JGV Papers in Press. Published August 21, 2014 as doi:10.1099/vir.0.068502-0

1

Classical swine fever virus (CSFV) and p7 protein induce

2

secretion of IL-1β in Macrophages

3

Zhi Lin, Wulong Liang, Kai Kang, Helin Li, Zhi Cao, Yanming Zhang*

4

College of Veterinary Medicine, Northwest A&F University, Yangling 712100, Shaanxi, China.

5

* Corresponding author: Yanming Zhang

6

Tel.: +86 2987092040; fax: +86 2987091032; e-mail: [email protected].

7

Contents Category: Animal viruses- Positive-strand RNA.

8

Running title: CSFV induces secretion of IL-1β

9

Number of Words in Abstract: 149; Number of Words in Main Text: 3187; Number of Figures: 6.

10

Abstract

11

Classical swine fever virus (CSFV) has a tropism for vascular

12

endothelial cells and immune system cells. The process and release of

13

proinflammatory cytokines, including IL-1β and IL-18, is one of the

14

fundamental reactions of the innate immune response to viral infection. In

15

this study, we investigated the production of IL-1β from macrophages

16

following CSFV infection. Our results showed that IL-1β was

17

upregulated after CSFV infection through activating caspase-1.

18

Subsequent studies demonstrated that reactive oxygen species (ROS) may

19

not be involved in CSFV mediated IL-1β release. Recently, researchers

20

indicate a novel mechanism by which inflammasomes are triggered

21

through detection of activity of viroporin. We further demonstrated that

22

CSFV viroporin p7 protein induces IL-1β secretion which can inhibit by 1

23

the ion channel blocker amantadine and also discovered that p7 protein is

24

a short-lived protein degraded by the proteasome. Together, our

25

observations provide an insight into the mechanism of CSFV-induced

26

inflammatory response.

27

Keywords: Classical swine fever virus (CSFV); p7 protein; IL-1β;

28

inflammatory response; caspase-1;

29

Introduction

30

Classical swine fever (CSF) caused by Classical swine fever virus

31

(CSFV), is a highly contagious viral disease which brings threat to pigs,

32

and is named a notifiable disease by the Office International des

33

Epizooties (OIE) (Dreier et al., 2007). CSFV is an enveloped RNA virus

34

which belongs to the genus Pestivirus within the family Flaviviridae

35

(Becher et al., 2003). The 12.3 kb CSFV genomic RNA contains a 5’

36

untranslated region (5’UTR), a large open reading frame (ORF), and a 3’

37

untranslated region (3’UTR). The virus-encoded polyprotein is co- and

38

posttranslationally processed into 4 structural proteins (C, Erns, E1, and

39

E2) and 8 mature non-structural proteins (Npro, p7, NS2, NS3, NS4A,

40

NS4B, NS5A, and NS5B) (Lamp et al., 2011; Thiel et al., 1991).

41

Recently, it is confirmed that CSFV p7 protein functions as a viroporin

42

involved in virulence in swine, pore formation and modification of

43

membrane permeability (Gladue et al., 2012; Guo et al., 2013;Largo et al.,

44

2014). 2

45

During invasion by pathogens, innate immunity has been viewed as

46

the first line of defense (Schroder & Tschopp, 2010). The process and

47

release of proinflammatory cytokines, including IL-1β and IL-18, is one

48

of the fundamental reactions of the innate immune response to viral

49

infection (Kanneganti et al., 2006; Schroder & Tschopp, 2010).

50

Production of mature IL-1β requires two steps, first pro-IL-1β is

51

synthesized and then pro-IL-1β is cleaved by activated caspase-1, which

52

is activated through autocleavage (van de Veerdonk et al., 2011).

53

Recently it was found that the activation of caspase-1 is mediated by the

54

NLRP3

55

apoptosis-associated speck-like protein containing a caspase recruitment

56

domain (ASC) and pro-caspase-1 (Ito et al., 2012). The inflammasomes

57

play a central role during viral infection (Kanneganti, 2010; Negash et al.,

58

2013). Researchers indicate a novel mechanism by which inflammasomes

59

are triggered through detection of activity of viroporin (Wang, 2013).

