Tumor Biol. DOI 10.1007/s13277-014-2876-y
RESEARCH ARTICLE
CIZ1 promoted the growth and migration of gallbladder cancer cells Dexiang Zhang & Yueqi Wang & Yuedi Dai & Jiwen Wang & Tao Suo & Hongtao Pan & Han Liu & Sheng Shen & Houbao Liu
Received: 3 October 2014 / Accepted: 18 November 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Gallbladder cancer (GBC) is one of the most common and aggressive diseases among the gastrointestinal tract malignancies, and the molecular mechanism underlying this disease remains largely unknown. CIZ1 (Cip1 interacting zinc finger protein 1), a binding partner of p21Cip1/Waf1, has been found to be involved in the tumorigenesis recently. However, the expression pattern and biological functions of CIZ1 in the progression of GBC are not fully understood. In this study, it was found that the expression of CIZ1 was significantly elevated in GBC samples compared to their adjacent normal tissues. Moreover, overexpression of CIZ1 promoted the growth and migration of GBC cells, while knocking down the expression of CIZ1 inhibited the growth, migration, and tumorigenesis of GBC cells in vitro and in vivo. Mechanistically, CIZ1 was found to interact with TCF4 (Tcell factor) and activate beta-catenin/TCF signaling. Our study demonstrated that CIZ1 played an oncogenic role in the progression of GBC and CIZ1 might be a promising target for the treatment of GBC.
Keywords CIZ1 . Gallbladder cancer . Cell growth and migration . Beta-catenin/TCF
Dexiang Zhang and Yueqi Wang contributed equally to this work. D. Zhang : Y. Wang : J. Wang : T. Suo : H. Pan : H. Liu : S. Shen : H. Liu (*) General Surgery Department, Zhongshan Hospital, General Surgery Institute, Fudan University, 180 Fenglin Rd., 200032 Shanghai, China e-mail: [email protected] Y. Dai Department of Medical Oncology, Cancer Hospital of Fudan University, Minhang Branch, 200240 Shanghai, China
Introduction Gallbladder cancer (GBC) is one of the most common and aggressive diseases among the gastrointestinal tract malignancies [1]. The outcome of the patients with this disease has been proven to be dismal with 5-year survival rates ranging from 10 to 20 % [2]. Therefore, there is an urgent need to develop novel and effective therapy regimens for GBC patients. However, the pathophysiological mechanisms contributing to GBC are still largely unknown. A better understanding of the molecular biology and carcinogenic mechanisms underlying development and progression of GBC may help to establish more effective treatments. CIZ1 (Cip1 interacting zinc finger protein 1) was initially identified as a p21Cip1/Waf1-interacting protein [3]. CIZ1 is ubiquitously expressed and consists of several domains, including two glutamine-rich repeats (QD1 and QD2), three zinc finger motifs, and matrin 3 domains [4]. It has been reported that the CDK/cyclin binding domain of p21Cip1/Waf1 interacts with the C-terminal region of CIZ1 through the first zinc finger domain [4]. Additionally, forced expression of CIZ1 affected the subcellular localization of p21Cip1/Waf1 [4]. More and more studies have shown that CIZ1 plays an important role in the initiation of DNA replication and replication fork organization [5, 6]. Overexpression of CIZ1 has been reported to stimulate S phase entry and cell proliferation [7]. However, knocking down the expression of CIZ1 inhibited S phase entry and suppressed cell proliferation [7]. The DNA replication-promoting function of CIZ1 was mediated by its interaction with cyclins E and A and subsequent formation of CDK2/cyclin A complex [5]. Aberrant expression, splicing variants, and point mutations of CIZ1 have been linked to human diseases, such as rheumatoid arthritis, Alzheimer’s disease, cervical dystonia [8–11], and several types of cancers including breast cancer [12], medulloblastoma [13], Ewing sarcoma and
Tumor Biol.
neuroblastoma [14], and lung cancer [15]. However, the biological function of CIZ1 in gallbladder cancer remains unknown. In this study, we found that the expression of CIZ1 was upregulated in the GBC tissues. Moreover, overexpression of CIZ1 in GBC cells promoted cell proliferation and migration, while downregulation of CIZ1 inhibited the tumorigenecity of GBC cells in vitro and in vivo. Mechanistically, CIZ1 interacted with TCF4 and positively regulated beta-catenin/TCF signaling. Taken together, our study suggests the oncogenic roles of CIZ1 in the pathogenesis of GBC.
