Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10419
RESEARCH ARTICLE
Clinorotation impacts root apex respiration and the ultrastructure of mitochondria Vasyl Brykov* and Elizabeth Kordyum Department of Cell Biology and Anatomy, M.G. Kholodny Institute of Botany of the National Academy of Sciences of Ukraine, Kyiv, Ukraine
Abstract Mitochondrial respiration in plants provides energy for biosynthesis, and its balance with photosynthesis determines the rate of plant biomass accumulation. However, there are very limited data on the influence of altered gravity on the functional status of plant mitochondria. We present the results of our investigations of root respiration, the mitochondrion ultrastructure, and AOX expression of pea 1-, 3- and 5-day-old seedlings grown under slow horizontal clinorotation by using an inhibitor analysis, electron microscopy, and quantitative real-time RT-PCR. It was shown for the first time that enhancement of the respiration rate in root apices of pea etiolated seedlings at the 5th day of clinorotation is not connected with increasing of both alternative oxidize capacity and AOX expression. We assumed this phenomenon is provided by more intensive oxidation of respiratory substrates. At the structural level, mitochondria in cells of the distal elongation zone were the most sensitive to clinorotation, which confirms the special physiological status of this zone. The performed investigation revealed a sufficient resistance of plant mitochondria to the influence of altered gravity that, in our opinion, is one of components providing plant adaptation to microgravity in space flight. Keywords: AOX expression; clinorotation; mitochondria; mitochondrial ultrastructure; Pisum sativum; respiration
Introduction Plants are considered as the irreplaceable component of Bioregenerative Life Support Systems (as a part of CELSS) in long-term space missions as far as they are sources of oxygen and food for crew, CO2 absorbers, regenerators of water through participation in recycling of organic wastes, and also green design for astronauts’ psychological comfort. Results of the space flight experiments aboard space shuttles and orbital stations clearly show that although microgravity is an unusual factor for plants, they can grow and develop during space flight from seed-to-seed under more-or-less optimal conditions for plant growth (Wolff et al., 2012; Kittang et al., 2014; Kordyum, 2014). These data allow us to study the state of plant structure and functions in microgravity that is necessary to predict the total amount of plant productivity, that is, green mass accumulation and seed crop. It is generally accepted that decreased convection in microgravity disturbs gas exchange between the environment and plant surface that defines a question on cell metabolism energy
supply more clearly (Musgrave et al., 1998; Liao et al., 2004). In aerobic respiration, mitochondria carry out the final steps of this process and generate the bulk of the ATP through oxidative phosphorylation, driven by oxidation of organic acids. At present, there are available data on the structural and functional characteristics of chloroplasts in algae and higher plants in real microgravity in space flight and in simulated microgravity (clinorotation) (Tripathy et al., 1996; Kochubey et al., 2004; Stutte et al., 2006). Unfortunately, less attention has been paid to mitochondrial respiration in altered gravity (Brykov, 2011). Mitochondrial respiration in plants provides energy for biosynthesis, and its balance with photosynthesis determines the rate of plant biomass accumulation (Millar et al., 2011). A distinctive feature of plant mitochondrial respiration is known to be the presence of alternative oxidase (AOX) that is a non-energy conserving terminal oxidase in the plant mitochondrial electron transport chain. It is encoded by the AOX genes and it is now often used as a general marker of mitochondrial dysfunction and/or cellular oxidative stress (Vanlerberghe,
Corresponding author: e-mail: [email protected] Abbreviations: AP, alternative pathway; AOX, alternative oxidase; CEZ, central elongation zone; CP, cytochrome pathway; DEZ, distal elongation zone; SHAM, salicylhydroxamic acid
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
475
Mitochondria under clinorotation
2013). Abiotic and biotic stresses are known to elevate AOX1 expression, supporting the idea that such stresses impact mitochondrial functions, and that AOX level might represent an important acclimation response (Vanlerberghe, 2013). Therefore, the aim of our work was to study the state of respiration and alternative oxidase, as well as the ultrastructure of mitochondria in root apex cells of pea etiolated seedlings under clinorotation. Materials and methods
Plant growth Sugar pea (Pisum sativum L.) seeds cv. Alfa were preliminarily soaked in distillate water blowing air in 8–10 h. Swollen seeds of the same size were selected and wrapped up in tubes from filter paper of 9 cm in height. Tubes with seeds were put into containers which were placed on a slow horizontal clinostat (2 rpm). Seedlings grew up to 5 days in the stationary conditions and under clinorotation in darkness at the temperature 24 1 С. Paper tubes were moistened with 0.5 mL of water every 24 h. 1-, 3- and 5-dayold seedlings were collected for testing.
Tissue respiration Oxygen consumption by root apices of 6 mm in length was measured using Clark-type electrodes (Hansatech Oxygraph, UK). For every measurement, seven root apices of total mass 10–15 mg were placed in a cell with 1.5 mL of distillate water. Measurements of oxygen uptake were carried out at 24 С during 12–15 min, beginning from the 2nd min, when respiration had a linear rate. The total rate of oxygen consumption (Vt) by a tissue was determined in the absence of inhibitors. The alternative pathway (AP) capacity was determined as a difference between O2 consumption in the presence of 3 mM КCN and residual respiration in the presence of КCN and 3 mM salicylhydroxamic acid (SHAM). The cytochrome pathway (CP) capacity was defined as a difference between oxygen consumption in the presence of 3 mM SHAM and residual respiration. In all measurements, the level of residual respiration was about 4% and it is not significantly different between the control and clinorotating root samples. Concentrations of KCN and SHAM had no apparent side effect in our system and produced maximal inhibition, as indicated by titration curves using different concentrations of each inhibitor in the presence and absence of the other (Mùller et al., 1988).
Quantitative real-time RT-PCR (qPCR) AOX expression was determined in whole roots, root apices (6 mm), and in the mature root zone (1 cm from beginning 476
V. Brykov and E. Kordyum
root hair growth) of 5-day-old seedlings. Each root was quickly examined under a microscope and corresponding root parts were cut off. Total RNA was isolated using InnuPREP Plant RNA Kit (Analytikjena) as described in the manufacturer’s protocol and quantified by spectrophotometry. RNA integrity was verified by agarose gel electrophoresis under denaturing conditions and by spectrophotometric assessment of the 260/280 nm ratio. First strand cDNA synthesis was performed using 1 mg of total RNA pre-treated with DNase I (Thermo Scientific) using oligo-(dT)18 primers and the Maxima H Minus Reverse Transcriptase (Thermo Scientific) according to the manufacturer’s instructions. RT-qPCR reactions were performed by using primers specific for pea AOX in a Maxima SYBR Green qPCR Master Mix (Thermo Scientific). The ACTIN3 housekeeping gene was used as an internal control. AOX nucleotide sequences for pea have been taken from Małecka et al. (2009). Primer sequences were designed with NCBI ESTs by using Vector NTI Oligo Design tool (ACTIN3: F – CCAAATCATGTTTGAGGCTTTTAA, R – GTGAAAGAACGGCCTGAATAGC; AOX: F –AGGTAACCAACCATACGG, R – TAAGGCGTTGCTAGAAGA). Primer specificity and the formation of primer dimers were controlled by both melting curve analysis and agarose gel electrophoresis. Primer concentrations were optimized and amplification efficiency was tested by relative standard curves, while specificity of the RT-qPCR amplification was confirmed by melting curve analysis of each single reaction. The real-time PCR was performed in a 25 mL reaction mixture using an iCycler iQ system (Bio-Rad). The following program was applied: initial denaturation: 95 C, 10 min; followed by 40 cycles at 94 C, 20 s; 61 C, 30 s; 72 C, 30 s. Relative expression was calculated based on qPCR efficiency (e) and the threshold values difference (DCt) between treated and control samples for both target and reference genes according to the mathematical model previously described by Pfaffl (2001). All calculations were made based on Ct values of 5-day-old seedlings from each experimental group. No reverse transcriptase and no template controls were included in each qPCR run. All experiments were performed in two biological replicates and two technical replicates.
