration-related genes. This is significant because the genes that are down-regulated and up-regulated could be either a cause of neuronal degeneration effects of PFOS or could be a preventative mechanism to protect against neuronal damage. All the up-regulated and downregulated genes have to be tested for their role and function in neurodegenerative effects by protein signalling, protein-protein interaction studies or by gene knockout studies. The genes that are up-regulated which are more specific to PFOS exposure could potentially be used as biomarkers to monitor soil quality. Such biomarkers could be used as indicators for the impact of pollutants before the lethal effects becomes apparent. These genes could also

296

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

be used to monitor soil pollution and so provide an ecotoxicological early warning system.

Acknowledgments The authors acknowledge the Ramaciotti Centre for Genomics, The University of New South Wales, Sydney, for mRNA sequencing and eResearch SA for computing facility. Srinithi Mayilswami is recipient of IPRS and CRCCARE top-up scholarships.

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ecoenv.2014.09.017. References Alexander, B.H., Olsen, G.W., 2007. Bladder cancer in perfluorooctanesulfonyl fluoride manufacturing workers. Ann. Epidemiol 17, 471–478. Bae, Y.S., Choi, M.K., Lee, W.J., 2010. Dual oxidase in mucosal immunity and hostmicrobe homeostasis. Trends Immunol. 31, 278–287. Bai, J., Mei, Y., 2011. Overexpression of aldehyde dehydrogenase-2 attenuates neurotoxicity induced by 4-hydroxynonenal in cultured primary hippocampal neurons. Neurotox. Res. 19, 412–422. Bassing, C.H., Chua, K.F., Sekiguchi, J., Suh, H., Whitlow, S.R., Fleming, J.C., Monroe, B.C., Ciccone, D.N., Yan, C., Vlasakova, K., Livingston, D.M., Ferguson, D.O., Scully, R., Alt, F.W., 2002. Increased ionizing radiation sensitivity and genomic instability in the absence of histone H2AX. Proc. Natl. Acad. Sci. U.S.A. 99, 8173–8178. Begley, T.H., White, K., Honigfort, P., Twaroski, M.L., Neches, R., Walker, R.A., 2005. Perfluorochemicals: potential sources of and migration from food packaging. Food Addit. Contam. 22, 1023–1031. Berthiaume, J., Wallace, K.B., 2002. Perfluorooctanoate, perflourooctanesulfonate, and N-ethyl perfluorooctanesulfonamido ethanol; peroxisome proliferation and mitochondrial biogenesis. Toxicol. Lett. 129, 23–32. Brulle, F., Morgan, A.J., Cocquerelle, C., Vandenbulcke, F., 2010. Transcriptomic underpinning of toxicant-mediated physiological function alterations in three terrestrial invertebrate taxa: a review. Environ. Pollut. 158, 2793–2808. Caillou, B., Dupuy, C., Lacroix, L., Nocera, M., Talbot, M., Ohayon, R., Deme, D., Bidart, J.M., Schlumberger, M., Virion, A., 2001. Expression of reduced nicotinamide adenine dinucleotide phosphate oxidase (ThoX, LNOX, Duox) genes and proteins in human thyroid tissues. J. Clin. Endocrinol. Metab. 86, 3351–3358. Canty-Laird, E., Carre, G.A., Mandon-Pepin, B., Kadler, K.E., fabre, S., 2010. First evidence of bone morphogenetic protein 1 expression and activity in sheep ovarian follicles. Biol. Reprod. 83, 138–146. Caronia, G., Wilcoxon, J., Feldman, P., Grove, E.A., 2010. Bone morphogenetic protein signaling in the developing telencephalon controls formation of the hippocampal dentate gyrus and modifies fear-related behavior. J. Neurosci. 