Materials and methods Cell culture Human GBC cell lines GBC-SD, SGC-996, NOZ, and EHGB2 human embryonic kidney cells 293 T were purchased from ATCC (American Type Culture Collection) and cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10 % fetal bovine serum (FBS; PAA Laboratories, Pasching, Austria), 10 U/ml penicillin-G, and 10 mg/ml streptomycin. All cells were incubated at 37 °C in a humidified atmosphere containing 5 % CO2. Clinical samples Primary tissues were collected from patients who received surgery for GBC at Zhongshan Hospital which was affiliated to Fudan University. All of the patients had given informed consent. Dissected samples were frozen immediately after surgery and stored at −80 °C until needed. Plasmid construction and transfection To generate the CIZ1 expression vector, the open reading frame of human CIZ1 cDNA was cloned into the expression vector pcDNA 3.1-myc, which resulted in the myc-tagged CIZ1 protein. The coding sequence of TCF4 was cloned to the expression vector pCMVTag2B and fused with a Flag tag. The CIZ1 expression vector and empty pcDNA3.1-myc were transfected into GBC-SD and SGC-996 cells using Lipofectamine 2000 reagent (Invitrogen). The transfected cells were selected in the presence of 600 μg/ml G418, and resistant cells were pooled and further confirmed the expression of exogenous CIZ1 by Western blot. RNA extraction and real-time PCR analysis Total RNA was isolated from GBC tissues and matched adjacent normal tissues of GBC patients after their
informed consent using TRIzol reagent (Invitrogen). The RNA samples were separated in 2 % agarose gels containing ethidium bromide, and their quality was then determined by visibility of 18S and 28S RNA bands under UV light. Two microgram of total RNA with high quality was processed directly to cDNA with the reverse transcription kit (Promega, Madison, WI), following the manufacturer’s instructions, in a total volume of 25 μl. The primer pair used for amplification of the human CIZ1 gene was as follows: forward primer, 5′-AGCAGT TACTGCAGCTCCAG-3′, and reverse primer, 5′-GGAG GTTACCCAGTGTTGCT-3′. As an internal standard, a fragment of human beta-actin was amplified by PCR using the following primers: forward primer, 5′-GATC ATTGCTCCTCCTGAGC-3′, and reverse primer, 5′ACTCCT GCTTGCTGATCCAC-3′. Amplification reactions were performed in a 20-μl volume of the LightCycler-DNA Master SYBR Green I mixture from Roche Applied Science as follows: with 10 pmol of primer, 2 mM MgCl2, 200 μM dNTP mixture, 0.5 U of Taq DNA polymerase and universal buffer. All of the reactions were performed in triplicate in an iCycler iQ System (Bio-Rad), and the thermal cycling conditions were as follows: 95 °C for 3 min; 40 cycles of 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 30 s; 72 °C for 10 min. To confirm specificity of amplification, the PCR products from each primer pair were subjected to a melting curve analysis and electrophoresis in 2 % agarose gel. Western blot Cells were plated into 35-mm dishes and cultured to 80 % confluence. The cells were then scraped and lysed in RIPA buffer, and cell lysates were centrifuged at 10,000g (4 °C for 20 min). Protein concentrations were determined using Bradford reagent (Sigma) according to the manufacturer’s instructions. Equal amounts of total cellular protein were mixed with loading buffer (62.5 mM Tris–HCl, pH 6.8, 10 % glycerol, 2 % SDS, 2 % beta-mercaptoethanol, and bromphenol blue), boiled for 5 min, and subjected to 10 % SDS-PAGE. Proteins were transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with Tris-buffered saline containing 0.05 % Tween 20 (TBST) and 5 % fat-free dry milk for 1 h at room temperature and incubated overnight with primary antibodies in TBST with 1 % bovine serum albumin. After washing with TBST, the membranes were further incubated for 1 h at room temperature with corresponding horseradish peroxidaseconjugated secondary antibody in appropriate dilution and then washed five times with the same buffer. The
Tumor Biol.
immunoreactive protein bands were visualized by ECL kit (Pierce). Antibodies to Flag, CIZ1, c-Myc, cyclinD1, Snail, and GAPDH were purchased from Santa Cruz Biotechnology, and antibody to TCF was purchased from Cell Signaling Technology.
brief washes in 0.01 mol/l PBS, sections were exposed for 2 h to 0.01 mol/l PBS containing horseradish peroxidaseconjugated rabbit anti-goat IgG (1:500), followed by development with 0.003 % H2O2 and 0.03 % 3,30-diaminobenzidine in 0.05 mol/l Tris–HCl (pH 7.5).