Electron microscopy Root apices were fixed in 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.2, for 2 h at room temperature, postfixed with 1% OsO4 in the same buffer for 2 h at 4 C, dehydrated in graded ethanol series, then in acetone and afterwards embedded in the epon-araldit mixture. Ultrathin sections were cut on the MT-XL (RMC) ultramicrotome, stained with uranyl acetate and lead citrate (Reynolds, 1963) and examined with transmission Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
electron microscopes JEM 1200EX and JEM 1230EX (JEOL) at 80 kV. To study the ultrastructure of mitochondria in meristem cells and in cells of the distal elongation zone (DEZ), the central elongation zone (CEZ), and the mature zone it was necessary to identify clearly root growth zones before obtaining the ultrathin sections, as the sizes of these zones could vary in different roots. With this end, we examined preliminarily the anatomical structure of every root apex at the medial semi-thin sections. The sites for preparation of ultrathin sections were defined on a cell size and shape, the nucleus location, and a degree of cell vacuolization. Morphometry was done with Image Tool 3.0 (Uthscsa). The significance of differences between mean values was determined by a non-parametric Mann–Whitney U test for sizes of mitochondria and by t-test for dates on crista relative volume. Differences at P 0.05 were considered significant. Results
Tissue respiration and AOX expression In the control, the respiration rate of root apices increased during seedling growth and it was on 27% more in 5-day-old seedlings in comparison with that in 1-day-old ones. KCN and SHAM application showed a high sensitivity of the investigated tissue to inhibitors of mitochondrion respiration. The residual respiration level in root apices of unevenaged seedlings did not exceed 4% in the stationary control and after clinorotation that means respiration rate of root apices characterizes namely mitochondrial respiration and represents general functioning of both terminal oxidases. Age-specific changes in respiration of root apices during seedling growth were revealed in the stationary control. The sensitivity of root apices to KCN revealed in CP capacity
Mitochondria under clinorotation
increasing on 20% (Figure 1A). In addition, AP capacity decreased significantly on 60%, from 294 94.2 to 118 53.1 nmol О2 min 1 g 1, and it was only 12% from Vt at the 5th day. Thus, an inhibitory analysis showed that increased respiration of root apices was caused by an increase in the CP capacity that is effective in relation to energy accumulation. It is evidence of significant intensification of energetic metabolism in root cells during seedling growth in the stationary control. Dynamics of changes in root apex respiration during seedling growth under clinorotation were similar to that in the control (Figure 1B). The respiration rate increased on 35% at the 5th day of seedling growth and was 981 100.3 nmol O2 min 1 g 1; it was 772 105.8 nmol O2 min 1 g 1 in 1-day-old seedlings. Such respiration promoting coincided with the increased CP capacity on 28%, the AP capacity significantly reduced on 55%. Simultaneously, a respiration rate of root apices was rather higher under clinorotation. In 5-day-old seedlings, it exceeded the control level on 7%. Although CP capacity and AP capacity were also higher under clinorotation, they were not statistically significant. Conservation of oxygen consumption age dynamics by root apices under clinorotation may indicate a high resistance of mitochondrial respiration to the influence of altered gravity during seedling growth. The relative level of AOX expression in whole roots, root apices and mature zones was similar in the control and under clinorotation (Figure 2).
Mitochondrial ultrastructure It was shown the ultrustructure of mitochondria changes significantly in root cortex cells in the radial direction, from peripheral to inner layers (data not shown). Therefore, we investigated the ultrastructure of mitochondria in the 2nd
Figure 1 Age-related changes of total rate of respiration (Vt), CP capacity (Vcyt) and AP capacity (Valt) in pea root apices growing during 5 days in stationary control and under clinorotation. Values are means SD of 8–46 replicates. FW – fresh weight.
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
477
Mitochondria under clinorotation
Figure 2 Expression of AOX in etiolated roots of 5-day-old pea seedlings in stationary control and under clinorotation. Error bars on RT-qPCR results represent standard deviations.
and 3rd cortex surface layers. General peculiarities of the changes in the mitochondrion ultrastucture in the direction from the root apical meristem to the mature zone in the control and under clinorotation have been established (Figure 3). In meristematic cells, a mitochondrion population is always polymorphous. Along with mitochondria of an oval or rounded shape there are elongated, sometimes branched or dumb-bell shaped organelles. Mitochondria in meristematic cells often contact with each other. Membranes of mitochondrial envelopes and cristae have a lower electron density, in comparison with the surrounding hyaloplasm (Figure 3). Such mitochondrion ultrastructure is supposed to be connected with their highly active growth in rapidly fission meristematic cells. The given idea is confirmed with the smaller sizes of mitochondria in meristematic cells then in cells of the DEZ (Figure 4A). In addition, the high level of mitochondrial protein gene transcription, which is characteristic for root meristem cells, is gradually reduced in the direction of the mature zone (Li et al., 1996). Cell transition to growth by elongation is also accompanied by decreasing the polymorphism of a mitochondrial population. In the DEZ, large elongated organelles are found but their quantity is less than in meristematic cells. In the CEZ, such organelles are very rarely observed. Membranes of mitochondrial cristae become more distinct in comparison with those in meristematic cells, they gain increased osmiophility; in contrast, a matrix loses electron density (Figure 3). A root cell enlargement from the meristem to the CEZ is accompanied by increasing size of mitochondria, which is the most expressed in 5-day-old seedlings (Figure 4A). In the same time, a ratio of the crista area to organelle area (relative area of cristae) remains constant (Figure 5A). The obtained data show that increasing of the mitochondrial matrix 478
V. Brykov and E. Kordyum
volume and crista area occurs during root cell elongation and differentiation. Formation of mitochondrial metabolic system is known to occur during root cell differentiation, that is expressed in straightened respiration due to the high requirement for respiratory energy for biosynthetic and uptake processes, as this is a major factor regulating the rate of respiration (Khavkin, 1977; Lambers et al., 2002). Mitochondria in cells of different root growth zones revealed different sensitivity to the influence of clinorotation. The mitochondrion ultrastructure in meristematic cells under clinorotation was similar to that in control cells. Meristematic cell transition from division to slow elongation in the DEZ under clinorotation, unlike control, is accompanied by the following rearrangements of the mitochondrion ultrastructure: 1) decreasing the population polymorphism, 2) decreasing an organelle size (Figure 4B), 3) crista widening, increasing a ratio of the crista area to matrix area (Figure 3 and 5B), and 5) increasing the matrix electron density. In rapidly growing cells of the CEZ, the mitochondrion ultrastructure under clinorotation was more or less similar with that in the control. Changes in the mitochondrion ultrastructure in cells of the DEZ under clinorotation may be characterized as moderated condensation of organelles (Figure 3). A degree of organelle condensation depends on the time of clinorotation. Mitochondria in cells of the DEZ had the more matrix density in comparison with that in meristematic cells. A relative crista area increased on 28% under 3-day clinorotation, and on 35% under 5-day clinorotation (Figure 5B), which indicates the active nature of mitochondrion condensation process in cells of the DEZ. In addition, the size of mitochondria was smaller than in the CEZ and mature zone (Figure 6), whereas the crista shape and distribution as well as matrix density hardly changed in comparison with control (Figure 3). We may assume that organelle condensation in the DEZ has a reversible physiological character and may connect with the changes in the functional load of mitochondria in cells of the DEZ. Thus, the obtained data confirmed a special physiological role of the DEZ in root development and formation of its metabolic systems. Responses of DEZ cells to various exogenous and endogenous signals such as auxin, mechanical impedance, electrotropic stimulation and gravity differ from CEZ cell reaction, and even they can be opposite (Ishikawa and Evans, 1995). It is generally assumed that actively metabolizing cells in the DEZ undergo the most rearrangements under the changes in a cell differentiation rate in microgravity (Kordyum, 1997). Discussion It necessary to note again that available, very limited, data on the mitochondrion ultrastructure in microgravity are contradictory. There were no differences in the mitochondrion Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
Mitochondria under clinorotation
Figure 3 Fragments of 1-, 3- and 5-day-old pea root meristem (A, D, G, J, M, Q), DEZ (B, E, H, K, N, R), CEZ (C, F, I, L, O, S) and mature zone (P, T) cells with mitochondria in stationary control (A–C, G–I, M–P) and after clinorotation (D–F, J–L, Q–T). Bar – 0.1 mm.