60

Recent studies reveal that the influenza virus viroporin M2 protein

61

induces IL-1β production by ionic perturbation (Ichinohe et al., 2010),

62

Encephalomyocarditis Virus activates the NLRP3 inflammasome by

63

stimulating Ca2+ flux from intracellular storages to the cytosol via

64

Viroporin 2B protein (Ito et al., 2012).

inflammasome,

which

forms

through

recruiting

the

65

In the present study, we showed that CSFV infection induced the

66

expression and production of IL-1β through activating caspase-1. Next 3

67

we demonstrate that CSFV viroporin p7 protein induces IL-1β secretion

68

which can inhibit by the ion channel blocker amantadine and also

69

discovered that p7 protein is a short-lived protein degraded by the

70

proteasome.

71

Results

72

CSFV infection induces IL-1β secretion from macrophages

73

To assess the effect of CSFV on IL-1β transcription and secretion,

74

macrophages 3D4/2 which support CSFV replication in vitro (Weingartl

75

et al., 2002) were infected with CSFV. At indicated time, total cellular

76

RNA was extracted from mock-infected or CSFV-infected cells and the

77

exrpession of IL-1β mRNA was quantified by real-time RT-PCR. At the

78

same time, cell culture supernatants were collected and the release of

79

mature IL-1β was measured using IL-1β-specific ELISA kit. The results

80

showed a 10-fold increase in the level of IL-1β mRNA in infected cells at

81

24 hours post infection (Fig.1 (a)) and 16-fold increase at 48 hours post

82

infection (Fig.1 (a)). We also found increased secretion of IL-1β both at

83

24 hours (163 pg/ml) and 48 hours (216 pg/ml) post CSFV infection

84

compared with control group (11 pg/ml) (Fig.1 (b)). We also confirmed

85

that the IL-1β-stimulatory activity of CSFV required viral replication, as

86

UV-inactivated virus did not induce IL-1β production from treated 3D42

87

cells (fig.1 (b)).

88

Reactive oxygen species (ROS) production has been proved to be 4

89

involved in the induction of IL-1β (Allen et al., 2009). In the previous

90

study, CSFV protein NS5A was shown to stimulate ROS accumulation in

91

SUVECs (He et al., 2012). Using DHE (Dihydroethidium), ROS

92

Fluorescent Probe, we discovered that CSFV infection also stimulated

93

ROS accumulation in 3D42(Fig.1 (c)). To determine whether ROS is

94

responsible for IL-1β secretion by CSFV infection, cells were incubated

95

with ROS inhibitor PDTC (pyrrolidine dithiocarbamate; antioxidant)

96

(100μΜ). However, 20% inhibition was observed in the IL-1β secretion

97

from CSFV-infected cells incubated with PDTC (Fig.1 (b)).

98

These results demonstrated that CSFV infection can induce the

99

transcriptional expression and secretion of mature IL-1β, while ROS is

100

not involved in this progress.

101

Activation of caspase-1 by CSFV

102

Posttranslational processing and secretion of IL-1β are processed by

103

caspase-1. Caspase-1, consisting of two subunits of p20 and p10, is

104

activated through autocleavage. After activation, Caspase-1 cleaves the

105

pro-inflammatory cytokines pro-IL-1β to mature IL-1β. To determine

106

whether CSFV infection activates caspase-1, mock-infected and

107

CSFV-infected cellular lysates in the indicated time were analyzed by

108

Western blot. The results show higher levels of mature caspase-1 (p10) at

109

24

110

Benzyloxycarbonyl–Tyr–Val–Ala–Asp(OMe)–fluoromethyl-ketone(z-VA

hours

and

48

hours

post

exposure 5

to CSFV (Fig.2(a)).

111

D-FMK), a caspase 1 inhibitor, significantly inhibited IL-1β release from

112

CSFV-infected macrophages(fig.2 (b)). These data suggested that CSFV

113

induces secretion of IL-1β through activation of caspase-1.

114

CSFV p7 protein stimulates IL-1β release

115

Recently, intracellular accumulation of ROS, influenza A virus M2

116

ion channel protein, Encephalomyocarditis Virus Viroporin 2B protein

117

and HCV p7 protein have been shown to induce IL-1β secretion through

118

the activation of the inflammasome complex (Ichinohe et al., 2010; Ito et

119

al., 2012; Shrivastava et al., 2013). CSFV p7 protein is an ion channel

120

protein, which induces Ca2+ flux in cells (Guo et al., 2013) and may be

121

involved in CSFV-mediated IL-1β production. To prove this hypothesis

122

macrophages 3D4/2 were transfected with plasmid pEGFP-p7 or

123

pEGFP-C3. After 24 hours, the level of IL-1β mRNA was quantified by

124

real-time RT-PCR. Cell culture supernatants were collected and the

125

release of mature IL-1β was measured using IL-1β-specific ELISA kit.

