Pathology – Research and Practice 210 (2014) 98–104
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Original Article
Clinicopathologic characteristics of colorectal cancer with microsatellite instability S. Ziadi ∗ , F. Ksiaa, R. Ben Gacem, N. Labaied, M. Mokni, M. Trimeche Department of Pathology, CHU Farhat-Hached of Sousse, 4000 Sousse, Tunisia
a r t i c l e
i n f o
Article history: Received 5 February 2013 Received in revised form 29 July 2013 Accepted 22 October 2013 Keywords: Colorectal cancer Microsatellite instability Tunisia
a b s t r a c t Colorectal cancer (CRC) can be classified according to the level of microsatellite instability (MSI) exhibited by the tumor. The aim of this study was to determine MSI status in CRC from Tunisia and to identify clinical and pathological characteristics of MSI-H tumors. Microsatellite status was determined by polymerase chain reaction amplification using standard markers (BAT25, BAT26, D2S123, D5S346 and D17S250, the Bethesda panel) in 44 CRC cases. Molecular results were correlated with pathological and clinical features. Six CRC cases (13.8%) showed high-level instability (MSI-H), 14 cases had low level instability (MSI-L), and the remainders were stable (MSS). Immunohistochemical analysis showed loss of MSH2 protein in 3 cases among the 6 MSI-H tumors, whereas no silencing of MLH1 or MSH6 was found in any case. Significant differences in age and family history of cancers were observed between MSI-H and MSS/MSI-L groups (p = 0.01 and p = 0.002). However, statistical analysis showed that there were no significant differences between MSI-H and MSS/MSI-L tumors in terms of tumor location, lymph node involvement and stage of disease. Regarding histological features, MSI-H tumors were more likely to be poorly differentiated (p = 0.003), to have a medullary pattern (p = 0.005), and to harbor increased numbers of peritumoral lymphocytes (p = 0.001). These findings indicate that careful observation of the tumor morphology can assist in the identification of unstable colorectal cancers requiring molecular investigations. © 2013 Elsevier GmbH. All rights reserved.
Introduction Colorectal cancers (CRC) are considered to belong to the most common cancers in industrialized countries. They are the third most common cancer in men after lung and prostate cancers and come second in women after breast cancer. In Tunisia, CRC have an annual incidence of 10.3/100,000 individuals. However, a significant proportion (9%) of these cancers occurs before age 40 years, suggesting genetic susceptibility [13]. The deficiency of the DNA mismatch repair (MMR) system is a major mechanism for carcinogenesis. It is involved in the development of hereditary non-polyposis colorectal cancers (HNPCC, also called Lynch syndrome) and in nearly 20% of sporadic CRC [3]. This deficiency is responsible for microsatellite instability (MSI), resulting from the accumulation of small insertions or deletions that frequently arise during replication of these short repeated sequences [25].
∗ Corresponding author at: Department of Pathology, Farhat-Hached Hospital, Sousse 4000, Tunisia. Tel.: +216 98633982; fax: +216 73226702. E-mail address: sonia [email protected] (S. Ziadi). 0344-0338/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2013.10.004
Dysfunction of MMR proteins may be related either to an alteration of a gene at the constitutional level, which is the case with Lynch syndrome mutations constitutional MMR genes (hMLH1, hMSH2, hPMS1, hPMS2 and hMSH6), or to altered gene in somatic tumor. In the latter case, it is often a loss of function of hMLH1 most often involved is its epigenetic repression by methylation of its promoter [34]. Determining the MSI phenotype by molecular biology techniques has been standardized by the international conference organized by the National Institute of Health in 1998 [3], which recommends the genotyping of five markers: three dinucleotide repeat markers (D2S123, D5S346, D17S250) and two mononucleotide repeat markers (BAT25 and BAT26) [3]. The realization of this phenotype, which compares the constitutional and tumor genome of a patient, assumes control of the histological quality of the tumor sample. Besides a fundamental interest because of the original transformation mechanism, the study of tumors with MSI instability is of great clinical interest. It has indeed been shown in several studies that tumors with MSI had several epidemiological, anatomical, histological and prognostic features [1,14,39]. The aim of the present study was to analyze in a series of CRC from Tunisia the clinico-pathological characteristics of colorectal cancers with microsatellite instability.
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
Material and methods Patients and tumor samples Patients who had undergone resection of CRC between January and December 2007 were identified from the files of the Department of Pathology, CHU Farhat-Hached of Sousse, Tunisia. Patients with history of familial adenomatous polyposis or preoperative anticancer therapy were excluded from the study. Fifty patients were retained for this study. For all of these cases, matched pairs of colorectal tumor and normal adjacent tissues were obtained as formalin-fixed, paraffin-embedded specimens. Clinical information regarding gender, age at diagnosis, location of the tumor (classified as proximal or distal in reference to the splenic flexure of colon), tumor extension according to the classification of UICC/AJCC, personal and family history of cancer, was retrieved from available hospital records for every patient. Review of tissue sections was carried out by two pathologists (MT and SZ) without knowledge of the tumor MSI status. At least three histologic hematoxylin–eosin stain slides were reviewed per case. Several histological parameters were evaluated semiquantitatively. Histological tumor type and grade were determined according to the World Health Organization classification [11]. The percentage of mucin was quantified under low power magnification; we divided our patients according to the percentage of this component into three groups: 50%. Considered as “medullary-type” cancers, a subgroup showed poor differentiation consisting of nests, trabecular, and sheets of small- to medium-sized cells with scant to abundant eosinophilic cytoplasm, frequent mitotic figures and a distinct stromal population of small lymphocytes [1,11]. We divided our patients according to the percentage of this component into three groups: 50%. Patterns of lymphocytic infiltration include the presence of intra-epithelial lymphocytes and peritumoral lymphocytes were determined. Tumor-infiltrating lymphocytes based on the finding in a hematoxylin and eosin-stained section of at least four intraepithelial lymphocytes in one field at high magnification [39]. Peritumoral lymphocytes were defined as the cuff of lymphocytes surrounding the deepest point of the advancing front of the tumor [8]. DNA extraction and ˇ-globin amplification Genomic DNA was extracted from formalin-fixed, paraffinembedded tissues samples as described previously [20]. Briefly, 2–5 sections (5 m thick) of each tissue sample were cut using a microtome and were put in a microtube containing 400 l of a lysis buffer (50 mM Tris–HCl at pH 8.5; 1 mM EDTA; 0.5% Tween 20). Then, a volume of 10 l of proteinase K, initial concentration of 10 mg/ml, was added to the reaction mixture. After incubation overnight at 56 ◦ C, the tubes were boiled for 7 min to inactivate the enzyme. To separate DNA from the other components, centrifugation at 12,000 rpm for 15 min and at 4 ◦ C was conducted, the supernatant, containing the DNA, was collected and stored at −20 ◦ C until use. The quality of the extracted DNA was assessed by polymerase chain reaction (PCR) amplifying a 268-base pairs (bp) sequence of the housekeeping gene -globin using a pair of specific primers (globinS: 5 -CAACTTCATCCACGTTCACC-3 and Gh20: 5 GAAGAGCCAAGGACAGGTAC-3 ) [27]. Samples of high-quality DNA were submitted to microsatellite instability analysis. Microsatellites analyses Microsatellite instability was assessed using the five microsatellite markers recommended by the 1997 National Cancer
99
Table 1 Primer sequences and PCR annealing temperature for the five Bethesda markers. Marker BAT25 BAT26 D2S123 D5S346 D17S250
Primer sequence (5 →3 ) TCGCCTCCAAGAATGTAAGT TCTGGATTTTAACTATGGCTC TGACTACTTTTGACTTCAGCC AACCATTCAACATTTTTAACC AAACAGGATGCCTGCCTTTA GGACTTTCCACCTATGGGAC ACTCACTCTAGTGATAAATCGGG AGCAGATAAGACAAGTATTACTAG GGAAGAATCAAATAGACAAT GCTGGCCATATATATATTTAAACC
Hybridization temperature 53 ◦ C 53 ◦ C 53 ◦ C 58 ◦ C 48 ◦ C
Institute-sponsored consensus conference in Bethesda [3]: two mononucleotide markers, single nucleotide repeats (BAT25 and BAT26) and three dinucleotide markers, repetitions of a pattern of two nucleotides (D5S346, D2S123 and D17S250). Primer sequences are given in Table 1. Optimal annealing temperatures were determined for each primer pair, and 200 ng of template DNA was amplified by PCR in a final reaction volume of 25 l containing 1 unit of Taq DNA polymerase (Promega, Madison, WI, USA), PCR buffer 1× (10 mM Tris, pH 8.3, 50 mM KCl), 0.2 mM each deoxynucleotide triphosphate (dNTP), and 2.5 mM MgCl2 , and 0.3 mM each primer. The reaction amplifications were carried out on a PTC200TM thermocycler (MJ Research, Watertown, MA, USA). Thermal cycling was performed using the following conditions: initial denaturation at 93 ◦ C for 5 min, followed by 35 cycles of 1 min at 93 ◦ C, 1 min at the specific annealing temperature (Table 1) and 1 min at 72 ◦ C. The reaction was finished with a 10-min extension at 72 ◦ C. Finally, PCR products were separated by electrophoresis in polyacrylamide mini gels using Mini-Protean 3 System (Bio-Rad, Marnes-la-Coquette, France), stained by ethidium bromide and visualized under ultra-violet light using the GelDoc2000 System (Bio-Rad). MSI was identified by the presence of novel bands in the PCR product from malignant colorectal tissue as compared with the pattern from non-malignant tissue of the same patient. Each gel was scored independently by two experienced observers (MT and RBG). If there was discordance in their interpretation, the gels were reviewed to provide a consensus result. Tumors in which none of the markers showed instability were classified as microsatellite stable (MSS). Those with a single unstable marker were classified as MSI-low (MSI-L). Tumors with two or more unstable loci were classified as MSI-high (MSI-H) [3]. Immunohistochemical staining Immunohistochemistry was performed for MSI-H cases to assess the expression of the MMR proteins: MLH1, MSH2, and MSH6. Briefly, four micron-thick sections were obtained from formalin-fixed, paraffin-embedded tissue blocks. The tissue sections were deparaffinized in toluene and rehydrated in graded concentrations of alcohol. Endogenous peroxidase activity was blocked by treating the sections with a blocking solution. For antigen retrieval, the sections were treated while boiling in citrate buffer (pH 6.0) in a microwave oven. Sections were then rinsed with Tris-buffered saline (TBS) (0.05 M Tris–HCl, 1.15 M NaCl, pH 7.6) and incubated overnight at 4 ◦ C with primary antibodies against MLH1 (Diagnostic BioSystems, clone: G168-15, dilution of 1:100), MSH2 (Diagnostic BioSystems, clone 25D12, dilution of 1:50), MSH6 (Diagnostic BioSystems, clone: 44, dilution of 1:50). After rinsing in TBS, the described antibodies were detected using the EnVision+ labeled polymer Kit (DakoCytomation) following the manufacturer’s instructions. To visualize immunoreactivity,
100
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
Fig. 1. Examples of microsatellite instability (MSI) analysis in colorectal carcinomas. The arrows indicate the presence of extra bands in the tumor (T) tissue compared to the normal (N) tissue from the same patient.