30, 6291–6301. Caudle, W.M., Kitsou, E., Li, J., Bradner, J., Zhang, J., 2009. A role for a novel protein, nucleolin, in Parkinson’s disease. Neurosci. Lett. 459, 11–15. Das, P., Megharaj, M., Naidu, R., 2013. Perfluorooctane sulfonate release pattern from soils of fire training areas in Australia and its bioaccumulation potential in the earthworm Eisenia fetida. Environ. Sci. Pollut. Res., http://dx.doi.org/ 10.1007/s11356-013-1782-y. Dranovsky, A., Vincent, I., Gregori, L., Schwarzman, A., Colflesh, D., Enghild, J., Strittmatter, W., Davies, P., Goldgaber, D., 2001. Cdc2 phosphorylation of nucleolin demarcates mitotic stages and Alzheimer’s disease pathology. Neurobiol. Aging 22, 517–528. Enneking, E.M., Kudumala, S.R., Moreno, E., Stephan, R., Boerner, J., Godenschwege, T.A., Pielage, J., 2013. Transsynaptic coordination of synaptic growth, function, and stability by the L1-type CAM Neuroglian. PLoS Biol. 11, e1001537. Fishman-Jacob, T., Reznichenko, L., Youdim, M.B., Mandel, S.A., 2009. A sporadic Parkinson disease model via silencing of the ubiquitin-proteasome/E3 ligase component SKP1A. J. Biol. Chem. 284, 32835–32845. Fletcher, T., Galloway, T.S., Melzer, D., Holcroft, P., Cipelli, R., Pilling, L.C., Mondal, D., Luster, M., HARRIES, L.W., 2013. Associations between PFOA, PFOS and changes in the expression of genes involved in cholesterol metabolism in humans. Environ. Int. 57-58, 2–10. Ge, X., Frank, C.L., Calderon De Anda, F., Tsai, L.H., 2010. Hook3 interacts with PCM1 to regulate pericentriolar material assembly and the timing of neurogenesis. Neuron 65, 191–203. Gibson, G.E., Park, L.C., Sheu, K.F., Blass, J.P., Calingasan, N.Y., 2000. The alphaketoglutarate dehydrogenase complex in neurodegeneration. Neurochem. Int. 36, 97–112. Glover, G., Mueller, K.P., Sollner, C., Neuhauss, S.C., Nicolson, T., 2012. The usher gene cadherin 23 is expressed in the zebrafish brain and a subset of retinal amacrine cells. Mol. Vis. 18, 2309–2322.

Gobron, S., Creveaux, I., Meiniel, R., Didier, R., Herbet, A., Bamdad, M., El Bitar, F., Dastugue, B., Meiniel, A., 2000. Subcommissural organ/Reissner’s fiber complex: characterization of SCO-spondin, a glycoprotein with potent activity on neurite outgrowth. Glia 32, 177–191. Gouder, N., Scheurer, L., Fritschy, J.M., Boison, D., 2004. Overexpression of adenosine kinase in epileptic hippocampus contributes to epileptogenesis. J. Neurosci. 24, 692–701. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., Di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., Regev, A., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652. Gulesserian, T., Kim, S.H., Fountoulakis, M., Lubec, G., 2002. Aberrant expression of centractin and capping proteins, integral constituents of the dynactin complex, in fetal down syndrome brain. Biochem. Biophys. Res. Commun. 291, 62–67. Guruge, K.S., Yeung, L.W., Yamanaka, N., Miyazaki, S., Lam, P.K., Giesy, J.P., Jones, P.D., Yamashita, N., 2006. Gene expression profiles in rat liver treated with perfluorooctanoic acid (PFOA). Toxicol. Sci. 89, 93–107. Han, Y., Yin, H., Xu, Y., Zhu, Q., Luo, J., Wang, X., CHEN, G., 2012. Increased expression of calponin-3 in epileptic patients and experimental rats. Exp. Neurol. 233, 430–437. Hazelton, P.D., Cope, W.G., Pandolfo, T.J., Mosher, S., Strynar, M.J., Barnhart, M.C., Bringolf, R.B., 2012. Partial life-cycle and acute toxicity of perfluoroalkyl acids to freshwater mussels. Environ. Toxicol. Chem. 31, 1611–1620. Huang, T.S., Olsvik, P.A., Krovel, A., Tung, H.S., Torstensen, B.E., 2009. Stress-induced expression of protein disulfide isomerase associated 3 (PDIA3) in Atlantic salmon (Salmo salar L.). Comp. Biochem. Physiol. C: Pharmacol. Toxicol. Endocrinol. 