ultrastructure in root meristematic cells of Zea mays seedlings grown on board the biosatellite Cosmos 1514 (Tairbekov, 1979), and Beta vulgaris seedlings under clinorotation (Kordium et al., 2008). Unlike these data, the presence of swollen mitochondria in root meristematic cells of Avena sativa and Vigna radiata seedlings has been reported in microgravity (Slocum et al., 1984), although the Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
absence of statistical information makes it impossible to draw definite conclusions on mitochondrion structural rearrangements in the last experiment. In the same time, an increased electron density of the mitochondrial matrix and more crista quantity, as well as major heterogeneity of a mitochondrion population, were described in root meristematic cells of pea seedlings grown on board the orbital 479
Mitochondria under clinorotation
V. Brykov and E. Kordyum
Figure 4 Changes in a size of mitochondria in cortex cells of root growth zones of pea 1-, 3- and 5-day-old seedlings grown in stationary control (A) and under clinorotation (B). The box plot shows the median, 25% – quartile, 75% – quartile, spreads – minimal and maximal values. Point values above 1 mm2 were ignored. Significant differences (P < 0.05) are denoted by the same labels.
station Salyut (Sytnik et al., 1984). These results should be interpreted with caution due to the difficulty of discrimination between microgravity effects and plant responses to environmental stress (Stutte et al., 2006; Wolff et al., 2012). Root tissue histogenesis is not disturbed in altered gravity but this process accelerates. It was repeatedly shown that linear sizes of both root apical meristem and elongation zone decrease in altered gravity (Kordyum, 1997) resulting in the location of the mature zone with root hairs at a shorter distance from a root apex. Shortening the period of a root apical meristem activity leads to earlier removal of apical dominance that stimulates intensive development of lateral roots (Halstead and Dutcher, 1987; Kordyum, 1997). Our data on the increased respiration rate in pea seedling roots under clinorotation coincide with the information on
increasing the oxygen consumption by unicellular green alga Chlorella vulgaris at the all phases of its growth under clinorotation simultaneously with an increased size of mitochondria (Sytnik and Popova, 1998). In the authors’ opinion, described structural and functional changes in mitochondria indicate increasing a metabolic activity of organelles, as well as increasing the cell expenditure of energy in general, that is considered as an adaptive response to microgravity action (Sytnik and Popova, 1998; Popova, 2003). However, direct interpolation of these data on mitochondrion functioning in specialized tissues of higher plants is limited. We have already noted an increase in the total rate of oxygen consumption in root apices of 5-day-old seedlings on 7% under clinorotation in comparison with the control. This
Figure 5 A relative volume of mitochondrial cristae in pea root growth zones of 1-, 3-, 5-day-old pea seedlings in stationary control (A) and after clinorotation (B). Values are means SD of 27–75 replicates. Significant differences (P < 0.05) are denoted by the same labels.
480
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
Figure 6 The size of mitochondria in the meristem, DEZ, CEZ, and mature zone of 5-day-old pea roots in control and clinorotation. The box plot shows the median, 25% – quartile, 75% – quartile, spreads – minimal and maximal values. Point values above 1 mm2 were ignored. Significant differences (P < 0.05) are denoted by the same labels.
might be connected with the AOX activation as it is considered as the marker of mitochondrion stress-reactions on different unfavourable abiotic factors (Van Aken et al., 2009; Rasmusson and Mùller, 2011). AOX activation was known to reduce the ATP yield by uncoupling of oxidation and phosphorylation processes (Van Aken et al., 2009; Rasmusson and Mùller, 2011). But there were no changes in AOX expression level in pea 5-day-old seedlings under clinorotation. In addition, earlier it has been shown that clinorotation did not affect the respiratory control ratio in the mitochondrial fraction isolated from pee seedling roots; that is, simulated microgravity does not lead to uncoupling the oxidative phosphorylation (Brykov et al., 2012). So, we for the first time showed that increasing the oxygen consumption intensity in plant tissues under clinorotation was not connected with increasing of capacity of stressinduced AOX and AOX expression. The data on AP capacity, which have been obtained by an inhibitory analysis, are not evidence of the allocation of respiratory electrons and consequently of a share of alternative way in respiration in vivo (Day et al., 1996). At that time, sensitivity of root apices to cyanide significantly increased with seedling age: in 5-day-old seedling, AP capacity decreased by 40–45% in control and under clinorotation. Taking into account that a seedling respiration rate increased by 30% approximately at the 5th day, a maximal possible share of the alternative way in respiration was 7–10%. The obtained data show an increased role of the CP in respiration of root apices during 5 days of seedling growth that is accompanied with energetic metabolism intensification in control and under clinorotation similarly. Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
Mitochondria under clinorotation
Thus, it was shown a high resistance of integral indices of the mitochondrion structural and functional organization in root apices under clinorotation. At the same time, the study of metabolic activity of mitochondria, which were isolated from 5-day-old seedling roots, under oxidation of different respiratory substrates revealed certain changes in organelle functioning under clinorotation (Brykov et al., 2012). Oxidative activity of isolated mitochondria in the active phosphorilative state 3 under oxidation of both malate and exogenous NADH has a tendency to increase under clinorotation that may explain the enhancement of respiration at the tissue level described earlier. However, it is assumed, that such activation of oxidative metabolism does not lead to more accumulation of ATP molecules in comparison with control but it occurs in a response on the reduction of phosphorylation effectiveness, that is, ADP/ O ratio under oxidation of different substrates (Brykov et al., 2012). It is supposed the observed changes are consisted not in the general stimulation of the oxidative activity of mitochondria and increasing ATP output, but in the regulation of the mitochondrial electron transport chain (Brykov et al., 2012). This assumption requires the straight measurement of the supply of energy level in root elongating and mature cells, as functioning of mitochondria in vivo more depend on the adenylate control (АTP/ADP), the level of both sugars and glycolysis intensity, and O2 supply. All these factors are important to provide respiratory metabolism and maintain energetic homeostasis in root cells not only in the stationary growth conditions but, in our opinion, to a greater degree for successful functioning of mitochondria in space flight. In some space flight experiments with plants, it has been reported that mitochondria are in the hypoxia conditions (Porterfield, 2002; Liao et al., 2004; Paul et al., 2013). Activation of both glycolysis and synthesis of alcohol dehydrogenase occurs, and the level of this enzyme increases significantly in a developed root system (Stout et al., 2001). Hypoxia in root tissues may arise as a result of biophysical limitations in oxygen accessibility in plants in the microgravity conditions. Data, obtained by us, indicate an oxygen increasing requirement by root apices under clinorotation and, thus, they confirm the necessity of substrate aeration in space greenhouses to provide normal respiratory metabolism in plants. On our opinion, metabolic and structural changes in mitochondria under clinorotation are responses to the requirement of higher energy expenditures under the influence of altered gravity that is an unfamiliar factor for terrestrial organisms. Nevertheless, the chronic effect of microgravity does not prevent the development of adaptive reactions at the cellular level. The cell’s energy system is highly sensitive to environmental fluctuations which cause changes in cell metabolism, including activation of anabolic 481
Mitochondria under clinorotation