diaminobenzidine (DAB) was used, and samples were counterstained with hematoxylin and mounted. Lack of expression of one of these proteins was defined as complete absence of detectable nuclear staining in tumor cells. Intact nuclear staining of the colonic crypts of the peritumoral normal mucosa, stromal cells and lymphocytes served as an internal positive control and was required for adequate evaluation. All immunohistochemical slides were evaluated independently by two pathologists (MT and SZ). Statistical analysis Statistical analysis was performed by SPSS software. Tumors classified as MSI-L were included with MSS tumors for statistical analysis because of the reported similarity between cases with low levels of MSI and MSS [15,22]. Comparisons of the clinicopathological characteristics between patients with MSI-H tumors and MSS/MSI-L tumors were performed by the 2 or the Fisher test. P values of less than 0.05 were considered statistically significant. Results MSI detection The quality of DNA samples was checked by PCR amplification of a 268-pb fragment within the human -globin gene. The integrity of DNA samples was validated in 44 of the 50 CRC cases tested. MSI analyses were then performed for these 44 CRC cases. Of these, 24 patients (54.5%) were found to have MSS tumors, 14 patients (31.8%) had instability at one marker (MSI-L), and six patients (13.6%) had instability at two or more markers (MSI-H). Fig. 1 illustrates representative examples for MSI analysis. Table 2 presents the status of each marker. Four of the MSI-H tumors were unstable at BAT26, and one was stable at both BAT26 and BAT25 (Table 1). In contrast, the most frequently unstable marker in MSI-L tumors was D17S250. Clinicopathological characteristics of MSI-H tumors The comparison of the clinicopathological characteristics according to the MSI status was summarized in Table 3.
Table 2 Microsatellite alterations (+) in 44 colorectal carcinomas from Tunisia. Case number
BAT25
BAT26
S2D123
S5D346
S17D250
MSI status
2 8 10 40 48 49 1 5 6 11 13 17 19 23 25 27 28 33 43 45 3 7 9 12 14 15 16 18 20 21 22 24 26 30 31 32 34 36 37 38 39 44 46 47
+ – – + – + + + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
– + – + + + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
+ – + + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
+ + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
– – + – + + – – + + + + + + + + + + + + – – – – – – – – – – – – – – – – – – – – – – – –
MSI-H MSI-H MSI-H MSI-H MSI-H MSI-H MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
101
Table 3 Comparison of the clinical and histological features between MSI-H and MSS/MSI-L colorectal cancers. Parameters Age at diagnosis (years) Range ≤50 50–70 >70
MSS or MSI-L (n = 38) 21–83 9 19 10
MSI-H (n = 6)
p value
38–55 5 1 0
0.01
Gender Male Female
17 21
3 3
0.82
Family history of cancer Colorectal Non-colorectal Negative
2 0 36
2 1 3
0.002
Location of tumor Proximal Distal
10 28
1 5
0.68
Depth of invasion pT1/T2 pT3/T4
2 36
1 5
0.40
Lymph node involvement Positive Negative
24 14
3 3
0.56
Visceral metastasis Positive Negative
10 28
2 4
0.72
TNM stage I/II III/IV
13 25
2 4
0.42
Tumor grade Well differentiated Moderately differentiated Poorly differentiated
26 8 4
0 5 1
0.003
Fig. 2. Colorectal carcinoma from subject with MSI-H phenotype showing medullary histological pattern (Case n◦ 8). The tumor is composed of sheets and nests of cells showing non glandular differentiation with numerous tumor-infiltrating (intraepithelial) lymphocytes (hematoxylin and eosin, original magnification ×400).
classified in stages III/IV (66.7%) and two were classified in stages I/II. The MSS/MSI-L cases had stages III/IV in 65.7% (25/38) versus 35.3% (13/38) in stages I/II. Regarding histological features, we found that MSI-H tumors were more likely to be poorly differentiated (p = 0.003), to have a medullary pattern (p = 0.005), and to harbor increased numbers of peritumoral lymphocytes (p = 0.001) (Table 3, Figs. 2 and 3). In contrast, no significant differences were found between MSI-H and MSS/MSI-L tumors according to mucinous component or intraepithelial lymphocytes. Immunohistochemical analysis of the MMR proteins
Peritumoral lymphocytes Positive Negative
7 31
3 3
0.001
Intraepithelial lymphocytes Positive Negative
1 37
1 5
0.50
Mucinous type Positive Negative
2 36
0 6
0.83
Medullary pattern Positive Negative
1 37
2 4
0.005
Immunohistochemistry for MLH1, MSH2, and MSH6 was performed for all MSI-H tumors. The results of the immunohistochemical analysis are resumed in Table 4, and representative examples of the immunostaining are presented in Fig. 4. Three cases among the six MSI-H tumors (50%) showed a complete loss of MSH2 with normal MLH1 and MSH6 staining (Cases n◦ 8, 10 and 49). Two of the three patients with tumors that were negative for MSH2 had a cancer onset age of less than 50 years old (39 and 40 years), of whom one patient (Case n◦ 10) had a family history of colorectal cancer (Table 4).
p-Values were calculated by 2 or Fisher’s exact tests (two sided) and were considered to be statistically significant for p < 0.05. Significant p-values are shown in bold.
MSI-H phenotype was found in three men and three women. Five MSI-H patients had a young age (ranging from 26 to 46 years) and three had a family history of cancer. A significant correlation was found between MSI-H phenotype and young age (≤50 years, p = 0.01) and family history of cancer (p = 0.002). Colorectal cancers having proximal location are often unstable. In our series, we did not find this association; in fact, five out of the six MSI-H tumors of our series were located in the distal colon. Statistical analysis showed that there were no significant differences between MSI-H and MSS/MSI-L tumors in terms of stage of disease. Indeed, two MSS/MSI-L tumors (5.2%) and one MSI-H tumor (16.6%) were in pT1/pT2 stage, while 36 MSS/MSI-L tumors (94.7%) and five MSI-H tumors were in pT3/pT4 (83.3%). Lymph node involvement was present in half of MSI-H tumors (3/6 cases) and in 14 MSS/MSI-L tumors (36.8%). Visceral metastases were present in two of MSI-H cases (one ovarian and one in the liver). According to the AJCC/UICC classification, four MSI-H tumors were
Fig. 3. Colorectal carcinoma from subject with MSI-H phenotype (Case n◦ 2) showing a Crohn’s like pattern characterized by a pronounced peritumoral lymphoid tissue with lymphoid follicles (hematoxylin and eosin, ×400).