126

We observed increased expression of both IL-1β mRNA (3.5-fold) (Fig.3

127

(a)) and secretion of IL-1β (75 pg/mL) in p7 expressing cells (Fig.3 (b)).

128

GFP-tagged p7 is a short-lived protein degraded by proteasome in

129

different cells



130

Many virus proteins are transiently produced but then decay

131

following uptake in cells. Since we have no efficient anti-p7 antibody to

132

perform immunofluorescence studies, GFP tag was used for analyzing by 6

133

fluorescence microscopy. To do this, macrophages 3D4/2 were

134

transfected with plasmids expressing either GFP or GFP-p7. After 24h,

135

GFPs were observed by direct fluorescence, and the numbers of GFP

136

positive cells were evaluated after nuclear Hoechst staining. As expected,

137

fluorescence analyses showed that the GFP control protein (Fig. 4a and b)

138

could be detected in cells untreated or exposed to proteasome inhibitor

139

MG132 (10μΜ). In contrast, the GFP-p7 was nearly undetectable (Fig. 4c)

140

and could mainly be detected after MG132 treatment (Fig. 4d).

141

Furthermore, it was tested if p7 is unstable in SUVECs in order to

142

verify whether p7 protein is unstable in different cells. Once again,

143

Western blot analysis showed that p7 is accumulated in cells in the

144

presence of proteasome inhibitor MG132 (Fig.5). The above results

145

suggest that p7 protein is a short-lived protein degraded by proteasome in

146

different mammalian cells.

147

Our observation showed that p7 protein is accumulated in cells in

148

the presence of proteasome inhibitor MG132, and it may influence the

149

IL-1beta expression. To examine this possibility, we measured IL-1β

150

production following MG132 treatment. The results showed that IL-1β

151

production is slightly increased following MG132 treatment (Fig.6). To

152

determinate whether p7 protein induced inflammasome activation is

153

associated with its ion channel characteristics, cells were treated with the

154

ion channel blocker amantadine and were transfected with p7 or 7

155

pEGFP-C3. As expected, cells treated with amantadine showed reduced

156

IL-1β secretion (Fig.6). Thus, CSFV p7 appeared to be associated with

157

CSFV-mediated IL-1β production, the exact mechanisms needed further

158

study.

159

Discussion

160

In this study, our findings demonstrate that Classical swine fever

161

virus induces the expression and maturation of IL-1β in macrophages,

162

which is mediated by activation of caspase-1. Though reactive oxygen

163

species (ROS) production has been involved in the induction of IL-1β

164

(Allen et al., 2009), 20% inhibition is observed in the IL-1β secretion

165

from CSFV-infected cells incubated with PDTC, suggesting that ROS

166

may not be involved in CSFV-induced IL-1β expression. Viroporin has

167

been implicated in the induction of IL-1β (Wang, 2013). Our results show

168

that CSFV viroporin p7 protein induces IL-1β production which can

169

inhibit by the ion channel blocker amantadine and also discovered that p7

170

protein is a short-lived protein degraded by the proteasome.