and catabolic processes. Earlier data on changes in lipid and carbohydrate metabolism in 24-day-old pea plants grown on board the orbital station Salyut and tested biochemically (Laurinavichius et al., 1984) were recently confirmed by data on altered expression of genes involved in carbon and lipid metabolism in Arabidopsis thaliana cell cultures under clinorotation (Wang et al., 2006) and seedlings in real microgravity (STS-131; Blancaflor et al., 2012). In the latter study, many genes encoding lipid signaling proteins were down-regulated. So, we have reason to assume that metabolism changes in microgravity because mitochondrion modifications are necessary to provide a cell enough energy under these new conditions. Conclusions Investigations of the structural and functional organization of mitochondria in pea seedling roots grown during five days in the stationary conditions and under slow horizontal clinorotation allowed us to conclude that mitochondria provide respiratory metabolism and maintain energetic homeostasis of root cells under clinorotation. Mitochondria in cells of the distal elongation zone are the most sensitive to the influence of simulated microgravity that confirms a special physiological role of the DEZ in root development and formation of its metabolic systems. Alternative oxidase does not participate in the maintenance of cellular energetic homeostasis under clinorotation that is demonstrated by an inhibitor analysis and indirectly by unchanged AOX expression under clinorotation. The utmost respiration rate of root apices under clinorotation, especially at the 5th day of clinorotation, exceeding that in the control on 7%, is connected with more intensive oxidation of respiratory substrates. At the structural level, mitochondria in cells of the distal elongation zone were the most sensitive to clinorotation that confirms the special physiological status of this zone. The performed investigation revealed a sufficient resistance of plant mitochondria to the influence of altered gravity that, in our opinion, is one of components providing plant adaptation to microgravity in space flight. Acknowledgement This study was supported by the grant 0113U002583 of the National Academy of Sciences of Ukraine. References Blancaflor EB, Sparks JA, Nakashima J, Tang Y (2012) Microgravity research on STS-131: transcript profiling of space-grown Arabidopsis seedlings uncover novel regulators of root development. ISLSWG Satellite Workshop to the Plant Biology Congress 24.
482
V. Brykov and E. Kordyum
Brykov VO (2011) Clinorotation affects the ultrastructure of pea root mitochondria. Micrograv Sci Technol 23: 215–19. Brykov VO, Shugaev AG, Generozova IP (2012) Ultrastructure and metabolic activity of pea mitochondria under clinorotation. Cyt Gen 46: 144–49. Day DA, Krab K, Lambers H, Moore AL, Siedow JN, Wagner AM, Wiskich JT (1996) The cyanide-resistant oxidase: to inhibit or not to inhibit, that is the question. Plant Physiol 110: 1–2. Halstead TW, Dutcher FR (1987) Plant in space. Annu Rev Plant Physiol 38: 317–45. Ishikawa H, Evans ML (1995) Specialized zones of development in roots. Plant Physiol 109: 725–27. Khavkin EE (1977) Formation of metabolic systems in growing plant cells. Novosibirsk: Nauka (in Russian). Kittang A-I, Iversen T-H, Fossum KR, Mazars C, Carnero-Diaz E, Boucheron-Dubuisson E, Disquet Ile, Legu V, Herranz R, Pereda-Loth V, Medina FJ (2014) Exploration of plant growth and development using the European Modular Cultivation System facility on the International Space Station. Plant Biol 16: 528–38. Kochubey SM, Adamchuk NI, Kordyum EL, Guikema JA (2004) Microgravity effects the photosynthetic apparatus of Brassica rapa L. Plant Biosystems 138: 1–9. Kordyum EL (1997) Biology of plant cell microgravity and under clinostating. Int Rev Cytol 171: 1–72. Kordium EL, Martyn GI, Ovcharenko IuV (2008) The growth and differentiation of root cap columella cells and the proper root grown in the stationary conditions and under clinorotation. Tsitol Genet 42: 3–12. Kordyum EL (2014) Plant cell gravisensitivity and adaptation to microgravity. Plant Biol 16(Suppl 1): 79–90. Lambers H, Atkin OK, Millenaar FF (2002) Respiratory patterns in roots in relation to their functioning. In: Waisel Y, Eshel A, Kafakki V eds. Plant roots: the hidden half. New York: Marcel Dekker, pp. 521–52. Laurinavichius RS, Yaroschus AV, Marchukajtis A (1984) Metabolism of pea plants grown under space flight conditions. In: Dubinin NP ed. Biologicheskii issledovaniya na orbitalnikh stanziyakh salyut. Moskow: Nauka, pp. 96–102 (in Russian). Li XQ, Zhang M, Brown GG (1996) Cell-specific expression of mitochondrial transcripts in maize seedlings. Plant Cell 8: 1961–75. Liao J, Liu G, Monje O, Stutte GW, Porterfield DM (2004) Induction of hypoxic root metabolism results from physical limitations in O2 bioavailability in microgravity. Adv Space Res 34: 1579–84. Małecka A, Derba-Maceluch M, Kaczorowska K, Piechalak A, Tomaszewska B (2009) Reactive oxygen species production and antioxidative defense system in pea root tissues treated with lead ions: mitochondrial and peroxisomal level. Acta Physiol Plant 31: 1065–75. Millar AH, Whelan J, Soole KL, Day DA (2011) Organization and regulation of mitochondrial respiration in plants. Annu Rev Plant Biol 62: 79–104.
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
Musgrave ME, Kuang A, Brown CS, Matthews SW (1998) Changes in arabidopsis leaf ultrastructure, chlorophyll and carbohydrate content during space flight depend on ventilation. Ann Bot 81: 503–12. Mùller IM, Berczi A, van der Plas LHW, Lambers H (1988) Measurement of the activity and capacity of the alternative pathway in intact plant tissues: identification of problems and possible solutions. Physiol Plant 72: 642–49. Paul A-L, Wheeler RM, Levine HG, Ferl RJ (2013) Fundamental plant biology enabled by the space shuttle. Am J Bot 100: 226–34. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45. Popova AF (2003) Comparative characteristic of mitochondria ultrastructural organization in Chlorella cells under altered gravity conditions. Adv Space Res 31: 2253–59. Porterfield DM (2002) The biophysical limitations in physiological transport and exchange in plants grown in microgravity. J Plant Growth Regul 21: 177–90. Rasmusson AG, Mùller IM (2011) Mitochondrial electron transport and plant stress. Adv Plant Biol 1: 357–81. Reynolds ES (1963) The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol 17: 208–12. Slocum RD, Gaynor JJ, Galston AW (1984) Cytological and ultrastructural studies on root tissues. Ann Bot 54: 65–76. Stout SC, Porterfield DM, Briarty LG, Kuang A, Musgrave ME (2001) Evidence of root zone hypoxia in Brassica rapa L. grown in microgravity. Int J Plant Sci 162: 249–55. Stutte GW, Monje O, Hatfield RD, Paul AL, Ferl RJ, Simone CG (2006) Microgravity effects on leaf morphology, cell structure,
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
Mitochondria under clinorotation
carbon metabolism and mRNA expression of dwarf wheat. Planta 224: 1038–49. Sytnik KM, Kordium VA, Nedukcha EM, Sidorenko PG, Fomicheva VM (1984) Plant cell under changes of geophysical factors. Kiev: Nauka (in Russian). Sytnik KM, Popova AF (1998) Changes in plant mitochondria ultrastructure and respiration intensity in altered gravity. J Gravit Physiol 5: 169–70. Tairbekov MG (1979) The study of plant cell using “Bioficsator – 1” device Biological research on bio-satellites “Cosmos”. In: Tairbekov MG, Parfenov LG, Platonova RN eds. Biological research on bio-satellites “Cosmos“. Moskow: Nauka, pp. 161– 69 (in Russian). Tripathy BC, Brown CS, Levine HG, Krikorian AD (1996) Growth and photosynthetic responses of wheat plants grown in space. Plant Physiol 110: 801–06. Vanlerberghe GC (2013) Alternative oxidase: a mitochondrial respiratory pathway to maintain metabolic and signaling homeostasis during abiotic and biotic stress in plants. Int J Mol Sci 14: 6805–47. Van Aken O, Giraud E, Clifton R, Whelan J (2009) Alternative oxidase: a target and regulator of stress responses. Physiol Plantarum 137: 354–61. Wang II, Zheng HQ, Wet S, Zeng R, Xia QX (2006) A proteomic approach to analyzing responses of Arabidopsis thaliana callus cells to clinostat rotation. J Exp Bot 57: 827–35. Wolff SA, Coelho LH, Zabrodina M, Brinckmann E, Kittang A-I (2012) Plant mineral nutrition, gas exchange and photosynthesis in space: A review. Adv Space Res 51: 465–75. Received 26 August 2014; accepted 13 December 2014. Final version published online 2015.