102
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
Fig. 4. Immunostaining for MLH1 (panel a, ×400), MSH2 (panel b, ×200), and MSH6 (panel c, ×400) in a colorectal cancer case with high microsatellite instability (Case n◦ 8) showing extinction of the expression of MSH2 and retained expression of MLH1 and MSH6 proteins.
Table 4 Results of the immunohistochemical analysis for the three MMR proteins: MLH1, MSH2 and MSH6 in MSI-H colorectal tumors. Case number
Gender
2 8 10 40 48 49
F M F M M F
Age at diagnosis 38 39 40 45 46 55
Family history of cancer + − + + − −
Protein expression MLH1/MSH2/MSH6 +/+/+ +/−/+ +/−/+ +/+/+ +/+/+ +/−/+
F: female; M: male; +: positive; −: negative
Discussion Hereditary nonpolyposis colorectal cancer (HNPCC) is the most frequent cause of inherited colorectal cancer. It is an autosomal dominantly inherited syndrome characterized by the occurrence of early onset CRC, an excess of synchronous and metachronous CRC, as well as a defined spectrum of extracolonic tumors, particularly cancers of the endometrium, small intestine, hepato-biliary tract, upper urinary tract and stomach [23]. Most of these cases remain unknown for lack of a suitable diagnostic strategy. High-level microsatellite instability (MSI-H) is demonstrated in most cancers presenting in the inherited condition (HNPCC) and in 10–20% of sporadic colorectal cancers [3,5]. Distinction between these categories of MSI-H cancer is of clinical importance. In patients with MSI-H sporadic colorectal cancer, instability is often based on epigenetic transcriptional silencing of hMLH1 via hypermethylation of its promoter [12,34]. DNA methylation is an age-related phenomenon, and sporadic MSI-H CRC are more frequent in the elderly [33]. In this study, we analyzed the MSI status in a series of CRC from Tunisia and found a high-level of microsatellite instability (MSI-H) in 13.6% (6/44) of our cases. Several studies have analyzed the MSI status of colorectal cancer based on the same technique we used. These studies have reported varying frequencies of colorectal cancers with unstable phenotype, ranging from 9 to 27% [2,4,19,21,36]. Individuals with MSI-H tumors seem to have distinct clinical features. In this study, we found significant difference in age between MSI-H and MSS/MSI-L groups (p = 0.01). Samowitz et al. [29] reported that individuals with colorectal cancer diagnosed before the age of 55 or over the age of 70 had a higher percentage of MSI-H tumors than those between 55 and 70 years of age. Gryfe et al. [10] reported that MSI-H tumors are diagnosed at a younger age than those with MSS colorectal cancers. Other studies have found no significant difference in age at diagnosis [17,26].
Family history is considered the most useful indicator of HNPCC in individual patients in the clinical setting. In this study, the family history of cancer was correlated with the unstable phenotype (p = 0.002). Indeed, 4 of our patients had a positive family history of CRC, among them two had instability at 2 or more markers (MSI-H). Another patient had a positive family history of pancreatic cancer and had high level microsatellite instability. MSI-H tumors were generally reported more frequently in women [39], although this was not confirmed in all studies [10,38]. In this present study, there was no association between MSI-H status and gender. MSI-H tumors are more likely to be right sided [17,31,39]. This was not observed in our series. MSI-H colorectal tumors typically present with a greater depth of invasion but with a lower overall stage (as defined by the American Joint Committee on Cancer, AJCC) [9,10]. In contrast, we found that MSI-H phenotype appeared to be overrepresented in stage III and IV tumors; this association did not reach statistical significance. Lymph node metastases are less frequent in individuals with MSIH [6,10,18,22,24,28]. In our study, lymph node metastases were present in half of MSI-H colorectal cancers. Many authors agree that MSI-H carcinomas tend to be poorly differentiated [9,10,23], mucin-producing [9,35] and of the medullary type [32,37]. Frequently, there is a greater lymphoid host response (peritumoral lymphocytes and intraepithelial lymphocytes). In our study, MSI-H was significantly associated with poor differentiation (p = 0.003), medullary type (p = 0.005) and peritumoral lymphocytes (p = 0.001) when compared with the MSS/MSI-L groups. Distinguishing the phenotype of MSI-H in HNPCC as compared with sporadic colorectal cancers will help to identify which individuals are at risk of an inherited predisposition (i.e., MMR gene mutations), thereby determining whose families should undergo intensive surveillance. Several studies have tried to identify features that are more characteristic of MSI-H tumors and that can differentiate tumors from patients with HNPCC from those with sporadic CRC. Young et al. [39] reported that MSI-H in sporadic cancers represented a late onset disorder affecting a disproportionate number of women, whereas MSI-H in HNPCC was predominantly associated with younger age of presentation and a more equal gender distribution. In our study, 83% (5/6) of cases with MSI-H phenotype were younger than 50 years without sex predominance. Although HNPCC predominantly affects the proximal colon, 30–40% may present with disease in the distal colon. By comparison, approximately 80–90% MSI-H sporadic cancers occur in proximal colon [19,39]. In our work, the localization of
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
MSI-H tumors in the distal colon was more common than in the proximal colon (5 cases versus 1 case). It now appears that some of the generic morphological characteristics of MSI-H cancers are observed more frequently in HNPCC while others appear more often in sporadic MSI-H cancer. A marked mucinous component has been reported in 31–43% [7,19,35,39] of sporadic MSI-H cancer. When a mucinous phenotype was defined on the basis of any amount of secretory mucin production, this feature was present in 67% of MSI-H cancers that were mainly sporadics [9]. On the other hand, mucinous differentiation was observed in only 19% of probable HNPCC cancers [16] and in 22% [39] of subjects with a proven germline mutation. Mucin production was not significantly increased as compared with CRC from the general population [30]. In our series, only one case among the six MSIH tumors had a significant mucinous component, but he had no familial history of cancer. The presence of peritumoral lymphocyte, intraepithelial lymphocytes and a Crohn’s-like reaction was scored more frequently in HNPCC CRC, although the difference was statistically significant only for peritumoral lymphocytes [39]. In our study, three cases among the six MSI-H tumors showed a marked peri-tumoral lymphocytosis. These three patients were younger than 50 years and one of them had a family history of colorectal cancer. Furthermore, mutations in MMR genes have been proven to be closely related to the development of HNPCC cancers. In particular, MLH1 and MSH2 are thought to be the main genes responsible [40]. Germline mutations are usually responsible for the absence of MSH2 proteins [41], whereas the absence of MLH1 can be indicative of a germline mutation or of somatic hypermethylation of its promoter that happens in sporadic CRC [42,43]. In our study, among six MSI-H CRCs, 3 tumors had isolated loss of MSH2, of whom 2 patients had a cancer onset age of less than 50 years old, and one among them had a family history of CRC. However, no loss of MLH1 or MSH6 expression was found in our MSI-H tumors. Therefore, a likely explanation for the no loss of MLH1 in our study is the higher prevalence of hereditary cancer in our population. Also, three out of six MSI-H tumors of our series of CRC showed normal nuclear expression of MLH1, MSH2 and MSH6. One possible explanation is that these false negative tumors harbor mutations in the other MMR genes, or in as yet unidentified genes that affect MMR function. Our findings support, but not confirm, the suggestions of higher prevalence of hereditary cancer in previous studies on CRC in Tunisia. Nevertheless, despite these observed differences, sporadic and hereditary MSI-H tumors cannot be truly separated into two nonoverlapping groups by the phenotype alone. In conclusion, in line with others, the present study indicates that careful observation of tumor morphology can assist in the identification of unstable colorectal cancers and may be useful to identify patients who need further analysis. We believe that the enlargement of the spectrum with these types of studies will contribute to early detection of Lynch syndrome in our population.
Conflict of interest The authors declare that they have no conflict of interest.
Acknowledgements This work was supported by the “Ministère de l’Enseignement Supérieur, de la Recherche Scientifique et Technologie” and the “Ministère de la Santé” of Tunisia.