RNAi-mediated knocking down of CIZ1
Immunoprecipitation
In our experiments, FG12 lentiviral vector, which has an independent open reading frame of green fluorescence protein (GFP), was used to produce small, double-stranded RNA (siRNA) to inhibit target gene expression in EH-GB2 and SGC-996 cells. To construct the hairpin siRNA expression cassette, complementary DNA oligonucleotides for siRNA of CIZ1 (si CIZ1) or mutated sequence as control (si con) were synthesized, annealed, and inserted into FG12. Two CIZ1 siRNA constructs were used as follows: CIZ1 siRNA 1# (highlighted sequence was the complementary sequence with CIZ1 mRNA), 5′-ACCGGGACTGACCAGTTTGC ATTCAAGAGATGCAAACTGGTCAGTCCTTTTTTGG ATCCC-3′ and 5′-TCGAGGGATCCAAAAAGGGACTG ACCAGTTTGCATCTCTTGAATGCAAACTGGTCAG TCC-3′; and CIZ1 siRNA 2# (highlighted sequence was the complementary sequence with CIZ1 mRNA), 5′A C C G G G AT T C T T C T T C T C A G A C T T C A A G A G AGTCTGAGAAGAAGAATCCTTTTTTGGATCCC-3′ and 5′-TCGAGGGATCCAA AAAGGGATTCTTCTTC TCAGACTCTCTTGAAGTCTGAGAAGAAGAATCC3′; si con vector (highlighted sequence was the random sequence as control that was not related to CIZ1 mRNA), 5′ACCGGTACATAGGGACGTAACGTTCAA GAGACG TTACGTCCCTATGTACCTTTTTGGATCCC-3′ and 5′TCGAGGGATCCAAAAAGGTACATAGGGACGTAAC GTCTCTTGAACGTTACGTCCCTATGTAC-3′. FG12 vector with si CIZ1 or si con was transfected into 293 T, and the virus with CIZ1 siRNA or si con was harvested from culture medium. The harvested virus was purified by centrifugation at 25,000g (4 °C, 150 min), and appropriate amounts of virus were used to infect SGC-996 and EH-GB2 cells. After 3 days of infection, the GFP-positive cells were sorted by flow cytometry (BD Biosciences), which all stably expressed si CIZ1 or si con.
Cells were washed with ice-cold PBS and lysated in Trisbuffered saline (pH 7.4), containing 50 mM Tris, 150 mM NaCl, 1 % NP-40, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF, 2.5 mg/ml aprotinin and leupeptin, 1 mM betaglycerophosphate and AEBSF (4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride), and 10 mM iodoacetate. Lysates were incubated on ice for 15 min before cellular debris and nuclei were removed by centrifugation at 10,000g for 20 min. Cell lysates were incubated with the corresponding primary antibodies overnight at 4 °C. Protein A-Sepharose (Amersham Biosciences, Piscataway, NJ, USA) beads in a 50:50 mixture in 50 mM Tris buffer, pH 7.0, were added and further incubated for another 4 h at 4 °C. The immunoprecipitates were washed four times in Tris-buffered saline and boiled for 5 min in 40-μl Laemmli buffer containing 0.02 % blue bromophenol and 2 % β-mercaptoethanol. Crystal violet assay For cell growth assay, equal number of cells were seeded in 6well plates and cultured in medium supplemented with 10 % FBS for 14 days. The medium was changed every other day. Cell growth was stopped after 14 days in culture by removing the medium and adding 0.5 % crystal violet solution in 20 % methanol. After staining for 5 min, the fixed cells were washed with phosphate-buffered saline (PBS) and photographed. Soft agar assay For clonogenic assay, cells were plated into 6-well flat-bottomed dishes using a two-layer soft agar system with 1.0×104 cells per well in a volume of 1 ml per well. After 14 days of incubation, the colonies were counted and measured. All of the experiments were done at least three times.
Immunohistochemistry Boyden chamber assay GBC tissues were fixed in formalin, embedded in paraffin, and 5-μm-thick sections were cut and mounted on glass slides. After deparaffin and antigen recovery, the sections were washed thrice in 0.01 mol/l PBS (8 mmol/l Na2HPO4, 2 mmol/l NaH2PO4, and 150 mmol/l NaCl) for 5 min each, blocked for 1 h in 0.01 mol/l PBS supplemented with 0.3 % Triton X-100 and 5 % normal goat serum, followed by addition of anti-CIZ1 (1:100) antibody at 4 °C overnight. After
Boyden chambers (8-μm pore size polycarbonate membrane) were obtained from Neuroprobe Corporation, Bethesda, MD, USA. Cells (2×105) in 0.05 ml medium containing 1 % FBS were placed in the upper chamber, and the lower chamber was loaded with 0.152 ml medium containing 10 % FBS. After 10 h of incubation, cells migrated to the lower surface of filters were detected with traditional H&E staining, and five fields of
Tumor Biol.
each well were counted. Three wells were examined for each cell type, and the experiments were repeated for at least three times.