483
RESEARCH ARTICLE
Clinorotation impacts root apex respiration and the ultrastructure of mitochondria Vasyl Brykov* and Elizabeth Kordyum Department of Cell Biology and Anatomy, M.G. Kholodny Institute of Botany of the National Academy of Sciences of Ukraine, Kyiv, Ukraine
Abstract Mitochondrial respiration in plants provides energy for biosynthesis, and its balance with photosynthesis determines the rate of plant biomass accumulation. However, there are very limited data on the influence of altered gravity on the functional status of plant mitochondria. We present the results of our investigations of root respiration, the mitochondrion ultrastructure, and AOX expression of pea 1-, 3- and 5-day-old seedlings grown under slow horizontal clinorotation by using an inhibitor analysis, electron microscopy, and quantitative real-time RT-PCR. It was shown for the first time that enhancement of the respiration rate in root apices of pea etiolated seedlings at the 5th day of clinorotation is not connected with increasing of both alternative oxidize capacity and AOX expression. We assumed this phenomenon is provided by more intensive oxidation of respiratory substrates. At the structural level, mitochondria in cells of the distal elongation zone were the most sensitive to clinorotation, which confirms the special physiological status of this zone. The performed investigation revealed a sufficient resistance of plant mitochondria to the influence of altered gravity that, in our opinion, is one of components providing plant adaptation to microgravity in space flight. Keywords: AOX expression; clinorotation; mitochondria; mitochondrial ultrastructure; Pisum sativum; respiration
Introduction Plants are considered as the irreplaceable component of Bioregenerative Life Support Systems (as a part of CELSS) in long-term space missions as far as they are sources of oxygen and food for crew, CO2 absorbers, regenerators of water through participation in recycling of organic wastes, and also green design for astronauts’ psychological comfort. Results of the space flight experiments aboard space shuttles and orbital stations clearly show that although microgravity is an unusual factor for plants, they can grow and develop during space flight from seed-to-seed under more-or-less optimal conditions for plant growth (Wolff et al., 2012; Kittang et al., 2014; Kordyum, 2014). These data allow us to study the state of plant structure and functions in microgravity that is necessary to predict the total amount of plant productivity, that is, green mass accumulation and seed crop. It is generally accepted that decreased convection in microgravity disturbs gas exchange between the environment and plant surface that defines a question on cell metabolism energy
supply more clearly (Musgrave et al., 1998; Liao et al., 2004). In aerobic respiration, mitochondria carry out the final steps of this process and generate the bulk of the ATP through oxidative phosphorylation, driven by oxidation of organic acids. At present, there are available data on the structural and functional characteristics of chloroplasts in algae and higher plants in real microgravity in space flight and in simulated microgravity (clinorotation) (Tripathy et al., 1996; Kochubey et al., 2004; Stutte et al., 2006). Unfortunately, less attention has been paid to mitochondrial respiration in altered gravity (Brykov, 2011). Mitochondrial respiration in plants provides energy for biosynthesis, and its balance with photosynthesis determines the rate of plant biomass accumulation (Millar et al., 2011). A distinctive feature of plant mitochondrial respiration is known to be the presence of alternative oxidase (AOX) that is a non-energy conserving terminal oxidase in the plant mitochondrial electron transport chain. It is encoded by the AOX genes and it is now often used as a general marker of mitochondrial dysfunction and/or cellular oxidative stress (Vanlerberghe,
Corresponding author: e-mail: [email protected] Abbreviations: AP, alternative pathway; AOX, alternative oxidase; CEZ, central elongation zone; CP, cytochrome pathway; DEZ, distal elongation zone; SHAM, salicylhydroxamic acid
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
475
Mitochondria under clinorotation
2013). Abiotic and biotic stresses are known to elevate AOX1 expression, supporting the idea that such stresses impact mitochondrial functions, and that AOX level might represent an important acclimation response (Vanlerberghe, 2013). Therefore, the aim of our work was to study the state of respiration and alternative oxidase, as well as the ultrastructure of mitochondria in root apex cells of pea etiolated seedlings under clinorotation. Materials and methods
Plant growth Sugar pea (Pisum sativum L.) seeds cv. Alfa were preliminarily soaked in distillate water blowing air in 8–10 h. Swollen seeds of the same size were selected and wrapped up in tubes from filter paper of 9 cm in height. Tubes with seeds were put into containers which were placed on a slow horizontal clinostat (2 rpm). Seedlings grew up to 5 days in the stationary conditions and under clinorotation in darkness at the temperature 24 1 С. Paper tubes were moistened with 0.5 mL of water every 24 h. 1-, 3- and 5-dayold seedlings were collected for testing.
Tissue respiration Oxygen consumption by root apices of 6 mm in length was measured using Clark-type electrodes (Hansatech Oxygraph, UK). For every measurement, seven root apices of total mass 10–15 mg were placed in a cell with 1.5 mL of distillate water. Measurements of oxygen uptake were carried out at 24 С during 12–15 min, beginning from the 2nd min, when respiration had a linear rate. The total rate of oxygen consumption (Vt) by a tissue was determined in the absence of inhibitors. The alternative pathway (AP) capacity was determined as a difference between O2 consumption in the presence of 3 mM КCN and residual respiration in the presence of КCN and 3 mM salicylhydroxamic acid (SHAM). The cytochrome pathway (CP) capacity was defined as a difference between oxygen consumption in the presence of 3 mM SHAM and residual respiration. In all measurements, the level of residual respiration was about 4% and it is not significantly different between the control and clinorotating root samples. Concentrations of KCN and SHAM had no apparent side effect in our system and produced maximal inhibition, as indicated by titration curves using different concentrations of each inhibitor in the presence and absence of the other (Mùller et al., 1988).