103
References [1] J. Alexander, T. Watanabe, T.T. Wu, et al., Histopathological identification of colon cancer with microsatellite instability, Am. J. Pathol. 158 (2001) 527–535. [2] P. Benatti, R. Gafà, D. Barana, et al., Microsatellite instability and colorectal cancer prognosis, Clin. Cancer Res. 11 (2005) 8332–8340. [3] C.R. Boland, S.N. Thibodeau, S.R. Hamilton, et al., A National Cancer Institute Workshop on microsatellite instability for cancer detection and familial predisposition: development of international criteria for determination of microsatellite instability in colorectal cancer, Cancer Res. 58 (1998) 5248–5257. [4] S.C. Chang, J.K. Lin, S.H. Yang, et al., Relationship between genetic alterations and prognosis in sporadic colorectal cancer, Int. J. Cancer 118 (2006) 1721–1727. [5] S. Cottrell, D. Bicknell, L. Kaklamanis, et al., Molecular analysis of APC mutations in familial adenomatous polyposis and sporadic colon carcinomas, Lancet 340 (1992) 626–630. [6] R. Dolcetti, A. Viel, C. Doglioni, et al., High prevalence of activated intraepithelial cytotoxic T lymphocytes and increased neoplastic cell apoptosis in colorectal carcinomas with microsatellite instability, Am. J. Pathol. 154 (1990) 1805–1813. [7] R. Gafa, I. Maestri, M. Matteuzzi, et al., Sporadic colorectal adenocarcinomas with high-frequency microsatellite instability, Cancer 89 (2000) 2025–2037. [8] D.M. Graham, H.D. Appelman, Crohn’s-like lymphoid reaction and colorectal carcinoma: a potential histologic prognosticator, Mod. Pathol. 3 (1990) 332–335. [9] J.K. Greenson, J.D. Bonner, O. Ben-Yzhak, et al., Phenotype of microsatellite unstable colorectal carcinomas: well-differentiated and focally mucinous tumors and the absence of dirty necrosis correlate with microsatellite instability, Am. J. Surg. Pathol. 27 (2003) 563–570. [10] R. Gryfe, H. Kim, E.T. Hsieh, et al., Tumor microsatellite instability and clinical outcome in young patients with colorectal cancer, N. Engl. J. Med. 342 (2000) 69–77. [11] S.R. Hamilton, L.A. Aaltonen (Eds.), World Health Organisation. Classification of tumors pathology and genetics of tumors of the digestive system, IARC Press, Lyon, 2000. [12] J.G. Herman, A. Umar, K. Polyak, Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 6870–6875. [13] International Agency for Research on Cancer, Cancer Incidence, Mortality and Prevalence Worldwide in 2008 [in ligne], in: GLOBOCAN, 2008, Website: http://globocan.iarc.fr/ [14] J.R. Jass, Classification of colorectal cancer based on correlation of clinical, morphological and molecular features, Histopathology 50 (2007) 113–130. [15] J.R. Jass, K.A. Do, L.A. Simms, et al., Morphology of sporadic colorectal cancer with DNA replication errors, Gut 42 (1998) 673–679. [16] J.R. Jass, T.C. Smyrk, S.M. Stewart, et al., Pathology of hereditary non-polyposis colorectal cancer, Anticancer Res. 14 (1994) 1631–1634. [17] S.Y. Jeong, K.H. Shin, J.H. Shin, et al., Microsatellite instability and mutations in DNA mismatch repair genes in sporadic colorectal cancers, Dis. Colon Rectum 46 (2003) 1069–1077. [18] P. Jernvall, M.J. Makinen, T.J. Karttunen, et al., Microsatellite instability: impact on cancer progression in proximal and distal colorectal cancers, Eur. J. Cancer 35 (1999) 197–201. [19] H. Kim, J. Jen, B. Vogelstein, et al., Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences, Am. J. Pathol. 145 (1994) 148–156. [20] F. Ksiaa, S. Ziadi, M. Mokni, et al., The presence of JC virus in gastric carcinomas correlates with patient’s age, intestinal histological type and aberrant methylation of tumor suppressor genes, Mod. Pathol. 23 (2010) 522–530. [21] C. Lamberti, S. Lundin, M. Bogdanow, et al., Microsatellite instability did not predict individual survival of unselected patients with colorectal cancer, Int. J. Colorectal Dis. 22 (2007) 145–152. [22] R.A. Lothe, P. Peltomaki, G.I. Meling, et al., Genomic instability in colorectal cancer: relationship to clinicopathological variables and family history, Cancer Res. 53 (1993) 5849–5852. [23] H.T. Lynch, C.R. Boland, G. Gong, et al., Phenotypic and genotypic heterogeneity in the Lynch syndrome: diagnostic, surveillance and management implications, Eur. J. Hum. Genet. 14 (2006) 390–402. [24] J.M. Michael-Robinson, A. Biemer-Hüttmann, D.M. Purdie, et al., Tumor infiltrating lymphocytes and apoptosis are independent features in colorectal cancer stratified according to microsatellite instability status, Gut 48 (2001) 360–366. [25] R. Muc, R. Naidoo, Microsatellite instability in diagnostic pathology, Curr. Diagn. Pathol. 8 (2002) 318–327. [26] C.M. Ribic, D.J. Sargent, M.J. Moore, et al., Tumor microsatellite-instability status as a predictor of benefit from fluorouracil-based adjuvant chemotherapy for colon cancer, N. Engl. J. Med. 349 (2003) 247–257. [27] R.K. Saiki, S. Scharf, F. Faloona, et al., Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia, Science 20 (1985) 1350–1354. [28] S. Salahshor, U. Kressner, H. Fischer, et al., Microsatellite instability in sporadic colorectal cancer is not an independent prognostic factor, Br. J. Cancer 81 (1999) 190–193. [29] W.S. Samowitz, K. Curtin, K.N. Ma, et al., Microsatellite instability in sporadic colon cancer is associated with an improved prognosis at the population level, Cancer Epidemiol. Biomarkers Prev. 10 (2001) 917–923.
104
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
[30] M. Shashidharan, T. Smyrk, K.M. Lin, Histologic comparison of hereditary nonpolyposis colorectal cancer associated with MSH2 and MLH1 and colorectal cancer from the general population, Dis. Colon Rectum 42 (1999) 722–726. [31] S.N. Thibodeau, G. Bren, D. Schaid, Microsatellite instability in cancer of the proximal colon, Science 260 (1993) 816–819. [32] P. Thirunavukarasu, M. Sathaiah, S. Singla, Medullary carcinoma of the large intestine: a population based analysis, Int. J. Oncol. 37 (2010) 901–907. [33] M. Toyota, N. Ahuja, M. Ohe-Toyota, J.G. Herman, S.B. Baylin, J.P. Issa, CpG island methylator phenotype in colorectal cancer, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 8681–8686. [34] M.L. Veigl, L. Kasturi, J. Olechnowicz, et al., Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 8698–8702. [35] R. Ward, A. Meagher, I. Tomlinson, et al., Microsatellite instability and the clinicopathological features of sporadic colorectal cancer, Gut 48 (2001) 821–829. [36] T. Watanabe, T. Kobunai, E. Toda, et al., Distal colorectal cancers with microsatellite instability (MSI) display distinct gene expression profiles that are different from proximal MSI cancers, Cancer Res. 66 (2006) 9804–9808.
[37] B. Winn, R. Tavares, J. Fanion, et al., Differentiating the undifferentiated: immunohistochemical profile of medullary carcinoma of the colon with an emphasis on intestinal differentiation, Hum. Pathol. 40 (2009) 398–404. [38] C.M. Wright, O.F. Dent, M. Barker, et al., Prognostic significance of extensive microsatellite instability in sporadic clinicopathological stage C colorectal cancer, Br. J. Surg. 7 (2000) 1197–1202. [39] J. Young, L.A. Simms, K.G. Biden, et al., Features of colorectal cancers with high-level microsatellite instability occurring in familial and sporadic settings: parallel pathways of tumorigenesis, Am. J. Pathol. 159 (2001) 2107–2116. ´ [40] G. Kurzawski, K. Safranow, J. Suchy, D. Chlubek, R.J. Scott, J. Lubinski, Mutation analysis of MLH1 and MSH2 genes performed by denaturing high-performance liquid chromatography, J. Biochem. Biophys. Methods 51 (2002) 89–100. [41] E. Mangold, C. Pagenstecher, W. Friedl, et al., Tumours from MSH2 mutation carriers show loss of MSH2 expression but many tumours from MLH1 mutation carriers exhibit weak positive MLH1 staining, J. Pathol. 207 (2005) 385–395. [42] J.M. Cunningham, E.R. Christensen, D.J. Tester, et al., Thibodeau. Hypermethylation of the hMLH1 promoter in colon cancer with microsatellite instability, Cancer Res. 58 (1998) 3455–3460. [43] S.N. Thibodeau, A.J. French, J.M. Cunningham, et al., Microsatellite instability in colorectal cancer: different mutator phenotypes and the principal involvement of hMLH1, Cancer Res. 58 (1998) 1713–1718.