171

IL-1β is one of the most potent proinflammatory cytokines and is

172

demonstrated to possess multiple and diverse properties in the response to

173

infection (Piccioli & Rubartelli, 2013). The inflammasomes is known as

174

the platforms for caspase-1 activation and IL-1β maturation. The NLRP3

175

inflammasome and RIG-I inflammasome have been shown to be involved

176

in RNA virus-induced caspase-1 activation (Ito et al., 2012; Poeck et al., 8

177

2010). A variety of viruses have been shown to induce IL-1β production

178

through the NLRP3 inflammasome (Ito et al., 2012). In particular,

179

flaviviruses related to CSFV, including West Nile virus, Japanese

180

encephalitis virus and hepatitis C virus, promote IL-1β production

181

through the NLRP3 inflammasome (Kaushik et al., 2012; Negash et al.,

182

2013; Ramos et al., 2012). Prior works revealed increased accumulation

183

of IL-1β mRNA in swine macrophages and monocytes infected with

184

CSFV by means of microarrays and quantitative reverse transcription

185

real-time polymerase chain reaction (qrt-PCR) (Knoetig et al.,

186

1999;Borca et al., 2008; Gladue et al., 2010; Zaffuto et al., 2007). Our

187

report agrees that CSFV triggers IL-1β mRNA accumulation and also

188

induces IL-1β secretion through activation of caspase-1. RIG-I plays a

189

central role in recognition of RNA virus and activation of inflammasome

190

signaling for IL-1β production (Kato et al., 2006; Loo et al., 2008; Poeck

191

et al., 2010; Takeuchi & Akira, 2008). Recent study showed that CSFV

192

can be recognized by RIG-I and MAD5 to induce NF-κB activation

193

(Husser et al., 2011; Dong et al., 2013). We suppose that NF-κB

194

activation might be involved in the expression of pro-IL-1β and CSFV

195

might trigger RIG-I or NLRP3 to form an inflammasome then activate

196

caspase-1 for IL-1β maturation. However, this possibility needs further

197

study.

198

Many viruses are known to encode viroporins, which are involved in 9

199

inflammasome activation. Influenza virus viroporin M2 protein (Ichinohe

200

et al., 2010) and Encephalomyocarditis virus viroporin 2B protein (Ito et

201

al., 2012) induce IL-1β production by ionic perturbation. Recent studies

202

also showed that Porcine reproductive and respiratory syndrome virus

203

(PRRSV) ion channel-like protein E (Zhang et al., 2013) and HCV p7

204

RNA induce IL-1β secretion, which can be inhibited by KCl or the ion

205

channel blocker amantadine (Shrivastava et al., 2013). Ca2+ signaling has

206

been shown to be linked to NLRP3 inflammasome activation (Horng,

207

2014; Lee et al., 2012; Murakami et al., 2012). Previous work has

208

demonstrated that CSFV p7 protein elevates Ca2+ levels in cells (Guo et

209

al., 2013). Our results indicate that CSFV p7 protein triggers IL-1β

210

secretion and CSFV p7-mediated IL-1β secretion is inhibited by the ion

211

channel blocker amantadine. Our observations, togerther with those of

212

Guo et al., suggest that CSFV p7 protein induces IL-1β secretion might

213

through elevated Ca2+ levels.

214

Proteasome system plays an important role in the degradation of

215

short-lived protein and some endogenously expressed proteins (Glickman

216

& Ciechanover, 2002). Many virus proteins are transiently produced but

217

then decay in cells, including HCV NS2 protein, HCV p7 protein, CSFV

218

NS2 protein and human immunodeficiency virus type 1 (HIV-1) protein

219

Vpu (Ciechanover et al., 1998; Franck et al., 2005; Guo et al., 2013;

220

Haqshenas, 2013). While recent studies have shown that HCV p7 is 10

221

unaffected by proteasome inhibitors when expressed in a full-length virus

222

context, and only mutant p7 proteins that disrupt polyprotein processing

223

are affected by MG132 (Bentham et al., 2013). It is reported that the

224

pestivirus p7 protein is required for generation of infectious virions, while

225

mutations in BVDV p7 significantly affect the generation of infectious

226

virions (Brohm et al., 2009; Harada et al., 2000). Thus, when expressed

227

in a full-length virus context, the virus might prevent p7 from degradation.

228

This may explain the conflict between Bentham and Haqshenas. Our

229

results show that CSFV p7 protein is degraded via proteasome in different

230

cells, which also need confirm in full-length virus. And also increased

231

IL-1beta expression was observed within transfected cells following

232

MG132 treatment.

233

Proinflammatory cytokines are important mediators in immune

234

responses against viral infection. Further investigation is needed in order

235

to examine the exact mechanism of the CSFV-mediated inflammatory

236

processes.

237

Materials and methods

238

Virus and cell culture

239

CSFV (Shimen strain) was purchased from the Control Institute of

240

Veterinary Bio-products and Pharmaceuticals (China). The virus was

241

propagated in swine alveolar macrophages 3D4/2 (ATCC: CRL-2845), an

242

MOI of 10 TCID50 was used in the context. Macrophages were cultured 11

243

in RPMI 1640 medium (GIBCO, UK) containing 2 mM L-glutamine, 1.5

244

g/l sodium bicarbonate, 4.5 g/l glucose, 10 mM HEPES, 1.0 mM sodium

245

pyruvate, 0.1 mM nonessential amino acids and 10% FBS(Weingartl et al.,

246

2002). The swine umbilical vascular endothelial cells (SUVECs) were

247

cultured in high glucose Dulbecco’s-modified Eagle’s medium (DMEM;

248

GIBCO, UK) containing 10% heat-inactivated fetal bovine serum (FBS)

249

(Hyclone, USA) and 50 μg/ml heparin (Sigma-Aldrich, USA) (Hong et

250

al., 2007).