(mean±SD). Statistical analysis was performed using the Student’s t test.
In vivo tumorigenesis assay
Result
Four 4-week-old nude mice were used in this study. CIZ1 knockdown cells (1×106; SGC-996/si CIZ1) and their control cells (SGC-996/si con) were subcutaneously injected into the opposite flanks of the same mouse. The resulting tumors were measured every 10 days, and tumor volumes (mm3) were calculated using the standard formula: length × width × height×0.5326. Tumors were harvested 40 days after injection. Data were presented as tumor volumes and tumor weight
The expression of CIZ1 was upregulated in gallbladder cancer tissues
Fig. 1 The expression of CIZ1 was increased in GBC. a Relative mRNA level of CIZ1 in human GBC samples and adjacent normal tissues. Realtime PCR was performed on 34 GBC samples and 34 normal tissues. The CIZ1 expression was normalized to that of beta-actin. Data was calculated
from triplicates. b The protein level of CIZ1 in GBC samples and adjacent normal tissues was examined by immunohistochemistry. c The protein level of CIZ1 in GBC samples and paired normal tissues was examined by Western blot. d The protein level of CIZ1 in GBC cell lines
The expression of CIZ1 in gallbladder cancer (GBC) tissues has not been studied. Therefore, we first examined the expression levels of CIZ1 mRNA in 34 pairs of human GBC and adjacent noncancerous tissues by quantitative real-time PCR. The CIZ1 transcripts were expressed at lower levels in the
Tumor Biol.
adjacent noncancerous tissues compared to the cancerous tissues (P=0.0056, Fig. 1a), indicating that the mRNA level of CIZ1 was frequently upregulated in GBC tissues. In the next study, we examined the protein level of CIZ1 in GBC tissues and adjacent normal tissues. The immunohistochemistry results revealed that the protein level of CIZ1 was elevated in GBC tissues (Fig. 1b), which was consistent with the results shown in Fig. 1a. Moreover, the protein level of CIZ1 in nine randomly selected GBC tissues and adjacent noncancerous tissues was examined by Western blot analysis. Elevated CIZ1 protein level was observed in 7/9 GBC tissues (Fig. 1c). In addition, CIZ1 was strongly expressed in four GBC cell lines (GBC-SD, SGC-996, NOZ, and EH-GB2) (Fig. 1d). Taken together, these studies suggested that the expression on CIZ1 was increased in GBC tissues and cell lines. Forced expression of CIZ1 promoted the growth and migration of gallbladder cancer cells The upregulation of CIZ1 in GBC tissues suggested that CIZ1 might exert an oncogenic role in the progression of GBC. As shown in Fig. 1d, GBC-SD and SGC-996 cell lines expressed the relative low level of CIZ1. To investigate the biological
Fig. 2 Overexpression of CIZ1 promoted the growth and migration of GBC-SD and SGC-996 cells. a The GBC-SD and SGC-996 cells were stably transfected with either the pcDNA3.1 vector or the CIZ1 expression vector. G418-resistant cells were pooled and confirmed the exogenously expressed CIZ1 by Western blot analysis. b The effects of CIZ1 on the
role of CIZ1 in the progression of gallbladder cancer, we selected GBC-SD and SGC-996 cells for CIZ1 overexpression. GBC-SD and SGC-996 cells were transfected with mycCIZ1 or pcDNA3.1 using the Lipfectamine 2000 transfection reagent. After selection with neomycin (G418), the resistant cells were pooled and confirmed the exogenous expression of myc-CIZ1 by Western blot (Fig. 2a). In the crystal violet assay, forced expression of CIZ1 promoted the growth of GBC-SD and SGC-996 cells in liquid culture (Fig. 2b). Moreover, upregulation of CIZ1 conferred the anchorage-independent growth advantage of GBC-SD and SGC-996 cells in the soft agar, indicating CIZ1 promoted the tumorigenecity of GNB cells (Fig. 2c). In addition, CIZ1 overexpression enhanced the motility of GBC cells, which was demonstrated by the cell migration assay using Boyden chamber (Fig. 2d). In summary, upregulation of CIZ1 promoted the growth and migration of GBC cells. Downregulation of CIZ1 inhibited the growth and migration of gallbladder cancer cells We next studied the biological functions of endogenous CIZ1 through knocking down the expression of CIZ1 in SGC-996
growth of GBC-SD and SGC-996 cells were measured by crystal violet assay. c The effects of CIZ1 on the anchorage-independent growth of GBCSD cells were measured by soft agar assay. Data shown was the representative results from three independent experiments. **P
RESEARCH ARTICLE
CIZ1 promoted the growth and migration of gallbladder cancer cells Dexiang Zhang & Yueqi Wang & Yuedi Dai & Jiwen Wang & Tao Suo & Hongtao Pan & Han Liu & Sheng Shen & Houbao Liu
Received: 3 October 2014 / Accepted: 18 November 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Gallbladder cancer (GBC) is one of the most common and aggressive diseases among the gastrointestinal tract malignancies, and the molecular mechanism underlying this disease remains largely unknown. CIZ1 (Cip1 interacting zinc finger protein 1), a binding partner of p21Cip1/Waf1, has been found to be involved in the tumorigenesis recently. However, the expression pattern and biological functions of CIZ1 in the progression of GBC are not fully understood. In this study, it was found that the expression of CIZ1 was significantly elevated in GBC samples compared to their adjacent normal tissues. Moreover, overexpression of CIZ1 promoted the growth and migration of GBC cells, while knocking down the expression of CIZ1 inhibited the growth, migration, and tumorigenesis of GBC cells in vitro and in vivo. Mechanistically, CIZ1 was found to interact with TCF4 (Tcell factor) and activate beta-catenin/TCF signaling. Our study demonstrated that CIZ1 played an oncogenic role in the progression of GBC and CIZ1 might be a promising target for the treatment of GBC.