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Original Article
Clinicopathologic characteristics of colorectal cancer with microsatellite instability S. Ziadi ∗ , F. Ksiaa, R. Ben Gacem, N. Labaied, M. Mokni, M. Trimeche Department of Pathology, CHU Farhat-Hached of Sousse, 4000 Sousse, Tunisia
a r t i c l e
i n f o
Article history: Received 5 February 2013 Received in revised form 29 July 2013 Accepted 22 October 2013 Keywords: Colorectal cancer Microsatellite instability Tunisia
a b s t r a c t Colorectal cancer (CRC) can be classified according to the level of microsatellite instability (MSI) exhibited by the tumor. The aim of this study was to determine MSI status in CRC from Tunisia and to identify clinical and pathological characteristics of MSI-H tumors. Microsatellite status was determined by polymerase chain reaction amplification using standard markers (BAT25, BAT26, D2S123, D5S346 and D17S250, the Bethesda panel) in 44 CRC cases. Molecular results were correlated with pathological and clinical features. Six CRC cases (13.8%) showed high-level instability (MSI-H), 14 cases had low level instability (MSI-L), and the remainders were stable (MSS). Immunohistochemical analysis showed loss of MSH2 protein in 3 cases among the 6 MSI-H tumors, whereas no silencing of MLH1 or MSH6 was found in any case. Significant differences in age and family history of cancers were observed between MSI-H and MSS/MSI-L groups (p = 0.01 and p = 0.002). However, statistical analysis showed that there were no significant differences between MSI-H and MSS/MSI-L tumors in terms of tumor location, lymph node involvement and stage of disease. Regarding histological features, MSI-H tumors were more likely to be poorly differentiated (p = 0.003), to have a medullary pattern (p = 0.005), and to harbor increased numbers of peritumoral lymphocytes (p = 0.001). These findings indicate that careful observation of the tumor morphology can assist in the identification of unstable colorectal cancers requiring molecular investigations. © 2013 Elsevier GmbH. All rights reserved.
Introduction Colorectal cancers (CRC) are considered to belong to the most common cancers in industrialized countries. They are the third most common cancer in men after lung and prostate cancers and come second in women after breast cancer. In Tunisia, CRC have an annual incidence of 10.3/100,000 individuals. However, a significant proportion (9%) of these cancers occurs before age 40 years, suggesting genetic susceptibility [13]. The deficiency of the DNA mismatch repair (MMR) system is a major mechanism for carcinogenesis. It is involved in the development of hereditary non-polyposis colorectal cancers (HNPCC, also called Lynch syndrome) and in nearly 20% of sporadic CRC [3]. This deficiency is responsible for microsatellite instability (MSI), resulting from the accumulation of small insertions or deletions that frequently arise during replication of these short repeated sequences [25].
∗ Corresponding author at: Department of Pathology, Farhat-Hached Hospital, Sousse 4000, Tunisia. Tel.: +216 98633982; fax: +216 73226702. E-mail address: sonia [email protected] (S. Ziadi). 0344-0338/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2013.10.004
Dysfunction of MMR proteins may be related either to an alteration of a gene at the constitutional level, which is the case with Lynch syndrome mutations constitutional MMR genes (hMLH1, hMSH2, hPMS1, hPMS2 and hMSH6), or to altered gene in somatic tumor. In the latter case, it is often a loss of function of hMLH1 most often involved is its epigenetic repression by methylation of its promoter [34]. Determining the MSI phenotype by molecular biology techniques has been standardized by the international conference organized by the National Institute of Health in 1998 [3], which recommends the genotyping of five markers: three dinucleotide repeat markers (D2S123, D5S346, D17S250) and two mononucleotide repeat markers (BAT25 and BAT26) [3]. The realization of this phenotype, which compares the constitutional and tumor genome of a patient, assumes control of the histological quality of the tumor sample. Besides a fundamental interest because of the original transformation mechanism, the study of tumors with MSI instability is of great clinical interest. It has indeed been shown in several studies that tumors with MSI had several epidemiological, anatomical, histological and prognostic features [1,14,39]. The aim of the present study was to analyze in a series of CRC from Tunisia the clinico-pathological characteristics of colorectal cancers with microsatellite instability.
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
Material and methods Patients and tumor samples Patients who had undergone resection of CRC between January and December 2007 were identified from the files of the Department of Pathology, CHU Farhat-Hached of Sousse, Tunisia. Patients with history of familial adenomatous polyposis or preoperative anticancer therapy were excluded from the study. Fifty patients were retained for this study. For all of these cases, matched pairs of colorectal tumor and normal adjacent tissues were obtained as formalin-fixed, paraffin-embedded specimens. Clinical information regarding gender, age at diagnosis, location of the tumor (classified as proximal or distal in reference to the splenic flexure of colon), tumor extension according to the classification of UICC/AJCC, personal and family history of cancer, was retrieved from available hospital records for every patient. Review of tissue sections was carried out by two pathologists (MT and SZ) without knowledge of the tumor MSI status. At least three histologic hematoxylin–eosin stain slides were reviewed per case. Several histological parameters were evaluated semiquantitatively. Histological tumor type and grade were determined according to the World Health Organization classification [11]. The percentage of mucin was quantified under low power magnification; we divided our patients according to the percentage of this component into three groups: 50%. Considered as “medullary-type” cancers, a subgroup showed poor differentiation consisting of nests, trabecular, and sheets of small- to medium-sized cells with scant to abundant eosinophilic cytoplasm, frequent mitotic figures and a distinct stromal population of small lymphocytes [1,11]. We divided our patients according to the percentage of this component into three groups: 50%. Patterns of lymphocytic infiltration include the presence of intra-epithelial lymphocytes and peritumoral lymphocytes were determined. Tumor-infiltrating lymphocytes based on the finding in a hematoxylin and eosin-stained section of at least four intraepithelial lymphocytes in one field at high magnification [39]. Peritumoral lymphocytes were defined as the cuff of lymphocytes surrounding the deepest point of the advancing front of the tumor [8]. DNA extraction and ˇ-globin amplification Genomic DNA was extracted from formalin-fixed, paraffinembedded tissues samples as described previously [20]. Briefly, 2–5 sections (5 m thick) of each tissue sample were cut using a microtome and were put in a microtube containing 400 l of a lysis buffer (50 mM Tris–HCl at pH 8.5; 1 mM EDTA; 0.5% Tween 20). Then, a volume of 10 l of proteinase K, initial concentration of 10 mg/ml, was added to the reaction mixture. After incubation overnight at 56 ◦ C, the tubes were boiled for 7 min to inactivate the enzyme. To separate DNA from the other components, centrifugation at 12,000 rpm for 15 min and at 4 ◦ C was conducted, the supernatant, containing the DNA, was collected and stored at −20 ◦ C until use. The quality of the extracted DNA was assessed by polymerase chain reaction (PCR) amplifying a 268-base pairs (bp) sequence of the housekeeping gene -globin using a pair of specific primers (globinS: 5 -CAACTTCATCCACGTTCACC-3 and Gh20: 5 GAAGAGCCAAGGACAGGTAC-3 ) [27]. Samples of high-quality DNA were submitted to microsatellite instability analysis. Microsatellites analyses Microsatellite instability was assessed using the five microsatellite markers recommended by the 1997 National Cancer
99
Table 1 Primer sequences and PCR annealing temperature for the five Bethesda markers. Marker BAT25 BAT26 D2S123 D5S346 D17S250
Primer sequence (5 →3 ) TCGCCTCCAAGAATGTAAGT TCTGGATTTTAACTATGGCTC TGACTACTTTTGACTTCAGCC AACCATTCAACATTTTTAACC AAACAGGATGCCTGCCTTTA GGACTTTCCACCTATGGGAC ACTCACTCTAGTGATAAATCGGG AGCAGATAAGACAAGTATTACTAG GGAAGAATCAAATAGACAAT GCTGGCCATATATATATTTAAACC
Hybridization temperature 53 ◦ C 53 ◦ C 53 ◦ C 58 ◦ C 48 ◦ C
Institute-sponsored consensus conference in Bethesda [3]: two mononucleotide markers, single nucleotide repeats (BAT25 and BAT26) and three dinucleotide markers, repetitions of a pattern of two nucleotides (D5S346, D2S123 and D17S250). Primer sequences are given in Table 1. Optimal annealing temperatures were determined for each primer pair, and 200 ng of template DNA was amplified by PCR in a final reaction volume of 25 l containing 1 unit of Taq DNA polymerase (Promega, Madison, WI, USA), PCR buffer 1× (10 mM Tris, pH 8.3, 50 mM KCl), 0.2 mM each deoxynucleotide triphosphate (dNTP), and 2.5 mM MgCl2 , and 0.3 mM each primer. The reaction amplifications were carried out on a PTC200TM thermocycler (MJ Research, Watertown, MA, USA). Thermal cycling was performed using the following conditions: initial denaturation at 93 ◦ C for 5 min, followed by 35 cycles of 1 min at 93 ◦ C, 1 min at the specific annealing temperature (Table 1) and 1 min at 72 ◦ C. The reaction was finished with a 10-min extension at 72 ◦ C. Finally, PCR products were separated by electrophoresis in polyacrylamide mini gels using Mini-Protean 3 System (Bio-Rad, Marnes-la-Coquette, France), stained by ethidium bromide and visualized under ultra-violet light using the GelDoc2000 System (Bio-Rad). MSI was identified by the presence of novel bands in the PCR product from malignant colorectal tissue as compared with the pattern from non-malignant tissue of the same patient. Each gel was scored independently by two experienced observers (MT and RBG). If there was discordance in their interpretation, the gels were reviewed to provide a consensus result. Tumors in which none of the markers showed instability were classified as microsatellite stable (MSS). Those with a single unstable marker were classified as MSI-low (MSI-L). Tumors with two or more unstable loci were classified as MSI-high (MSI-H) [3]. Immunohistochemical staining Immunohistochemistry was performed for MSI-H cases to assess the expression of the MMR proteins: MLH1, MSH2, and MSH6. Briefly, four micron-thick sections were obtained from formalin-fixed, paraffin-embedded tissue blocks. The tissue sections were deparaffinized in toluene and rehydrated in graded concentrations of alcohol. Endogenous peroxidase activity was blocked by treating the sections with a blocking solution. For antigen retrieval, the sections were treated while boiling in citrate buffer (pH 6.0) in a microwave oven. Sections were then rinsed with Tris-buffered saline (TBS) (0.05 M Tris–HCl, 1.15 M NaCl, pH 7.6) and incubated overnight at 4 ◦ C with primary antibodies against MLH1 (Diagnostic BioSystems, clone: G168-15, dilution of 1:100), MSH2 (Diagnostic BioSystems, clone 25D12, dilution of 1:50), MSH6 (Diagnostic BioSystems, clone: 44, dilution of 1:50). After rinsing in TBS, the described antibodies were detected using the EnVision+ labeled polymer Kit (DakoCytomation) following the manufacturer’s instructions. To visualize immunoreactivity,
100
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
Fig. 1. Examples of microsatellite instability (MSI) analysis in colorectal carcinomas. The arrows indicate the presence of extra bands in the tumor (T) tissue compared to the normal (N) tissue from the same patient.