Quantitative real-time RT-PCR (qPCR) AOX expression was determined in whole roots, root apices (6 mm), and in the mature root zone (1 cm from beginning 476
V. Brykov and E. Kordyum
root hair growth) of 5-day-old seedlings. Each root was quickly examined under a microscope and corresponding root parts were cut off. Total RNA was isolated using InnuPREP Plant RNA Kit (Analytikjena) as described in the manufacturer’s protocol and quantified by spectrophotometry. RNA integrity was verified by agarose gel electrophoresis under denaturing conditions and by spectrophotometric assessment of the 260/280 nm ratio. First strand cDNA synthesis was performed using 1 mg of total RNA pre-treated with DNase I (Thermo Scientific) using oligo-(dT)18 primers and the Maxima H Minus Reverse Transcriptase (Thermo Scientific) according to the manufacturer’s instructions. RT-qPCR reactions were performed by using primers specific for pea AOX in a Maxima SYBR Green qPCR Master Mix (Thermo Scientific). The ACTIN3 housekeeping gene was used as an internal control. AOX nucleotide sequences for pea have been taken from Małecka et al. (2009). Primer sequences were designed with NCBI ESTs by using Vector NTI Oligo Design tool (ACTIN3: F – CCAAATCATGTTTGAGGCTTTTAA, R – GTGAAAGAACGGCCTGAATAGC; AOX: F –AGGTAACCAACCATACGG, R – TAAGGCGTTGCTAGAAGA). Primer specificity and the formation of primer dimers were controlled by both melting curve analysis and agarose gel electrophoresis. Primer concentrations were optimized and amplification efficiency was tested by relative standard curves, while specificity of the RT-qPCR amplification was confirmed by melting curve analysis of each single reaction. The real-time PCR was performed in a 25 mL reaction mixture using an iCycler iQ system (Bio-Rad). The following program was applied: initial denaturation: 95 C, 10 min; followed by 40 cycles at 94 C, 20 s; 61 C, 30 s; 72 C, 30 s. Relative expression was calculated based on qPCR efficiency (e) and the threshold values difference (DCt) between treated and control samples for both target and reference genes according to the mathematical model previously described by Pfaffl (2001). All calculations were made based on Ct values of 5-day-old seedlings from each experimental group. No reverse transcriptase and no template controls were included in each qPCR run. All experiments were performed in two biological replicates and two technical replicates.
Electron microscopy Root apices were fixed in 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.2, for 2 h at room temperature, postfixed with 1% OsO4 in the same buffer for 2 h at 4 C, dehydrated in graded ethanol series, then in acetone and afterwards embedded in the epon-araldit mixture. Ultrathin sections were cut on the MT-XL (RMC) ultramicrotome, stained with uranyl acetate and lead citrate (Reynolds, 1963) and examined with transmission Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
electron microscopes JEM 1200EX and JEM 1230EX (JEOL) at 80 kV. To study the ultrastructure of mitochondria in meristem cells and in cells of the distal elongation zone (DEZ), the central elongation zone (CEZ), and the mature zone it was necessary to identify clearly root growth zones before obtaining the ultrathin sections, as the sizes of these zones could vary in different roots. With this end, we examined preliminarily the anatomical structure of every root apex at the medial semi-thin sections. The sites for preparation of ultrathin sections were defined on a cell size and shape, the nucleus location, and a degree of cell vacuolization. Morphometry was done with Image Tool 3.0 (Uthscsa). The significance of differences between mean values was determined by a non-parametric Mann–Whitney U test for sizes of mitochondria and by t-test for dates on crista relative volume. Differences at P 0.05 were considered significant. Results
Tissue respiration and AOX expression In the control, the respiration rate of root apices increased during seedling growth and it was on 27% more in 5-day-old seedlings in comparison with that in 1-day-old ones. KCN and SHAM application showed a high sensitivity of the investigated tissue to inhibitors of mitochondrion respiration. The residual respiration level in root apices of unevenaged seedlings did not exceed 4% in the stationary control and after clinorotation that means respiration rate of root apices characterizes namely mitochondrial respiration and represents general functioning of both terminal oxidases. Age-specific changes in respiration of root apices during seedling growth were revealed in the stationary control. The sensitivity of root apices to KCN revealed in CP capacity
Mitochondria under clinorotation
increasing on 20% (Figure 1A). In addition, AP capacity decreased significantly on 60%, from 294 94.2 to 118 53.1 nmol О2 min 1 g 1, and it was only 12% from Vt at the 5th day. Thus, an inhibitory analysis showed that increased respiration of root apices was caused by an increase in the CP capacity that is effective in relation to energy accumulation. It is evidence of significant intensification of energetic metabolism in root cells during seedling growth in the stationary control. Dynamics of changes in root apex respiration during seedling growth under clinorotation were similar to that in the control (Figure 1B). The respiration rate increased on 35% at the 5th day of seedling growth and was 981 100.3 nmol O2 min 1 g 1; it was 772 105.8 nmol O2 min 1 g 1 in 1-day-old seedlings. Such respiration promoting coincided with the increased CP capacity on 28%, the AP capacity significantly reduced on 55%. Simultaneously, a respiration rate of root apices was rather higher under clinorotation. In 5-day-old seedlings, it exceeded the control level on 7%. Although CP capacity and AP capacity were also higher under clinorotation, they were not statistically significant. Conservation of oxygen consumption age dynamics by root apices under clinorotation may indicate a high resistance of mitochondrial respiration to the influence of altered gravity during seedling growth. The relative level of AOX expression in whole roots, root apices and mature zones was similar in the control and under clinorotation (Figure 2).
Mitochondrial ultrastructure It was shown the ultrustructure of mitochondria changes significantly in root cortex cells in the radial direction, from peripheral to inner layers (data not shown). Therefore, we investigated the ultrastructure of mitochondria in the 2nd
Figure 1 Age-related changes of total rate of respiration (Vt), CP capacity (Vcyt) and AP capacity (Valt) in pea root apices growing during 5 days in stationary control and under clinorotation. Values are means SD of 8–46 replicates. FW – fresh weight.
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
477
Mitochondria under clinorotation
Figure 2 Expression of AOX in etiolated roots of 5-day-old pea seedlings in stationary control and under clinorotation. Error bars on RT-qPCR results represent standard deviations.