251

Constructs, transfection and reagents

252

To

facilitate

cloning

of

the

amplicons,

HindIII

(F:

253

CCGAAGCTTCTACCATTGGGTCAGG) (Underlined sequences show

254

the recognized site of restriction enzyme HindIII) and BamHI (R:

255

TCGGGATCCGCTTAACCCTTGGCAAC) (Underlined sequences show

256

the recognized site of restriction enzyme BamHI) sites were engineered

257

into the PCR oligonucleotides for amplification of CSFV p7 gene

258

according to the archived CSFV Shimen strain nucleotide sequence

259

(GenBank: AF092448). PCR product was subcloned into the mammalian

260

expression vector pEGFP-C3.The recombinant plasmid was sequenced

261

and named pEGFP-p7. Using Lipofectamine 2000 reagent (Invitrogen,

262

USA), the plasmids were transfected into overnight cultured SUVEC

263

cells and macrophages in 12-well plates.

264

Specific proteasome inhibitor MG132 (Sigma) was used to inhibit 12

265

the proteasomal degradation pathway. At 6h post-transfection, fresh

266

medium containing proteasome inhibitor MG132 (10μM) was added for

267

another 18h. For the GFP expression study, Nuclei were stained for 15

268

min at room temperature with Hoechst 33342(Beyotime,China). ROS

269

inhibitor PDTC (pyrrolidine dithiocarbamate; antioxidant), Amantadine

270

hydrochloride (ion channel blocker) were purchased from sigma.

271

Benzyloxycarbonyl–Tyr–Val–Ala–Asp

272

(z-VAD-FMK) and DHE (Dihydroethidium) were purchased from

273

Beyotime (China).

274

Real-time RT-PCR

(OMe)

–fluoromethyl-ketone

Target gene IL-1β in mock-infected and CSFV-infected cells were

275 276

quantified

by

277

5’-CAGCACCTCTCAAGCAGAACAA-3’,

278

5’-GGCAGCAACCATGTACCAACT-3’). Total cellular RNA was

279

isolated using TRIzol (Invitrogen) and the cDNA was reverse transcribed

280

from 1 μg of total RNA by using reverse transcription kit (Takara Bio,

281

Dalian, China). The RNA expression was normalized by housekeeping

282

gene

283

P2:5’-AACCGACTGCTGTCACCTTCAC-3’). Quantitative

284

RT-PCR was carried out by using a SYBR ExScriptTM RT-PCR Kit

285

(Takara Bio, Dalian, China). Reactions were performed under the

β-actin

real-time

(P1:

RT-PCR

using

the

primers(S: A:

5’-CGTCCACCGCAAATGCTTC-3’,

13

real-time

℃, and 40 cycles of 10 s at 95℃ and

286

following conditions: 10 min at 95

287

30s at 60

288

as specified by the manufacturer (Livak & Schmittgen, 2001).

289

Western blot and ELISA

290

℃. Relative transcript levels were analyzed using ΔΔCt method

Cells were incubated in radioimmune precipitation (RIPA) buffer [50

291

mM Tris (pH 7.5), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate,

292

0.1% SDS, 1 mM sodium orthovanadate, 1 mM sodium formate,

293

100μg/ml PMSF] for 45 min on ice. Protein samples were separated by

294

15% sodium dodecyl sulfate polyacrylamide gel electrophoresis and

295

transferred onto polyvinylidine fluoride (PVDF) membrane (Millipore,

296

USA). Mouse anti-GFP monoclonal antibody (Genscript, USA), rabbit

297

anti-caspase-1-p10 (sc-514; Santa Cruz Biotechnology) was used as

298

primary antibody. Cellular protein GAPDH was detected with mouse

299

anti-porcine GAPDH antibody (Genscript, USA) as an internal control

300

protein. The secreted IL-1β protein in cell culture supernatant was

301

determined by ELISA according to the manufacturer’s protocol (R&D

302

Systems).