diaminobenzidine (DAB) was used, and samples were counterstained with hematoxylin and mounted. Lack of expression of one of these proteins was defined as complete absence of detectable nuclear staining in tumor cells. Intact nuclear staining of the colonic crypts of the peritumoral normal mucosa, stromal cells and lymphocytes served as an internal positive control and was required for adequate evaluation. All immunohistochemical slides were evaluated independently by two pathologists (MT and SZ). Statistical analysis Statistical analysis was performed by SPSS software. Tumors classified as MSI-L were included with MSS tumors for statistical analysis because of the reported similarity between cases with low levels of MSI and MSS [15,22]. Comparisons of the clinicopathological characteristics between patients with MSI-H tumors and MSS/MSI-L tumors were performed by the 2 or the Fisher test. P values of less than 0.05 were considered statistically significant. Results MSI detection The quality of DNA samples was checked by PCR amplification of a 268-pb fragment within the human -globin gene. The integrity of DNA samples was validated in 44 of the 50 CRC cases tested. MSI analyses were then performed for these 44 CRC cases. Of these, 24 patients (54.5%) were found to have MSS tumors, 14 patients (31.8%) had instability at one marker (MSI-L), and six patients (13.6%) had instability at two or more markers (MSI-H). Fig. 1 illustrates representative examples for MSI analysis. Table 2 presents the status of each marker. Four of the MSI-H tumors were unstable at BAT26, and one was stable at both BAT26 and BAT25 (Table 1). In contrast, the most frequently unstable marker in MSI-L tumors was D17S250. Clinicopathological characteristics of MSI-H tumors The comparison of the clinicopathological characteristics according to the MSI status was summarized in Table 3.
Table 2 Microsatellite alterations (+) in 44 colorectal carcinomas from Tunisia. Case number
BAT25
BAT26
S2D123
S5D346
S17D250
MSI status
2 8 10 40 48 49 1 5 6 11 13 17 19 23 25 27 28 33 43 45 3 7 9 12 14 15 16 18 20 21 22 24 26 30 31 32 34 36 37 38 39 44 46 47
+ – – + – + + + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
– + – + + + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
+ – + + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
+ + – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
– – + – + + – – + + + + + + + + + + + + – – – – – – – – – – – – – – – – – – – – – – – –
MSI-H MSI-H MSI-H MSI-H MSI-H MSI-H MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSI-L MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
101
Table 3 Comparison of the clinical and histological features between MSI-H and MSS/MSI-L colorectal cancers. Parameters Age at diagnosis (years) Range ≤50 50–70 >70
MSS or MSI-L (n = 38) 21–83 9 19 10
MSI-H (n = 6)
p value
38–55 5 1 0
0.01
Gender Male Female
17 21
3 3
0.82
Family history of cancer Colorectal Non-colorectal Negative
2 0 36
2 1 3
0.002
Location of tumor Proximal Distal
10 28
1 5
0.68
Depth of invasion pT1/T2 pT3/T4
2 36
1 5
0.40
Lymph node involvement Positive Negative
24 14
3 3
0.56
Visceral metastasis Positive Negative
10 28
2 4
0.72
TNM stage I/II III/IV
13 25
2 4
0.42
Tumor grade Well differentiated Moderately differentiated Poorly differentiated
26 8 4
0 5 1
0.003
Fig. 2. Colorectal carcinoma from subject with MSI-H phenotype showing medullary histological pattern (Case n◦ 8). The tumor is composed of sheets and nests of cells showing non glandular differentiation with numerous tumor-infiltrating (intraepithelial) lymphocytes (hematoxylin and eosin, original magnification ×400).
classified in stages III/IV (66.7%) and two were classified in stages I/II. The MSS/MSI-L cases had stages III/IV in 65.7% (25/38) versus 35.3% (13/38) in stages I/II. Regarding histological features, we found that MSI-H tumors were more likely to be poorly differentiated (p = 0.003), to have a medullary pattern (p = 0.005), and to harbor increased numbers of peritumoral lymphocytes (p = 0.001) (Table 3, Figs. 2 and 3). In contrast, no significant differences were found between MSI-H and MSS/MSI-L tumors according to mucinous component or intraepithelial lymphocytes. Immunohistochemical analysis of the MMR proteins
Peritumoral lymphocytes Positive Negative
7 31
3 3
0.001
Intraepithelial lymphocytes Positive Negative
1 37
1 5
0.50
Mucinous type Positive Negative
2 36
0 6
0.83
Medullary pattern Positive Negative
1 37
2 4
0.005
Immunohistochemistry for MLH1, MSH2, and MSH6 was performed for all MSI-H tumors. The results of the immunohistochemical analysis are resumed in Table 4, and representative examples of the immunostaining are presented in Fig. 4. Three cases among the six MSI-H tumors (50%) showed a complete loss of MSH2 with normal MLH1 and MSH6 staining (Cases n◦ 8, 10 and 49). Two of the three patients with tumors that were negative for MSH2 had a cancer onset age of less than 50 years old (39 and 40 years), of whom one patient (Case n◦ 10) had a family history of colorectal cancer (Table 4).
p-Values were calculated by 2 or Fisher’s exact tests (two sided) and were considered to be statistically significant for p < 0.05. Significant p-values are shown in bold.
MSI-H phenotype was found in three men and three women. Five MSI-H patients had a young age (ranging from 26 to 46 years) and three had a family history of cancer. A significant correlation was found between MSI-H phenotype and young age (≤50 years, p = 0.01) and family history of cancer (p = 0.002). Colorectal cancers having proximal location are often unstable. In our series, we did not find this association; in fact, five out of the six MSI-H tumors of our series were located in the distal colon. Statistical analysis showed that there were no significant differences between MSI-H and MSS/MSI-L tumors in terms of stage of disease. Indeed, two MSS/MSI-L tumors (5.2%) and one MSI-H tumor (16.6%) were in pT1/pT2 stage, while 36 MSS/MSI-L tumors (94.7%) and five MSI-H tumors were in pT3/pT4 (83.3%). Lymph node involvement was present in half of MSI-H tumors (3/6 cases) and in 14 MSS/MSI-L tumors (36.8%). Visceral metastases were present in two of MSI-H cases (one ovarian and one in the liver). According to the AJCC/UICC classification, four MSI-H tumors were
Fig. 3. Colorectal carcinoma from subject with MSI-H phenotype (Case n◦ 2) showing a Crohn’s like pattern characterized by a pronounced peritumoral lymphoid tissue with lymphoid follicles (hematoxylin and eosin, ×400).