and 3rd cortex surface layers. General peculiarities of the changes in the mitochondrion ultrastucture in the direction from the root apical meristem to the mature zone in the control and under clinorotation have been established (Figure 3). In meristematic cells, a mitochondrion population is always polymorphous. Along with mitochondria of an oval or rounded shape there are elongated, sometimes branched or dumb-bell shaped organelles. Mitochondria in meristematic cells often contact with each other. Membranes of mitochondrial envelopes and cristae have a lower electron density, in comparison with the surrounding hyaloplasm (Figure 3). Such mitochondrion ultrastructure is supposed to be connected with their highly active growth in rapidly fission meristematic cells. The given idea is confirmed with the smaller sizes of mitochondria in meristematic cells then in cells of the DEZ (Figure 4A). In addition, the high level of mitochondrial protein gene transcription, which is characteristic for root meristem cells, is gradually reduced in the direction of the mature zone (Li et al., 1996). Cell transition to growth by elongation is also accompanied by decreasing the polymorphism of a mitochondrial population. In the DEZ, large elongated organelles are found but their quantity is less than in meristematic cells. In the CEZ, such organelles are very rarely observed. Membranes of mitochondrial cristae become more distinct in comparison with those in meristematic cells, they gain increased osmiophility; in contrast, a matrix loses electron density (Figure 3). A root cell enlargement from the meristem to the CEZ is accompanied by increasing size of mitochondria, which is the most expressed in 5-day-old seedlings (Figure 4A). In the same time, a ratio of the crista area to organelle area (relative area of cristae) remains constant (Figure 5A). The obtained data show that increasing of the mitochondrial matrix 478
V. Brykov and E. Kordyum
volume and crista area occurs during root cell elongation and differentiation. Formation of mitochondrial metabolic system is known to occur during root cell differentiation, that is expressed in straightened respiration due to the high requirement for respiratory energy for biosynthetic and uptake processes, as this is a major factor regulating the rate of respiration (Khavkin, 1977; Lambers et al., 2002). Mitochondria in cells of different root growth zones revealed different sensitivity to the influence of clinorotation. The mitochondrion ultrastructure in meristematic cells under clinorotation was similar to that in control cells. Meristematic cell transition from division to slow elongation in the DEZ under clinorotation, unlike control, is accompanied by the following rearrangements of the mitochondrion ultrastructure: 1) decreasing the population polymorphism, 2) decreasing an organelle size (Figure 4B), 3) crista widening, increasing a ratio of the crista area to matrix area (Figure 3 and 5B), and 5) increasing the matrix electron density. In rapidly growing cells of the CEZ, the mitochondrion ultrastructure under clinorotation was more or less similar with that in the control. Changes in the mitochondrion ultrastructure in cells of the DEZ under clinorotation may be characterized as moderated condensation of organelles (Figure 3). A degree of organelle condensation depends on the time of clinorotation. Mitochondria in cells of the DEZ had the more matrix density in comparison with that in meristematic cells. A relative crista area increased on 28% under 3-day clinorotation, and on 35% under 5-day clinorotation (Figure 5B), which indicates the active nature of mitochondrion condensation process in cells of the DEZ. In addition, the size of mitochondria was smaller than in the CEZ and mature zone (Figure 6), whereas the crista shape and distribution as well as matrix density hardly changed in comparison with control (Figure 3). We may assume that organelle condensation in the DEZ has a reversible physiological character and may connect with the changes in the functional load of mitochondria in cells of the DEZ. Thus, the obtained data confirmed a special physiological role of the DEZ in root development and formation of its metabolic systems. Responses of DEZ cells to various exogenous and endogenous signals such as auxin, mechanical impedance, electrotropic stimulation and gravity differ from CEZ cell reaction, and even they can be opposite (Ishikawa and Evans, 1995). It is generally assumed that actively metabolizing cells in the DEZ undergo the most rearrangements under the changes in a cell differentiation rate in microgravity (Kordyum, 1997). Discussion It necessary to note again that available, very limited, data on the mitochondrion ultrastructure in microgravity are contradictory. There were no differences in the mitochondrion Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
Mitochondria under clinorotation
Figure 3 Fragments of 1-, 3- and 5-day-old pea root meristem (A, D, G, J, M, Q), DEZ (B, E, H, K, N, R), CEZ (C, F, I, L, O, S) and mature zone (P, T) cells with mitochondria in stationary control (A–C, G–I, M–P) and after clinorotation (D–F, J–L, Q–T). Bar – 0.1 mm.
ultrastructure in root meristematic cells of Zea mays seedlings grown on board the biosatellite Cosmos 1514 (Tairbekov, 1979), and Beta vulgaris seedlings under clinorotation (Kordium et al., 2008). Unlike these data, the presence of swollen mitochondria in root meristematic cells of Avena sativa and Vigna radiata seedlings has been reported in microgravity (Slocum et al., 1984), although the Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
absence of statistical information makes it impossible to draw definite conclusions on mitochondrion structural rearrangements in the last experiment. In the same time, an increased electron density of the mitochondrial matrix and more crista quantity, as well as major heterogeneity of a mitochondrion population, were described in root meristematic cells of pea seedlings grown on board the orbital 479
Mitochondria under clinorotation
V. Brykov and E. Kordyum
Figure 4 Changes in a size of mitochondria in cortex cells of root growth zones of pea 1-, 3- and 5-day-old seedlings grown in stationary control (A) and under clinorotation (B). The box plot shows the median, 25% – quartile, 75% – quartile, spreads – minimal and maximal values. Point values above 1 mm2 were ignored. Significant differences (P < 0.05) are denoted by the same labels.
station Salyut (Sytnik et al., 1984). These results should be interpreted with caution due to the difficulty of discrimination between microgravity effects and plant responses to environmental stress (Stutte et al., 2006; Wolff et al., 2012). Root tissue histogenesis is not disturbed in altered gravity but this process accelerates. It was repeatedly shown that linear sizes of both root apical meristem and elongation zone decrease in altered gravity (Kordyum, 1997) resulting in the location of the mature zone with root hairs at a shorter distance from a root apex. Shortening the period of a root apical meristem activity leads to earlier removal of apical dominance that stimulates intensive development of lateral roots (Halstead and Dutcher, 1987; Kordyum, 1997). Our data on the increased respiration rate in pea seedling roots under clinorotation coincide with the information on
increasing the oxygen consumption by unicellular green alga Chlorella vulgaris at the all phases of its growth under clinorotation simultaneously with an increased size of mitochondria (Sytnik and Popova, 1998). In the authors’ opinion, described structural and functional changes in mitochondria indicate increasing a metabolic activity of organelles, as well as increasing the cell expenditure of energy in general, that is considered as an adaptive response to microgravity action (Sytnik and Popova, 1998; Popova, 2003). However, direct interpolation of these data on mitochondrion functioning in specialized tissues of higher plants is limited. We have already noted an increase in the total rate of oxygen consumption in root apices of 5-day-old seedlings on 7% under clinorotation in comparison with the control. This
Figure 5 A relative volume of mitochondrial cristae in pea root growth zones of 1-, 3-, 5-day-old pea seedlings in stationary control (A) and after clinorotation (B). Values are means SD of 27–75 replicates. Significant differences (P < 0.05) are denoted by the same labels.
480
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
Figure 6 The size of mitochondria in the meristem, DEZ, CEZ, and mature zone of 5-day-old pea roots in control and clinorotation. The box plot shows the median, 25% – quartile, 75% – quartile, spreads – minimal and maximal values. Point values above 1 mm2 were ignored. Significant differences (P < 0.05) are denoted by the same labels.