Keywords CIZ1 . Gallbladder cancer . Cell growth and migration . Beta-catenin/TCF
Dexiang Zhang and Yueqi Wang contributed equally to this work. D. Zhang : Y. Wang : J. Wang : T. Suo : H. Pan : H. Liu : S. Shen : H. Liu (*) General Surgery Department, Zhongshan Hospital, General Surgery Institute, Fudan University, 180 Fenglin Rd., 200032 Shanghai, China e-mail: [email protected] Y. Dai Department of Medical Oncology, Cancer Hospital of Fudan University, Minhang Branch, 200240 Shanghai, China
Introduction Gallbladder cancer (GBC) is one of the most common and aggressive diseases among the gastrointestinal tract malignancies [1]. The outcome of the patients with this disease has been proven to be dismal with 5-year survival rates ranging from 10 to 20 % [2]. Therefore, there is an urgent need to develop novel and effective therapy regimens for GBC patients. However, the pathophysiological mechanisms contributing to GBC are still largely unknown. A better understanding of the molecular biology and carcinogenic mechanisms underlying development and progression of GBC may help to establish more effective treatments. CIZ1 (Cip1 interacting zinc finger protein 1) was initially identified as a p21Cip1/Waf1-interacting protein [3]. CIZ1 is ubiquitously expressed and consists of several domains, including two glutamine-rich repeats (QD1 and QD2), three zinc finger motifs, and matrin 3 domains [4]. It has been reported that the CDK/cyclin binding domain of p21Cip1/Waf1 interacts with the C-terminal region of CIZ1 through the first zinc finger domain [4]. Additionally, forced expression of CIZ1 affected the subcellular localization of p21Cip1/Waf1 [4]. More and more studies have shown that CIZ1 plays an important role in the initiation of DNA replication and replication fork organization [5, 6]. Overexpression of CIZ1 has been reported to stimulate S phase entry and cell proliferation [7]. However, knocking down the expression of CIZ1 inhibited S phase entry and suppressed cell proliferation [7]. The DNA replication-promoting function of CIZ1 was mediated by its interaction with cyclins E and A and subsequent formation of CDK2/cyclin A complex [5]. Aberrant expression, splicing variants, and point mutations of CIZ1 have been linked to human diseases, such as rheumatoid arthritis, Alzheimer’s disease, cervical dystonia [8–11], and several types of cancers including breast cancer [12], medulloblastoma [13], Ewing sarcoma and
Tumor Biol.
neuroblastoma [14], and lung cancer [15]. However, the biological function of CIZ1 in gallbladder cancer remains unknown. In this study, we found that the expression of CIZ1 was upregulated in the GBC tissues. Moreover, overexpression of CIZ1 in GBC cells promoted cell proliferation and migration, while downregulation of CIZ1 inhibited the tumorigenecity of GBC cells in vitro and in vivo. Mechanistically, CIZ1 interacted with TCF4 and positively regulated beta-catenin/TCF signaling. Taken together, our study suggests the oncogenic roles of CIZ1 in the pathogenesis of GBC.