154, 435–442. Ji, K., Kim, Y., Oh, S., Ahn, B., Jo, H., Choi, K., 2008. Toxicity of perfluorooctane sulfonic acid and perfluorooctanoic acid on freshwater macroinvertebrates (Daphnia magna and Moina macrocopa) and fish (Oryzias latipes). Environ. Toxicol. Chem. 27, 2159–2168. Johansson, N., Eriksson, P., Viberg, H., 2009. Neonatal exposure to PFOS and PFOA in mice results in changes in proteins which are important for neuronal growth and synaptogenesis in the developing brain. Toxicol. Sci. 108, 412–418. Kannan, K., Corsolini, S., Falandysz, J., Fillmann, G., Kumar, K.S., Loganathan, B.G., Mohd, M.A., Olivero, J., WOUWE, V.A.N., YANG, N., ALDOUST, K. M., J.H., 2004. Perfluorooctanesulfonate and related fluorochemicals in human blood from several countries. Environ. Sci. Technol. 38, 4489–4495. Kannan, K., Yun, S.H., Evans, T.J., 2005. Chlorinated, brominated, and perfluorinated contaminants in livers of polar bears from Alaska.. Environ. Sci. Technol., 39; , pp. 9057–9063. Kawamoto, K., Oashi, T., Oami, K., Liu, W., Jin, Y., Saito, N., Sato, I., Tsuda, S., 2010. Perfluorooctanoic acid (PFOA) but not perfluorooctane sulfonate (PFOS) showed DNA damage in comet assay on Paramecium caudatum. J. Toxicol. Sci. 35, 835–841. Kessler, E., Fichard, A., Chanut-Delalande, H., Brusel, M., Ruggiero, F., 2001. Bone morphogenetic protein-1 (BMP-1) mediates C-terminal processing of procollagen V homotrimer. J. Biol. Chem. 276, 27051–27057. Kessler, E., Takahara, K., Biniaminov, L., Brusel, M., Greenspan, D.S., 1996. Bone morphogenetic protein-1: The type I procollagen C-proteinase. Science 271, 360–362. Key, B.D., Howell, R.D., Criddle, C.S., 1997. Fluorinated organics in the biosphere. Environ. Sci. Technol. 31, 2445–2454. Kim, S.H., Fountoulakis, M., Cairns, N.J., Lubec, G., 2002. Human brain nucleoside diphosphate kinase activity is decreased in Alzheimer’s disease and Down syndrome. Biochem. Biophys. Res. Commun. 296, 970–975. Krieger, J.A., Davila, D.R., Lytton, J., Born, J.L., Burchiel, S.W., 1995. Inhibition of sarcoplasmic/endoplasmic reticulum calcium ATPases (SERCA) by polycyclic aromatic hydrocarbons in HPB-ALL human T cells and other tissues. Toxicol. Appl. Pharmacol. 133, 102–108. Krovel, A.V., Softeland, L., Torstensen, B., Olsvik, P.A., 2008. Transcriptional effects of PFOS in isolated hepatocytes from Atlantic salmon Salmo salar L. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. Endocrinol. 148, 14–22. Kuniyoshi, H., Usui-Aoki, K., Juni, N., Yamamoto, D., 2003. Expression analysis of the lingerer gene in the larval central nervous system of Drosophila melanogaster. J. Neurogenet. 17, 117–137. Lechner, M., Knapp, H., 2011. Carryover of perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) from soil to plant and distribution to the different plant compartments studied in cultures of carrots (Daucus carota ssp. Sativus), potatoes (Solanum tuberosum), and cucumbers (Cucumis Sativus). J. Agric. Food Chem. 59, 11011–11018. Lee, H.G., Lee, Y.J., Yang, J.H., 2012. Perfluorooctane sulfonate induces apoptosis of cerebellar granule cells via a ROS-dependent protein kinase C signaling pathway. Neurotoxicology 33, 314–320. Liao, C.Y., Cui, L., Zhou, Q.F., Duan, S.M., Jiang, G.B., 2009. Effects of perfluorooctane sulfonate on ion channels and glutamate-activated current in cultured rat hippocampal neurons. Environ. Toxicol. Pharmacol. 27, 338–344. Liu, J., Farmer Jr., J.D., Lane, W.S., Friedman, J., Weissman, I., Schreiber, S.L., 1991. Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell 66, 807–815. MacDonald, M.M., Warne, A.L., Stock, N.L., Mabury, S.A., Solomon, K.R., Sibley, P.K., 2004. Toxicity of perfluorooctane sulfonic acid and perfluorooctanoic acid to Chironomus tentans. Environ. Toxicol. Chem. 23, 2116–2123. Mi, H., Muruganujan, A., Thomas, P.D., 2013. PANTHER in 2013: modeling the evolution of gene function, and other gene attributes, in the context of phylogenetic trees. Nucleic Acids Res. 41, D377–D386.