303

Statistical analysis

304

Data analyses were performed as mean ± SD. Differences in each

305

groups were examined for statistical significance using Student’s t-test. A

306

P value less than 0.05 was considered statistically significant. 14

307

Reference

308 309 310 311

Allen, I. C., Scull, M. A., Moore, C. B., Holl, E. K., McElvania-TeKippe, E., Taxman, D. J.,

312 313 314 315

Becher, P., Ramirez, R. A., Orlich, M., Rosales, S. C., Konig, M., Schweizer, M., Stalder, H.,

316 317

p7 reduce both the egress and infectivity of assembled particles via impaired proton channel

318 319 320

Borca, M. V., Gudmundsdottir, I., Fernández-Sainz, I. J., Holinka, L. G. & Risatti, G. R. (2008).

321 322 323

Brohm, C., Steinmann, E., Friesland, M., Lorenz, I. C., Patel, A., Penin, F., Bartenschlager, R. &

324 325 326 327 328 329 330

Guthrie, E. H., Pickles, R. J. & Ting, J. P.-Y. (2009). The NLRP3 inflammasome mediates in vivo innate immunity to influenza A virus through recognition of viral RNA. Immunity 30, 556-565. Schirrmeier, H. & Thiel, H. J. (2003). Genetic and antigenic characterization of novel pestivirus genotypes: implications for classification. Virology 311, 96-104. Bentham, M. J., Foster, T. L., McCormick, C. & Griffin, S. (2013). Mutations in hepatitis C virus function. The Journal of general virology 94, 2236-2248. Patterns of cellular gene expression in swine macrophages infected with highly virulent classical swine fever virus strain Brescia. Virus research 138, 89-96. Pietschmann, T. (2009). Characterization of Determinants Important for Hepatitis C Virus p7 Function in Morphogenesis by Using trans-Complementation. Journal of virology 83, 11682-11693. Ciechanover, A., Everett, R., Orr, A., Preston, C., Arnold, I., Pfeiffer, K., Neupert, W., Stuart, R., Schgger, H. & other authors (1998). The ubiquitin–proteasome pathway: on protein death and cell life FREE. EMBO J 17, 7151-7160. Dong, X.-Y., Liu, W.-J., Zhao, M.-Q., Wang, J.-Y., Pei, J.-J., Luo, Y.-W., Ju, C.-M. & Chen, J.-D. (2013). Classical swine fever virus triggers RIG-I and MDA5-dependent signaling pathway to IRF-3 and NF-κB activation to promote secretion of interferon and inflammatory cytokines

331 332

Dreier, S., Zimmermann, B., Moennig, V. & Greiser-Wilke, I. (2007). A sequence database allowing

333

automated genotyping of Classical swine fever virus isolates. Journal of virological methods

334 335

140, 95-99. Franck, N., Le Seyec, J., Guguen-Guillouzo, C. & Erdtmann, L. (2005). Hepatitis C virus NS2

336

protein is phosphorylated by the protein kinase CK2 and targeted for degradation to the

337

proteasome. Journal of virology 79, 2700-2708.

in porcine alveolar macrophages. Virology journal 10, 286.

338 339 340

Gladue, D. P., Zhu, J., Holinka, L. G., Fernandez-Sainz, I., Carrillo, C., Prarat, M. V., O’Donnell,

341 342

Gladue, D. P., Holinka, L. G., Largo, E., Sainz, I. F., Carrillo, C., O'Donnell, V.,

343 344 345

Fever Virus p7 protein is a viroporin involved in virulence in swine. Journal of virology 86,

346 347 348

V. & Borca, M. V. (2010). Patterns of gene expression in swine macrophages infected with classical swine fever virus detected by microarray. Virus research 151, 10-18. Baker-Branstetter, R., Lu, Z., Ambroggio, X. & other authors (2012). Classical Swine 6778-6791. Glickman, M. H. & Ciechanover, A. (2002). The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiological reviews 82, 373-428. Guo, H. C., Sun, S. Q., Sun, D. H., Wei, Y. Q., Xu, J., Huang, M., Liu, X. T., Liu, Z. X., Luo, J. X. & other authors (2013). Viroporin activity and membrane topology of classic swine fever 15