Materials and methods Cell culture Human GBC cell lines GBC-SD, SGC-996, NOZ, and EHGB2 human embryonic kidney cells 293 T were purchased from ATCC (American Type Culture Collection) and cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10 % fetal bovine serum (FBS; PAA Laboratories, Pasching, Austria), 10 U/ml penicillin-G, and 10 mg/ml streptomycin. All cells were incubated at 37 °C in a humidified atmosphere containing 5 % CO2. Clinical samples Primary tissues were collected from patients who received surgery for GBC at Zhongshan Hospital which was affiliated to Fudan University. All of the patients had given informed consent. Dissected samples were frozen immediately after surgery and stored at −80 °C until needed. Plasmid construction and transfection To generate the CIZ1 expression vector, the open reading frame of human CIZ1 cDNA was cloned into the expression vector pcDNA 3.1-myc, which resulted in the myc-tagged CIZ1 protein. The coding sequence of TCF4 was cloned to the expression vector pCMVTag2B and fused with a Flag tag. The CIZ1 expression vector and empty pcDNA3.1-myc were transfected into GBC-SD and SGC-996 cells using Lipofectamine 2000 reagent (Invitrogen). The transfected cells were selected in the presence of 600 μg/ml G418, and resistant cells were pooled and further confirmed the expression of exogenous CIZ1 by Western blot. RNA extraction and real-time PCR analysis Total RNA was isolated from GBC tissues and matched adjacent normal tissues of GBC patients after their
informed consent using TRIzol reagent (Invitrogen). The RNA samples were separated in 2 % agarose gels containing ethidium bromide, and their quality was then determined by visibility of 18S and 28S RNA bands under UV light. Two microgram of total RNA with high quality was processed directly to cDNA with the reverse transcription kit (Promega, Madison, WI), following the manufacturer’s instructions, in a total volume of 25 μl. The primer pair used for amplification of the human CIZ1 gene was as follows: forward primer, 5′-AGCAGT TACTGCAGCTCCAG-3′, and reverse primer, 5′-GGAG GTTACCCAGTGTTGCT-3′. As an internal standard, a fragment of human beta-actin was amplified by PCR using the following primers: forward primer, 5′-GATC ATTGCTCCTCCTGAGC-3′, and reverse primer, 5′ACTCCT GCTTGCTGATCCAC-3′. Amplification reactions were performed in a 20-μl volume of the LightCycler-DNA Master SYBR Green I mixture from Roche Applied Science as follows: with 10 pmol of primer, 2 mM MgCl2, 200 μM dNTP mixture, 0.5 U of Taq DNA polymerase and universal buffer. All of the reactions were performed in triplicate in an iCycler iQ System (Bio-Rad), and the thermal cycling conditions were as follows: 95 °C for 3 min; 40 cycles of 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 30 s; 72 °C for 10 min. To confirm specificity of amplification, the PCR products from each primer pair were subjected to a melting curve analysis and electrophoresis in 2 % agarose gel. Western blot Cells were plated into 35-mm dishes and cultured to 80 % confluence. The cells were then scraped and lysed in RIPA buffer, and cell lysates were centrifuged at 10,000g (4 °C for 20 min). Protein concentrations were determined using Bradford reagent (Sigma) according to the manufacturer’s instructions. Equal amounts of total cellular protein were mixed with loading buffer (62.5 mM Tris–HCl, pH 6.8, 10 % glycerol, 2 % SDS, 2 % beta-mercaptoethanol, and bromphenol blue), boiled for 5 min, and subjected to 10 % SDS-PAGE. Proteins were transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with Tris-buffered saline containing 0.05 % Tween 20 (TBST) and 5 % fat-free dry milk for 1 h at room temperature and incubated overnight with primary antibodies in TBST with 1 % bovine serum albumin. After washing with TBST, the membranes were further incubated for 1 h at room temperature with corresponding horseradish peroxidaseconjugated secondary antibody in appropriate dilution and then washed five times with the same buffer. The
Tumor Biol.
immunoreactive protein bands were visualized by ECL kit (Pierce). Antibodies to Flag, CIZ1, c-Myc, cyclinD1, Snail, and GAPDH were purchased from Santa Cruz Biotechnology, and antibody to TCF was purchased from Cell Signaling Technology.
brief washes in 0.01 mol/l PBS, sections were exposed for 2 h to 0.01 mol/l PBS containing horseradish peroxidaseconjugated rabbit anti-goat IgG (1:500), followed by development with 0.003 % H2O2 and 0.03 % 3,30-diaminobenzidine in 0.05 mol/l Tris–HCl (pH 7.5).