S. Mayilswami et al. / Ecotoxicology and Environmental Safety 110 (2014) 288–297

Mikami, A., Tynan, S.H., Hama, T., Luby-Phelps, K., Saito, T., Crandall, J.E., Besharse, J.C., Vallee, R.B., 2002. Molecular structure of cytoplasmic dynein 2 and its distribution in neuronal and ciliated cells. J. Cell Sci. 115, 4801–4808. Mlodzik, M., Baker, N.E., Rubin, G.M., 1990. Isolation and expression of scabrous, a gene regulating neurogenesis in Drosophila. Genes Dev. 4, 1848–1861. Mor, F., Izak, M., Cohen, I.R., 2005. Identification of aldolase as a target antigen in Alzheimer’s disease. J. Immunol. 175, 3439–3445. Noorlander, C.W., Van Leeuwen, S.P., TE Biesebeek, J.D., Mengelers, M.J., Zeilmaker, M.J., 2011. Levels of perfluorinated compounds in food and dietary intake of PFOS and PFOA in the Netherlands. J. Agric. Food Chem. 59, 7496–7505. Oikawa, K., Kimura, S., Aoki, N., Atsuta, Y., Takiyama, Y., Nagato, T., Yanai, M., Kobayashi, H., Sato, K., Sasajima, T., Tateno, M., 2004. Neuronal calcium sensor protein visinin-like protein-3 interacts with microsomal cytochrome b5 in a Ca2 þ -dependent manner. J. Biol. Chem. 279, 15142–15152. Olsen, G.W., Burris, J.M., Ehresman, D.J., Froehlich, J.W., Seacat, A.M., Butenhoff, J.L., Zobel, L.R., 2007. Half-life of serum elimination of perfluorooctanesulfonate, perfluorohexanesulfonate, and perfluorooctanoate in retired fluorochemical production workers. Environ. Health Perspect. 115, 1298–1305. Olsen, G.W., Hansen, K.J., Stevenson, L.A., Burris, J.M., Mandel, J.H., 2003. Human donor liver and serum concentrations of perfluorooctanesulfonate and other perfluorochemicals. Environ. Sci. Technol. 37, 888–891. Ostrakhovitch, E.A., Semenikhin, O.A., 2011. p53-mediated regulation of neuronal differentiation via regulation of dual oxidase maturation factor 1. Neurosci. Lett. 494, 80–85. Pei, Z., Jia, Z., Watkins, P.A., 2006. The second member of the human and murine bubblegum family is a testis- and brainstem-specific acyl-CoA synthetase. J. Biol. Chem. 281 (6632-41). Power, J.H., Asad, S., Chataway, T.K., Chegini, F., Manavis, J., Temlett, J.A., Jensen, P.H., Blumbergs, P.C., Gai, W.P., 2008. Peroxiredoxin 6 in human brain: molecular forms, cellular distribution and association with Alzheimer’s disease pathology. Acta Neuropathol. 115 (611-22). Reiners, J., Marker, T., Jurgens, K., Reidel, B., Wolfrum, U., 2005. Photoreceptor expression of the Usher syndrome type 1 protein protocadherin 15 (USH1F) and its interaction with the scaffold protein harmonin (USH1C). Mol. Vis. 11, 347–355. Ren, H., Vallanat, B., Nelson, D.M., Yeung, L.W., Guruge, K.S., Lam, P.K., LehmanMckeeman, L.D., Corton, J.C., 2009. Evidence for the involvement of xenobioticresponsive nuclear receptors in transcriptional effects upon perfluoroalkyl acid exposure in diverse species. Reprod. Toxicol. 27 (266-77). Roland, K., Kestemont, P., Henuset, L., Pierrard, M.A., Raes, M., Dieu, M., Silvestre, F., 2013. Proteomic responses of peripheral blood mononuclear cells in the European eel (Anguilla anguilla) after perfluorooctane sulfonate exposure. Aquat. Toxicol. 