349 350 351

virus p7 protein. Int J Biochem Cell Biol 45, 1186-1194. Guo, K.-K., Tang, Q.-H., Ning, P.-B., Li, H.-L., Liu, W., Lv, Q.-Z., Liang, W.-L., Lin, Z., Zhang, C.-C. & other authors (2013). Pilot Study on Degradation of Classical Swine Fever Virus

352 353 354

Haqshenas, G. (2013). The p7 protein of hepatitis C virus is degraded via the proteasome-dependent

355

Harada, T., Tautz, N. & Thiel, H. J. (2000). E2-p7 region of the bovine viral diarrhea virus

356 357 358 359 360 361 362 363 364

Nonstructural 2 Protein in Cells. Journal of Animal and Veterinary Advances 12, 234-241. pathway. Virus research 176, 211-215. polyprotein: Processing and functional studies. Journal of virology 74, 9498-9506. He, L., Zhang, Y.-m., Lin, Z., Li, W.-w., Wang, J. & Li, H.-L. (2012). Classical swine fever virus NS5A protein localizes to endoplasmic reticulum and induces oxidative stress in vascular endothelial cells. Virus genes 45, 274-282. Horng, T. (2014). Calcium signaling and mitochondrial destabilization in the triggering of the NLRP3 inflammasome. Trends in immunology 35, 253-261. Husser, L., Alves, M. P., Ruggli, N. & Summerfield, A. (2011). Identification of the role of RIG-I, MDA-5 and TLR3 in sensing RNA viruses in porcine epithelial cells using lentivirus-driven RNA interference. Virus Research 159, 9-16.

365 366

Ichinohe, T., Pang, I. K. & Iwasaki, A. (2010). Influenza virus activates inflammasomes via its

367 368 369

Ito, M., Yanagi, Y. & Ichinohe, T. (2012). Encephalomyocarditis virus viroporin 2B activates NLRP3

370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385

intracellular M2 ion channel. Nature immunology 11, 404-410. inflammasome. PLoS pathogens 8, e1002857. Kanneganti, T.-D. (2010). Central roles of NLRs and inflammasomes in viral infection. Nature Reviews Immunology 10, 688-698. Kanneganti, T. D., Body-Malapel, M., Amer, A., Park, J. H., Whitfield, J., Franchi, L., Taraporewala, Z. F., Miller, D., Patton, J. T. & other authors (2006). Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to viral infection and double-stranded RNA. Journal of Biological Chemistry 281, 36560-36568. Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T. & other authors (2006). Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441, 101-105. Kaushik, D. K., Gupta, M., Kumawat, K. L. & Basu, A. (2012). NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese encephalitis. PLoS ONE 7, e32270. Knoetig, S. M., Summerfield, A., Spagnuolo-Weaver, M. & McCullough, K. C. (1999). Immunopathogenesis of classical swine fever: role of monocytic cells. Immunology 97, 359-366. Lamp, B., Riedel, C., Roman-Sosa, G., Heimann, M., Jacobi, S., Becher, P., Thiel, H.-J. & Rümenapf, T. (2011). Biosynthesis of classical swine fever virus nonstructural proteins. Journal of virology 85, 3607-3620.

386 387 388

Largo, E., Gladue, D. P., Huarte, N., Borca, M. V. & Nieva, J. L. (2014). Pore-forming activity of

389 390

Lee, G.-S., Subramanian, N., Kim, A. I., Aksentijevich, I., Goldbach-Mansky, R., Sacks, D. B.,

391

regulates the NLRP3 inflammasome through Ca2+ and cAMP. Nature 492, 123-127.

pestivirus p7 in a minimal model system supports genus-specific viroporin function. Antiviral research 101, 30-36. Germain, R. N., Kastner, D. L. & Chae, J. J. (2012). The calcium-sensing receptor

16

392 393

Livak, K. J. & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.

394 395 396 397

Loo, Y.-M., Fornek, J., Crochet, N., Bajwa, G., Perwitasari, O., Martinez-Sobrido, L., Akira, S.,

398

role for calcium mobilization in activation of the NLRP3 inflammasome. Proceedings of the

399

National Academy of Sciences 109, 11282-11287.