RNAi-mediated knocking down of CIZ1
Immunoprecipitation
In our experiments, FG12 lentiviral vector, which has an independent open reading frame of green fluorescence protein (GFP), was used to produce small, double-stranded RNA (siRNA) to inhibit target gene expression in EH-GB2 and SGC-996 cells. To construct the hairpin siRNA expression cassette, complementary DNA oligonucleotides for siRNA of CIZ1 (si CIZ1) or mutated sequence as control (si con) were synthesized, annealed, and inserted into FG12. Two CIZ1 siRNA constructs were used as follows: CIZ1 siRNA 1# (highlighted sequence was the complementary sequence with CIZ1 mRNA), 5′-ACCGGGACTGACCAGTTTGC ATTCAAGAGATGCAAACTGGTCAGTCCTTTTTTGG ATCCC-3′ and 5′-TCGAGGGATCCAAAAAGGGACTG ACCAGTTTGCATCTCTTGAATGCAAACTGGTCAG TCC-3′; and CIZ1 siRNA 2# (highlighted sequence was the complementary sequence with CIZ1 mRNA), 5′A C C G G G AT T C T T C T T C T C A G A C T T C A A G A G AGTCTGAGAAGAAGAATCCTTTTTTGGATCCC-3′ and 5′-TCGAGGGATCCAA AAAGGGATTCTTCTTC TCAGACTCTCTTGAAGTCTGAGAAGAAGAATCC3′; si con vector (highlighted sequence was the random sequence as control that was not related to CIZ1 mRNA), 5′ACCGGTACATAGGGACGTAACGTTCAA GAGACG TTACGTCCCTATGTACCTTTTTGGATCCC-3′ and 5′TCGAGGGATCCAAAAAGGTACATAGGGACGTAAC GTCTCTTGAACGTTACGTCCCTATGTAC-3′. FG12 vector with si CIZ1 or si con was transfected into 293 T, and the virus with CIZ1 siRNA or si con was harvested from culture medium. The harvested virus was purified by centrifugation at 25,000g (4 °C, 150 min), and appropriate amounts of virus were used to infect SGC-996 and EH-GB2 cells. After 3 days of infection, the GFP-positive cells were sorted by flow cytometry (BD Biosciences), which all stably expressed si CIZ1 or si con.
Cells were washed with ice-cold PBS and lysated in Trisbuffered saline (pH 7.4), containing 50 mM Tris, 150 mM NaCl, 1 % NP-40, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF, 2.5 mg/ml aprotinin and leupeptin, 1 mM betaglycerophosphate and AEBSF (4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride), and 10 mM iodoacetate. Lysates were incubated on ice for 15 min before cellular debris and nuclei were removed by centrifugation at 10,000g for 20 min. Cell lysates were incubated with the corresponding primary antibodies overnight at 4 °C. Protein A-Sepharose (Amersham Biosciences, Piscataway, NJ, USA) beads in a 50:50 mixture in 50 mM Tris buffer, pH 7.0, were added and further incubated for another 4 h at 4 °C. The immunoprecipitates were washed four times in Tris-buffered saline and boiled for 5 min in 40-μl Laemmli buffer containing 0.02 % blue bromophenol and 2 % β-mercaptoethanol. Crystal violet assay For cell growth assay, equal number of cells were seeded in 6well plates and cultured in medium supplemented with 10 % FBS for 14 days. The medium was changed every other day. Cell growth was stopped after 14 days in culture by removing the medium and adding 0.5 % crystal violet solution in 20 % methanol. After staining for 5 min, the fixed cells were washed with phosphate-buffered saline (PBS) and photographed. Soft agar assay For clonogenic assay, cells were plated into 6-well flat-bottomed dishes using a two-layer soft agar system with 1.0×104 cells per well in a volume of 1 ml per well. After 14 days of incubation, the colonies were counted and measured. All of the experiments were done at least three times.
Immunohistochemistry Boyden chamber assay GBC tissues were fixed in formalin, embedded in paraffin, and 5-μm-thick sections were cut and mounted on glass slides. After deparaffin and antigen recovery, the sections were washed thrice in 0.01 mol/l PBS (8 mmol/l Na2HPO4, 2 mmol/l NaH2PO4, and 150 mmol/l NaCl) for 5 min each, blocked for 1 h in 0.01 mol/l PBS supplemented with 0.3 % Triton X-100 and 5 % normal goat serum, followed by addition of anti-CIZ1 (1:100) antibody at 4 °C overnight. After
Boyden chambers (8-μm pore size polycarbonate membrane) were obtained from Neuroprobe Corporation, Bethesda, MD, USA. Cells (2×105) in 0.05 ml medium containing 1 % FBS were placed in the upper chamber, and the lower chamber was loaded with 0.152 ml medium containing 10 % FBS. After 10 h of incubation, cells migrated to the lower surface of filters were detected with traditional H&E staining, and five fields of
Tumor Biol.
each well were counted. Three wells were examined for each cell type, and the experiments were repeated for at least three times.