128-129, 43–52. Sarkisian, M.R., Bartley, C.M., Rakic, P., 2008. Trouble making the first move: interpreting arrested neuronal migration in the cerebral cortex. Trends Neurosci. 31, 54–61. Seacat, A.M., Thomford, P.J., Hansen, K.J., Clemen, L.A., Eldridge, S.R., Elcombe, C.R., Butenhoff, J.L., 2003. Sub-chronic dietary toxicity of potassium perfluorooctanesulfonate in rats. Toxicology 183, 117–131. Seacat, A.M., Thomford, P.J., Hansen, K.J., Olsen, G.W., Case, M.T., Butenhoff, J.L., 2002. Subchronic toxicity studies on perfluorooctanesulfonate potassium salt in cynomolgus monkeys. Toxicol. Sci. 68, 249–264. Shim, J.H., Yoon, S.H., Kim, K.H., Han, J.Y., Ha, J.Y., Hyun, D.H., Paek, S.H., Kang, U.J., Zhuang, X., Son, J.H., 2011. The antioxidant Trolox helps recovery from the familial Parkinson’s disease-specific mitochondrial deficits caused by PINK1and DJ-1-deficiency in dopaminergic neuronal cells. Mitochondrion 11, 707–715. Siemens, J., Kazmierczak, P., Reynolds, A., Sticker, M., Littlewood-Evans, A., Muller, U., 2002. The Usher syndrome proteins cadherin 23 and harmonin form a complex by means of PDZ-domain interactions. Proc. Natl. Acad. Sci. U.S.A. 99, 14946–14951. Siemens, J., Lillo, C., Dumont, R.A., Reynolds, A., Williams, D.S., Gillespie, P.G., Muller, U., 2004. Cadherin 23 is a component of the tip link in hair-cell stereocilia. Nature 428, 950–955.

297

Sullivan, P.G., Brown, M.R., 2005. Mitochondrial aging and dysfunction in Alzheimer’s disease. Prog. Neuropsychopharmacol. Biol. Psychiatry 29, 407–410. Tomy, G.T., Tittlemier, S.A., Palace, V.P., Budakowski, W.R., Braekevelt, E., Brinkworth, L., Friesen, K., 2003. Biotransformation of N-ethyl perfluorooctanesulfonamide by Rainbow Trout (Onchorhynchus mykiss) liver microsomes. Environ. Sci. Technol. 38, 758–762. Venturelli, E., Villa, C., Fenoglio, C., Clerici, F., Marcone, A., Benussi, L., Ghidoni, R., Gallone, S., Scalabrini, D., Cortini, F., Fumagalli, G., Cappa, S., Binetti, G., Franceschi, M., Rainero, I., Giordana, M.T., Mariani, C., Bresolin, N., SCARPINI, E., Galimberti, D., 2010. Is KIF24 a genetic risk factor for frontotemporal lobar degeneration? Neurosci. Lett. 482, 240–244. Voigt, J., Papalopulu, N., 2006. A dominant-negative form of the E3 ubiquitin ligase Cullin-1 disrupts the correct allocation of cell fate in the neural crest lineage. Development 133, 559–568. Volkel, W., Genzel-Boroviczeny, O., Demmelmair, H., Gebauer, C., Koletzko, B., Twardella, D., Raab, U., Fromme, H., 2008. Perfluorooctane sulphonate (PFOS) and perfluorooctanoic acid (PFOA) in human breast milk: results of a pilot study. Int. J. Hyg. Environ. Health 211, 440–446. Wan Ibrahim, W.N., Tofighi, R., Onishchenko, N., Rebellato, P., Bose, R., Uhlén, P., Ceccatelli, S., 2013. Perfluorooctane sulfonate induces neuronal and oligodendrocytic differentiation in neural stem cells and alters the expression of PPARγ in vitro and in vivo. Toxicol. Appl. Pharmacol. 