Gill, M. A., García-Sastre, A. & other authors (2008). Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. Journal of virology 82, 335-345. Murakami, T., Ockinger, J., Yu, J., Byles, V., McColl, A., Hofer, A. M. & Horng, T. (2012). Critical

400 401

Negash, A. A., Ramos, H. J., Crochet, N., Lau, D. T., Doehle, B., Papic, N., Delker, D. A., Jo, J.,

402 403

by Hepatic Macrophages Links Hepatitis C Virus Infection with Liver Inflammation and

404

Piccioli, P. & Rubartelli, A. (2013). The secretion of IL-1β and options for release. In Seminars in

405 406 407

Bertoletti, A. & other authors (2013). IL-1β Production through the NLRP3 Inflammasome Disease. PLoS pathogens 9, e1003330. immunology 25, 425-429. Poeck, H., Bscheider, M., Gross, O., Finger, K., Roth, S., Rebsamen, M., Hannesschläger, N., Schlee, M., Rothenfusser, S. & other authors (2010). Recognition of RNA virus by RIG-I

408 409

results in activation of CARD9 and inflammasome signaling for interleukin 1 [beta]

410 411 412

Ramos, H. J., Lanteri, M. C., Blahnik, G., Negash, A., Suthar, M. S., Brassil, M. M., Sodhi, K.,

413

Schroder, K. & Tschopp, J. (2010). The inflammasomes. Cell 140, 821-832.

414 415 416

Shrivastava, S., Mukherjee, A., Ray, R. & Ray, R. B. (2013). Hepatitis C Virus Induces

417 418

Takeuchi, O. & Akira, S. (2008). MDA5/RIG-I and virus recognition. Current opinion in immunology

419

Thiel, H., Stark, R., Weiland, E., Rümenapf, T. & Meyers, G. (1991). Hog cholera virus: molecular

production. Nature immunology 11, 63-69. Treuting, P. M., Busch, M. P. & other authors (2012). IL-1β signaling promotes CNS-intrinsic immune control of West Nile virus infection. PLoS pathogens 8, e1003039.

Interleukin-1β (IL-1β)/IL-18 in Circulatory and Resident Liver Macrophages. Journal of virology 87, 12284-12290. 20, 17-22.

420 421

van de Veerdonk, F. L., Netea, M. G., Dinarello, C. A. & Joosten, L. A. (2011). Inflammasome

422

activation and IL-1β and IL-18 processing during infection. Trends in immunology 32,

423 424

110-116.

composition of virions from a pestivirus. Journal of virology 65, 4705-4712.

Wang, K. (2013). Viroporin Activates Inflammasome. Journal of Applied Virology 2, (1).

425 426 427

Weingartl, H., Sabara, M., Pasick, J., Van Moorlehem, E. & Babiuk, L. (2002). Continuous porcine

428 429 430 431

Zaffuto, K., Piccone, M., Burrage, T., Balinsky, C., Risatti, G., Borca, M., Holinka, L., Rock, D. &

432 433 434

cell lines developed from alveolar macrophages: partial characterization and virus susceptibility. Journal of virological methods 104, 203-216. Afonso, C. (2007). Classical swine fever virus inhibits nitric oxide production in infected macrophages. Journal of general virology 88, 3007-3012. Zhang, H., Cao, H., Wu, Z. & Cui, Y. (2011). A Review of Molecular Characterization of Classical Swine Fever Virus (CSFV). J Veter Med 66, 89-95. Zhang, K., Hou, Q., Zhong, Z., Li, X., Chen, H., Li, W., Wen, J., Wang, L., Liu, W. & other authors

(2013). Porcine reproductive and respiratory syndrome virus activates 17

435

inflammasomes of porcine alveolar macrophages via its small envelope protein E. Virology

436

442, 156-162.

437 438

Figures:

439

Fig.1. CSFV infection induces IL-1β secretion from macrophages. (a) RNA from mock-

440

or CSFV-infected macrophages was isolated at 24 h and 48 h, IL-1 β mRNA expression was

441

measured by qRT-PCR. (b) Macrophages were incubated with CSFV for 24 h and 48 h.

442

CSFV-infected macrophages were incubated with PDTC (100μΜ) for 24 h. Levels of secreted

443

IL-1β 24 h post treatment with uv-inactivated virus. Cell-free supernatants were collected and

444

analyzed for IL-1β by ELISA. The results are shown as means and standard deviations from three

445

independent experiments. **, P

Classical swine fever virus and p7 protein induce secretion of IL-1β in macrophages.

Classical swine fever virus (CSFV) has a tropism for vascular endothelial cells and immune system cells. The process and release of pro-inflammatory c...
740KB Sizes 0 Downloads 6 Views