(mean±SD). Statistical analysis was performed using the Student’s t test.
In vivo tumorigenesis assay
Result
Four 4-week-old nude mice were used in this study. CIZ1 knockdown cells (1×106; SGC-996/si CIZ1) and their control cells (SGC-996/si con) were subcutaneously injected into the opposite flanks of the same mouse. The resulting tumors were measured every 10 days, and tumor volumes (mm3) were calculated using the standard formula: length × width × height×0.5326. Tumors were harvested 40 days after injection. Data were presented as tumor volumes and tumor weight
The expression of CIZ1 was upregulated in gallbladder cancer tissues
Fig. 1 The expression of CIZ1 was increased in GBC. a Relative mRNA level of CIZ1 in human GBC samples and adjacent normal tissues. Realtime PCR was performed on 34 GBC samples and 34 normal tissues. The CIZ1 expression was normalized to that of beta-actin. Data was calculated
from triplicates. b The protein level of CIZ1 in GBC samples and adjacent normal tissues was examined by immunohistochemistry. c The protein level of CIZ1 in GBC samples and paired normal tissues was examined by Western blot. d The protein level of CIZ1 in GBC cell lines
The expression of CIZ1 in gallbladder cancer (GBC) tissues has not been studied. Therefore, we first examined the expression levels of CIZ1 mRNA in 34 pairs of human GBC and adjacent noncancerous tissues by quantitative real-time PCR. The CIZ1 transcripts were expressed at lower levels in the
Tumor Biol.
adjacent noncancerous tissues compared to the cancerous tissues (P=0.0056, Fig. 1a), indicating that the mRNA level of CIZ1 was frequently upregulated in GBC tissues. In the next study, we examined the protein level of CIZ1 in GBC tissues and adjacent normal tissues. The immunohistochemistry results revealed that the protein level of CIZ1 was elevated in GBC tissues (Fig. 1b), which was consistent with the results shown in Fig. 1a. Moreover, the protein level of CIZ1 in nine randomly selected GBC tissues and adjacent noncancerous tissues was examined by Western blot analysis. Elevated CIZ1 protein level was observed in 7/9 GBC tissues (Fig. 1c). In addition, CIZ1 was strongly expressed in four GBC cell lines (GBC-SD, SGC-996, NOZ, and EH-GB2) (Fig. 1d). Taken together, these studies suggested that the expression on CIZ1 was increased in GBC tissues and cell lines. Forced expression of CIZ1 promoted the growth and migration of gallbladder cancer cells The upregulation of CIZ1 in GBC tissues suggested that CIZ1 might exert an oncogenic role in the progression of GBC. As shown in Fig. 1d, GBC-SD and SGC-996 cell lines expressed the relative low level of CIZ1. To investigate the biological
Fig. 2 Overexpression of CIZ1 promoted the growth and migration of GBC-SD and SGC-996 cells. a The GBC-SD and SGC-996 cells were stably transfected with either the pcDNA3.1 vector or the CIZ1 expression vector. G418-resistant cells were pooled and confirmed the exogenously expressed CIZ1 by Western blot analysis. b The effects of CIZ1 on the
role of CIZ1 in the progression of gallbladder cancer, we selected GBC-SD and SGC-996 cells for CIZ1 overexpression. GBC-SD and SGC-996 cells were transfected with mycCIZ1 or pcDNA3.1 using the Lipfectamine 2000 transfection reagent. After selection with neomycin (G418), the resistant cells were pooled and confirmed the exogenous expression of myc-CIZ1 by Western blot (Fig. 2a). In the crystal violet assay, forced expression of CIZ1 promoted the growth of GBC-SD and SGC-996 cells in liquid culture (Fig. 2b). Moreover, upregulation of CIZ1 conferred the anchorage-independent growth advantage of GBC-SD and SGC-996 cells in the soft agar, indicating CIZ1 promoted the tumorigenecity of GNB cells (Fig. 2c). In addition, CIZ1 overexpression enhanced the motility of GBC cells, which was demonstrated by the cell migration assay using Boyden chamber (Fig. 2d). In summary, upregulation of CIZ1 promoted the growth and migration of GBC cells. Downregulation of CIZ1 inhibited the growth and migration of gallbladder cancer cells We next studied the biological functions of endogenous CIZ1 through knocking down the expression of CIZ1 in SGC-996
growth of GBC-SD and SGC-996 cells were measured by crystal violet assay. c The effects of CIZ1 on the anchorage-independent growth of GBCSD cells were measured by soft agar assay. Data shown was the representative results from three independent experiments. **P