269, 51–60. Wang, F., Liu, W., Ma, J., Yu, M., Jin, Y., Dai, J., 2012. Prenatal and neonatal exposure to perfluorooctane sulfonic acid results in changes in miRNA expression profiles and synapse associated proteins in developing rat brains. Environ. Sci. Technol. 46, 6822–6829. Wang, X., Li, B., Zhao, W.D., Liu, Y.J., Shang, D.S., Fang, W.G., Chen, Y.H., 2011. Perfluorooctane sulfonate triggers tight junction “opening” in brain endothelial cells via phosphatidylinositol 3-kinase. Biochem. Biophys. Res. Commun. 410, 258–263. Washington, J.W., Yoo, H., Ellington, J.J., Jenkins, T.M., Libelo, E.L., 2010. Concentrations, distribution, and persistence of perfluoroalkylates in sludge-applied soils near decatur, Alabama, USA. Environ. Sci. Technol. 44, 8390–8396. Winder, D.G., Mansuy, I.M., Osman, M., Moallem, T.M., Kandel, E.R., 1998. Genetic and pharmacological evidence for a novel, intermediate phase of long-term potentiation suppressed by calcineurin. Cell 92, 25–37. Wright, K.T., Seabright, R., Logan, A., Lilly, A.J., Khanim, F., Bunce, C.M., Johnson, W. E., 2010. Extracellular Nm23H1 stimulates neurite outgrowth from dorsal root ganglia neurons in vitro independently of nerve growth factor supplementation or its nucleoside diphosphate kinase activity. Biochem. Biophys. Res. Commun. 398, 79–85. Wu, Y., Antony, S., Hewitt, S.M., Jiang, G., Yang, S.X., Meitzler, J.L., Juhasz, A., Lu, J., Liu, H., Doroshow, J.H., Roy, K., 2013. Functional activity and tumor-specific expression of dual oxidase 2 in pancreatic cancer cells and human malignancies characterized with a novel monoclonal antibody. Int. J. Oncol. 42, 1229–1238. Xu, D., Li, C., Wen, Y., Liu, W., 2013. Antioxidant defense system responses and DNA damage of earthworms exposed to perfluorooctane sulfonate (PFOS). Environ. Pollut. 174, 121–127. Ye, L., Zhao, B., Yuan, K., Chu, Y., LI, C., Zhao, C., Lian, Q.Q., Ge, R.S., 2012. Gene expression profiling in fetal rat lung during gestational perfluorooctane sulfonate exposure. Toxicol. Lett. 209, 270–276. Yoo, H., Kannan, K., Kim, S.K., Lee, K.T., Newsted, J.L., Giesy, J., 2008. Perfluoroalkyl acids in the egg yolk of birds from Lake Shihwa, Korea. Environ. Sci. Technol. 42 (5821-7). Young-Pearse, T.L., Bai, J., Chang, R., Zheng, J.B., Loturco, J.J., Selkoe, D.J., 2007. A critical function for beta-amyloid precursor protein in neuronal migration revealed by in utero RNA interference. J. Neurosci. 27, 14459–14469. Yun, H.M., Jin, P., Han, J.Y., Lee, M.S., Han, S.B., Oh, K.W., Hong, S.H., Jung, E.Y., Hong, J.T., 2013. Acceleration of the development of Alzheimer’s Disease in amyloid beta-infused peroxiredoxin 6 overexpression transgenic mice. Mol. Neurobiol.. Zhang, L., Niu, J., Li, Y., Wang, Y., Sun, D., 2013. Evaluating the sub-lethal toxicity of PFOS and PFOA using rotifer Brachionus calyciflorus. Environ. Pollut. 180, 34–40. Zuo, L., Saba, L., Wang, K., Zhang, X., Krystal, J.H., Tabakoff, B., Luo, X., 2013. Exomewide association study of replicable nonsynonymous variants conferring risk for alcohol dependence. J. Stud. Alcohol Drugs 74, 622–625.