102
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
Fig. 4. Immunostaining for MLH1 (panel a, ×400), MSH2 (panel b, ×200), and MSH6 (panel c, ×400) in a colorectal cancer case with high microsatellite instability (Case n◦ 8) showing extinction of the expression of MSH2 and retained expression of MLH1 and MSH6 proteins.
Table 4 Results of the immunohistochemical analysis for the three MMR proteins: MLH1, MSH2 and MSH6 in MSI-H colorectal tumors. Case number
Gender
2 8 10 40 48 49
F M F M M F
Age at diagnosis 38 39 40 45 46 55
Family history of cancer + − + + − −
Protein expression MLH1/MSH2/MSH6 +/+/+ +/−/+ +/−/+ +/+/+ +/+/+ +/−/+
F: female; M: male; +: positive; −: negative
Discussion Hereditary nonpolyposis colorectal cancer (HNPCC) is the most frequent cause of inherited colorectal cancer. It is an autosomal dominantly inherited syndrome characterized by the occurrence of early onset CRC, an excess of synchronous and metachronous CRC, as well as a defined spectrum of extracolonic tumors, particularly cancers of the endometrium, small intestine, hepato-biliary tract, upper urinary tract and stomach [23]. Most of these cases remain unknown for lack of a suitable diagnostic strategy. High-level microsatellite instability (MSI-H) is demonstrated in most cancers presenting in the inherited condition (HNPCC) and in 10–20% of sporadic colorectal cancers [3,5]. Distinction between these categories of MSI-H cancer is of clinical importance. In patients with MSI-H sporadic colorectal cancer, instability is often based on epigenetic transcriptional silencing of hMLH1 via hypermethylation of its promoter [12,34]. DNA methylation is an age-related phenomenon, and sporadic MSI-H CRC are more frequent in the elderly [33]. In this study, we analyzed the MSI status in a series of CRC from Tunisia and found a high-level of microsatellite instability (MSI-H) in 13.6% (6/44) of our cases. Several studies have analyzed the MSI status of colorectal cancer based on the same technique we used. These studies have reported varying frequencies of colorectal cancers with unstable phenotype, ranging from 9 to 27% [2,4,19,21,36]. Individuals with MSI-H tumors seem to have distinct clinical features. In this study, we found significant difference in age between MSI-H and MSS/MSI-L groups (p = 0.01). Samowitz et al. [29] reported that individuals with colorectal cancer diagnosed before the age of 55 or over the age of 70 had a higher percentage of MSI-H tumors than those between 55 and 70 years of age. Gryfe et al. [10] reported that MSI-H tumors are diagnosed at a younger age than those with MSS colorectal cancers. Other studies have found no significant difference in age at diagnosis [17,26].
Family history is considered the most useful indicator of HNPCC in individual patients in the clinical setting. In this study, the family history of cancer was correlated with the unstable phenotype (p = 0.002). Indeed, 4 of our patients had a positive family history of CRC, among them two had instability at 2 or more markers (MSI-H). Another patient had a positive family history of pancreatic cancer and had high level microsatellite instability. MSI-H tumors were generally reported more frequently in women [39], although this was not confirmed in all studies [10,38]. In this present study, there was no association between MSI-H status and gender. MSI-H tumors are more likely to be right sided [17,31,39]. This was not observed in our series. MSI-H colorectal tumors typically present with a greater depth of invasion but with a lower overall stage (as defined by the American Joint Committee on Cancer, AJCC) [9,10]. In contrast, we found that MSI-H phenotype appeared to be overrepresented in stage III and IV tumors; this association did not reach statistical significance. Lymph node metastases are less frequent in individuals with MSIH [6,10,18,22,24,28]. In our study, lymph node metastases were present in half of MSI-H colorectal cancers. Many authors agree that MSI-H carcinomas tend to be poorly differentiated [9,10,23], mucin-producing [9,35] and of the medullary type [32,37]. Frequently, there is a greater lymphoid host response (peritumoral lymphocytes and intraepithelial lymphocytes). In our study, MSI-H was significantly associated with poor differentiation (p = 0.003), medullary type (p = 0.005) and peritumoral lymphocytes (p = 0.001) when compared with the MSS/MSI-L groups. Distinguishing the phenotype of MSI-H in HNPCC as compared with sporadic colorectal cancers will help to identify which individuals are at risk of an inherited predisposition (i.e., MMR gene mutations), thereby determining whose families should undergo intensive surveillance. Several studies have tried to identify features that are more characteristic of MSI-H tumors and that can differentiate tumors from patients with HNPCC from those with sporadic CRC. Young et al. [39] reported that MSI-H in sporadic cancers represented a late onset disorder affecting a disproportionate number of women, whereas MSI-H in HNPCC was predominantly associated with younger age of presentation and a more equal gender distribution. In our study, 83% (5/6) of cases with MSI-H phenotype were younger than 50 years without sex predominance. Although HNPCC predominantly affects the proximal colon, 30–40% may present with disease in the distal colon. By comparison, approximately 80–90% MSI-H sporadic cancers occur in proximal colon [19,39]. In our work, the localization of
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
MSI-H tumors in the distal colon was more common than in the proximal colon (5 cases versus 1 case). It now appears that some of the generic morphological characteristics of MSI-H cancers are observed more frequently in HNPCC while others appear more often in sporadic MSI-H cancer. A marked mucinous component has been reported in 31–43% [7,19,35,39] of sporadic MSI-H cancer. When a mucinous phenotype was defined on the basis of any amount of secretory mucin production, this feature was present in 67% of MSI-H cancers that were mainly sporadics [9]. On the other hand, mucinous differentiation was observed in only 19% of probable HNPCC cancers [16] and in 22% [39] of subjects with a proven germline mutation. Mucin production was not significantly increased as compared with CRC from the general population [30]. In our series, only one case among the six MSIH tumors had a significant mucinous component, but he had no familial history of cancer. The presence of peritumoral lymphocyte, intraepithelial lymphocytes and a Crohn’s-like reaction was scored more frequently in HNPCC CRC, although the difference was statistically significant only for peritumoral lymphocytes [39]. In our study, three cases among the six MSI-H tumors showed a marked peri-tumoral lymphocytosis. These three patients were younger than 50 years and one of them had a family history of colorectal cancer. Furthermore, mutations in MMR genes have been proven to be closely related to the development of HNPCC cancers. In particular, MLH1 and MSH2 are thought to be the main genes responsible [40]. Germline mutations are usually responsible for the absence of MSH2 proteins [41], whereas the absence of MLH1 can be indicative of a germline mutation or of somatic hypermethylation of its promoter that happens in sporadic CRC [42,43]. In our study, among six MSI-H CRCs, 3 tumors had isolated loss of MSH2, of whom 2 patients had a cancer onset age of less than 50 years old, and one among them had a family history of CRC. However, no loss of MLH1 or MSH6 expression was found in our MSI-H tumors. Therefore, a likely explanation for the no loss of MLH1 in our study is the higher prevalence of hereditary cancer in our population. Also, three out of six MSI-H tumors of our series of CRC showed normal nuclear expression of MLH1, MSH2 and MSH6. One possible explanation is that these false negative tumors harbor mutations in the other MMR genes, or in as yet unidentified genes that affect MMR function. Our findings support, but not confirm, the suggestions of higher prevalence of hereditary cancer in previous studies on CRC in Tunisia. Nevertheless, despite these observed differences, sporadic and hereditary MSI-H tumors cannot be truly separated into two nonoverlapping groups by the phenotype alone. In conclusion, in line with others, the present study indicates that careful observation of tumor morphology can assist in the identification of unstable colorectal cancers and may be useful to identify patients who need further analysis. We believe that the enlargement of the spectrum with these types of studies will contribute to early detection of Lynch syndrome in our population.
Conflict of interest The authors declare that they have no conflict of interest.
Acknowledgements This work was supported by the “Ministère de l’Enseignement Supérieur, de la Recherche Scientifique et Technologie” and the “Ministère de la Santé” of Tunisia.
103
References [1] J. Alexander, T. Watanabe, T.T. Wu, et al., Histopathological identification of colon cancer with microsatellite instability, Am. J. Pathol. 158 (2001) 527–535. [2] P. Benatti, R. Gafà, D. Barana, et al., Microsatellite instability and colorectal cancer prognosis, Clin. Cancer Res. 11 (2005) 8332–8340. [3] C.R. Boland, S.N. Thibodeau, S.R. Hamilton, et al., A National Cancer Institute Workshop on microsatellite instability for cancer detection and familial predisposition: development of international criteria for determination of microsatellite instability in colorectal cancer, Cancer Res. 58 (1998) 5248–5257. [4] S.C. Chang, J.K. Lin, S.H. Yang, et al., Relationship between genetic alterations and prognosis in sporadic colorectal cancer, Int. J. Cancer 118 (2006) 1721–1727. [5] S. Cottrell, D. Bicknell, L. Kaklamanis, et al., Molecular analysis of APC mutations in familial adenomatous polyposis and sporadic colon carcinomas, Lancet 340 (1992) 626–630. [6] R. Dolcetti, A. Viel, C. Doglioni, et al., High prevalence of activated intraepithelial cytotoxic T lymphocytes and increased neoplastic cell apoptosis in colorectal carcinomas with microsatellite instability, Am. J. Pathol. 154 (1990) 1805–1813. [7] R. Gafa, I. Maestri, M. Matteuzzi, et al., Sporadic colorectal adenocarcinomas with high-frequency microsatellite instability, Cancer 89 (2000) 2025–2037. [8] D.M. Graham, H.D. Appelman, Crohn’s-like lymphoid reaction and colorectal carcinoma: a potential histologic prognosticator, Mod. Pathol. 3 (1990) 332–335. [9] J.K. Greenson, J.D. Bonner, O. Ben-Yzhak, et al., Phenotype of microsatellite unstable colorectal carcinomas: well-differentiated and focally mucinous tumors and the absence of dirty necrosis correlate with microsatellite instability, Am. J. Surg. Pathol. 27 (2003) 563–570. [10] R. Gryfe, H. Kim, E.T. Hsieh, et al., Tumor microsatellite instability and clinical outcome in young patients with colorectal cancer, N. Engl. J. Med. 342 (2000) 69–77. [11] S.R. Hamilton, L.A. Aaltonen (Eds.), World Health Organisation. Classification of tumors pathology and genetics of tumors of the digestive system, IARC Press, Lyon, 2000. [12] J.G. Herman, A. Umar, K. Polyak, Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 6870–6875. [13] International Agency for Research on Cancer, Cancer Incidence, Mortality and Prevalence Worldwide in 2008 [in ligne], in: GLOBOCAN, 2008, Website: http://globocan.iarc.fr/ [14] J.R. Jass, Classification of colorectal cancer based on correlation of clinical, morphological and molecular features, Histopathology 50 (2007) 113–130. [15] J.R. Jass, K.A. Do, L.A. Simms, et al., Morphology of sporadic colorectal cancer with DNA replication errors, Gut 42 (1998) 673–679. [16] J.R. Jass, T.C. Smyrk, S.M. Stewart, et al., Pathology of hereditary non-polyposis colorectal cancer, Anticancer Res. 14 (1994) 1631–1634. [17] S.Y. Jeong, K.H. Shin, J.H. Shin, et al., Microsatellite instability and mutations in DNA mismatch repair genes in sporadic colorectal cancers, Dis. Colon Rectum 46 (2003) 1069–1077. [18] P. Jernvall, M.J. Makinen, T.J. Karttunen, et al., Microsatellite instability: impact on cancer progression in proximal and distal colorectal cancers, Eur. J. Cancer 35 (1999) 197–201. [19] H. Kim, J. Jen, B. Vogelstein, et al., Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences, Am. J. Pathol. 145 (1994) 148–156. [20] F. Ksiaa, S. Ziadi, M. Mokni, et al., The presence of JC virus in gastric carcinomas correlates with patient’s age, intestinal histological type and aberrant methylation of tumor suppressor genes, Mod. Pathol. 23 (2010) 522–530. [21] C. Lamberti, S. Lundin, M. Bogdanow, et al., Microsatellite instability did not predict individual survival of unselected patients with colorectal cancer, Int. J. Colorectal Dis. 22 (2007) 145–152. [22] R.A. Lothe, P. Peltomaki, G.I. Meling, et al., Genomic instability in colorectal cancer: relationship to clinicopathological variables and family history, Cancer Res. 53 (1993) 5849–5852. [23] H.T. Lynch, C.R. Boland, G. Gong, et al., Phenotypic and genotypic heterogeneity in the Lynch syndrome: diagnostic, surveillance and management implications, Eur. J. Hum. Genet. 14 (2006) 390–402. [24] J.M. Michael-Robinson, A. Biemer-Hüttmann, D.M. Purdie, et al., Tumor infiltrating lymphocytes and apoptosis are independent features in colorectal cancer stratified according to microsatellite instability status, Gut 48 (2001) 360–366. [25] R. Muc, R. Naidoo, Microsatellite instability in diagnostic pathology, Curr. Diagn. Pathol. 8 (2002) 318–327. [26] C.M. Ribic, D.J. Sargent, M.J. Moore, et al., Tumor microsatellite-instability status as a predictor of benefit from fluorouracil-based adjuvant chemotherapy for colon cancer, N. Engl. J. Med. 349 (2003) 247–257. [27] R.K. Saiki, S. Scharf, F. Faloona, et al., Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia, Science 20 (1985) 1350–1354. [28] S. Salahshor, U. Kressner, H. Fischer, et al., Microsatellite instability in sporadic colorectal cancer is not an independent prognostic factor, Br. J. Cancer 81 (1999) 190–193. [29] W.S. Samowitz, K. Curtin, K.N. Ma, et al., Microsatellite instability in sporadic colon cancer is associated with an improved prognosis at the population level, Cancer Epidemiol. Biomarkers Prev. 10 (2001) 917–923.
104
S. Ziadi et al. / Pathology – Research and Practice 210 (2014) 98–104
[30] M. Shashidharan, T. Smyrk, K.M. Lin, Histologic comparison of hereditary nonpolyposis colorectal cancer associated with MSH2 and MLH1 and colorectal cancer from the general population, Dis. Colon Rectum 42 (1999) 722–726. [31] S.N. Thibodeau, G. Bren, D. Schaid, Microsatellite instability in cancer of the proximal colon, Science 260 (1993) 816–819. [32] P. Thirunavukarasu, M. Sathaiah, S. Singla, Medullary carcinoma of the large intestine: a population based analysis, Int. J. Oncol. 37 (2010) 901–907. [33] M. Toyota, N. Ahuja, M. Ohe-Toyota, J.G. Herman, S.B. Baylin, J.P. Issa, CpG island methylator phenotype in colorectal cancer, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 8681–8686. [34] M.L. Veigl, L. Kasturi, J. Olechnowicz, et al., Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 8698–8702. [35] R. Ward, A. Meagher, I. Tomlinson, et al., Microsatellite instability and the clinicopathological features of sporadic colorectal cancer, Gut 48 (2001) 821–829. [36] T. Watanabe, T. Kobunai, E. Toda, et al., Distal colorectal cancers with microsatellite instability (MSI) display distinct gene expression profiles that are different from proximal MSI cancers, Cancer Res. 66 (2006) 9804–9808.
[37] B. Winn, R. Tavares, J. Fanion, et al., Differentiating the undifferentiated: immunohistochemical profile of medullary carcinoma of the colon with an emphasis on intestinal differentiation, Hum. Pathol. 40 (2009) 398–404. [38] C.M. Wright, O.F. Dent, M. Barker, et al., Prognostic significance of extensive microsatellite instability in sporadic clinicopathological stage C colorectal cancer, Br. J. Surg. 7 (2000) 1197–1202. [39] J. Young, L.A. Simms, K.G. Biden, et al., Features of colorectal cancers with high-level microsatellite instability occurring in familial and sporadic settings: parallel pathways of tumorigenesis, Am. J. Pathol. 159 (2001) 2107–2116. ´ [40] G. Kurzawski, K. Safranow, J. Suchy, D. Chlubek, R.J. Scott, J. Lubinski, Mutation analysis of MLH1 and MSH2 genes performed by denaturing high-performance liquid chromatography, J. Biochem. Biophys. Methods 51 (2002) 89–100. [41] E. Mangold, C. Pagenstecher, W. Friedl, et al., Tumours from MSH2 mutation carriers show loss of MSH2 expression but many tumours from MLH1 mutation carriers exhibit weak positive MLH1 staining, J. Pathol. 207 (2005) 385–395. [42] J.M. Cunningham, E.R. Christensen, D.J. Tester, et al., Thibodeau. Hypermethylation of the hMLH1 promoter in colon cancer with microsatellite instability, Cancer Res. 58 (1998) 3455–3460. [43] S.N. Thibodeau, A.J. French, J.M. Cunningham, et al., Microsatellite instability in colorectal cancer: different mutator phenotypes and the principal involvement of hMLH1, Cancer Res. 58 (1998) 1713–1718.