might be connected with the AOX activation as it is considered as the marker of mitochondrion stress-reactions on different unfavourable abiotic factors (Van Aken et al., 2009; Rasmusson and Mùller, 2011). AOX activation was known to reduce the ATP yield by uncoupling of oxidation and phosphorylation processes (Van Aken et al., 2009; Rasmusson and Mùller, 2011). But there were no changes in AOX expression level in pea 5-day-old seedlings under clinorotation. In addition, earlier it has been shown that clinorotation did not affect the respiratory control ratio in the mitochondrial fraction isolated from pee seedling roots; that is, simulated microgravity does not lead to uncoupling the oxidative phosphorylation (Brykov et al., 2012). So, we for the first time showed that increasing the oxygen consumption intensity in plant tissues under clinorotation was not connected with increasing of capacity of stressinduced AOX and AOX expression. The data on AP capacity, which have been obtained by an inhibitory analysis, are not evidence of the allocation of respiratory electrons and consequently of a share of alternative way in respiration in vivo (Day et al., 1996). At that time, sensitivity of root apices to cyanide significantly increased with seedling age: in 5-day-old seedling, AP capacity decreased by 40–45% in control and under clinorotation. Taking into account that a seedling respiration rate increased by 30% approximately at the 5th day, a maximal possible share of the alternative way in respiration was 7–10%. The obtained data show an increased role of the CP in respiration of root apices during 5 days of seedling growth that is accompanied with energetic metabolism intensification in control and under clinorotation similarly. Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
Mitochondria under clinorotation
Thus, it was shown a high resistance of integral indices of the mitochondrion structural and functional organization in root apices under clinorotation. At the same time, the study of metabolic activity of mitochondria, which were isolated from 5-day-old seedling roots, under oxidation of different respiratory substrates revealed certain changes in organelle functioning under clinorotation (Brykov et al., 2012). Oxidative activity of isolated mitochondria in the active phosphorilative state 3 under oxidation of both malate and exogenous NADH has a tendency to increase under clinorotation that may explain the enhancement of respiration at the tissue level described earlier. However, it is assumed, that such activation of oxidative metabolism does not lead to more accumulation of ATP molecules in comparison with control but it occurs in a response on the reduction of phosphorylation effectiveness, that is, ADP/ O ratio under oxidation of different substrates (Brykov et al., 2012). It is supposed the observed changes are consisted not in the general stimulation of the oxidative activity of mitochondria and increasing ATP output, but in the regulation of the mitochondrial electron transport chain (Brykov et al., 2012). This assumption requires the straight measurement of the supply of energy level in root elongating and mature cells, as functioning of mitochondria in vivo more depend on the adenylate control (АTP/ADP), the level of both sugars and glycolysis intensity, and O2 supply. All these factors are important to provide respiratory metabolism and maintain energetic homeostasis in root cells not only in the stationary growth conditions but, in our opinion, to a greater degree for successful functioning of mitochondria in space flight. In some space flight experiments with plants, it has been reported that mitochondria are in the hypoxia conditions (Porterfield, 2002; Liao et al., 2004; Paul et al., 2013). Activation of both glycolysis and synthesis of alcohol dehydrogenase occurs, and the level of this enzyme increases significantly in a developed root system (Stout et al., 2001). Hypoxia in root tissues may arise as a result of biophysical limitations in oxygen accessibility in plants in the microgravity conditions. Data, obtained by us, indicate an oxygen increasing requirement by root apices under clinorotation and, thus, they confirm the necessity of substrate aeration in space greenhouses to provide normal respiratory metabolism in plants. On our opinion, metabolic and structural changes in mitochondria under clinorotation are responses to the requirement of higher energy expenditures under the influence of altered gravity that is an unfamiliar factor for terrestrial organisms. Nevertheless, the chronic effect of microgravity does not prevent the development of adaptive reactions at the cellular level. The cell’s energy system is highly sensitive to environmental fluctuations which cause changes in cell metabolism, including activation of anabolic 481
Mitochondria under clinorotation
and catabolic processes. Earlier data on changes in lipid and carbohydrate metabolism in 24-day-old pea plants grown on board the orbital station Salyut and tested biochemically (Laurinavichius et al., 1984) were recently confirmed by data on altered expression of genes involved in carbon and lipid metabolism in Arabidopsis thaliana cell cultures under clinorotation (Wang et al., 2006) and seedlings in real microgravity (STS-131; Blancaflor et al., 2012). In the latter study, many genes encoding lipid signaling proteins were down-regulated. So, we have reason to assume that metabolism changes in microgravity because mitochondrion modifications are necessary to provide a cell enough energy under these new conditions. Conclusions Investigations of the structural and functional organization of mitochondria in pea seedling roots grown during five days in the stationary conditions and under slow horizontal clinorotation allowed us to conclude that mitochondria provide respiratory metabolism and maintain energetic homeostasis of root cells under clinorotation. Mitochondria in cells of the distal elongation zone are the most sensitive to the influence of simulated microgravity that confirms a special physiological role of the DEZ in root development and formation of its metabolic systems. Alternative oxidase does not participate in the maintenance of cellular energetic homeostasis under clinorotation that is demonstrated by an inhibitor analysis and indirectly by unchanged AOX expression under clinorotation. The utmost respiration rate of root apices under clinorotation, especially at the 5th day of clinorotation, exceeding that in the control on 7%, is connected with more intensive oxidation of respiratory substrates. At the structural level, mitochondria in cells of the distal elongation zone were the most sensitive to clinorotation that confirms the special physiological status of this zone. The performed investigation revealed a sufficient resistance of plant mitochondria to the influence of altered gravity that, in our opinion, is one of components providing plant adaptation to microgravity in space flight. Acknowledgement This study was supported by the grant 0113U002583 of the National Academy of Sciences of Ukraine. References Blancaflor EB, Sparks JA, Nakashima J, Tang Y (2012) Microgravity research on STS-131: transcript profiling of space-grown Arabidopsis seedlings uncover novel regulators of root development. ISLSWG Satellite Workshop to the Plant Biology Congress 24.
482
V. Brykov and E. Kordyum
Brykov VO (2011) Clinorotation affects the ultrastructure of pea root mitochondria. Micrograv Sci Technol 23: 215–19. Brykov VO, Shugaev AG, Generozova IP (2012) Ultrastructure and metabolic activity of pea mitochondria under clinorotation. Cyt Gen 46: 144–49. Day DA, Krab K, Lambers H, Moore AL, Siedow JN, Wagner AM, Wiskich JT (1996) The cyanide-resistant oxidase: to inhibit or not to inhibit, that is the question. Plant Physiol 110: 1–2. Halstead TW, Dutcher FR (1987) Plant in space. Annu Rev Plant Physiol 38: 317–45. Ishikawa H, Evans ML (1995) Specialized zones of development in roots. Plant Physiol 109: 725–27. Khavkin EE (1977) Formation of metabolic systems in growing plant cells. Novosibirsk: Nauka (in Russian). Kittang A-I, Iversen T-H, Fossum KR, Mazars C, Carnero-Diaz E, Boucheron-Dubuisson E, Disquet Ile, Legu V, Herranz R, Pereda-Loth V, Medina FJ (2014) Exploration of plant growth and development using the European Modular Cultivation System facility on the International Space Station. Plant Biol 16: 528–38. Kochubey SM, Adamchuk NI, Kordyum EL, Guikema JA (2004) Microgravity effects the photosynthetic apparatus of Brassica rapa L. Plant Biosystems 138: 1–9. Kordyum EL (1997) Biology of plant cell microgravity and under clinostating. Int Rev Cytol 171: 1–72. Kordium EL, Martyn GI, Ovcharenko IuV (2008) The growth and differentiation of root cap columella cells and the proper root grown in the stationary conditions and under clinorotation. Tsitol Genet 42: 3–12. Kordyum EL (2014) Plant cell gravisensitivity and adaptation to microgravity. Plant Biol 16(Suppl 1): 79–90. Lambers H, Atkin OK, Millenaar FF (2002) Respiratory patterns in roots in relation to their functioning. In: Waisel Y, Eshel A, Kafakki V eds. Plant roots: the hidden half. New York: Marcel Dekker, pp. 521–52. Laurinavichius RS, Yaroschus AV, Marchukajtis A (1984) Metabolism of pea plants grown under space flight conditions. In: Dubinin NP ed. Biologicheskii issledovaniya na orbitalnikh stanziyakh salyut. Moskow: Nauka, pp. 96–102 (in Russian). Li XQ, Zhang M, Brown GG (1996) Cell-specific expression of mitochondrial transcripts in maize seedlings. Plant Cell 8: 1961–75. Liao J, Liu G, Monje O, Stutte GW, Porterfield DM (2004) Induction of hypoxic root metabolism results from physical limitations in O2 bioavailability in microgravity. Adv Space Res 34: 1579–84. Małecka A, Derba-Maceluch M, Kaczorowska K, Piechalak A, Tomaszewska B (2009) Reactive oxygen species production and antioxidative defense system in pea root tissues treated with lead ions: mitochondrial and peroxisomal level. Acta Physiol Plant 31: 1065–75. Millar AH, Whelan J, Soole KL, Day DA (2011) Organization and regulation of mitochondrial respiration in plants. Annu Rev Plant Biol 62: 79–104.
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
V. Brykov and E. Kordyum
Musgrave ME, Kuang A, Brown CS, Matthews SW (1998) Changes in arabidopsis leaf ultrastructure, chlorophyll and carbohydrate content during space flight depend on ventilation. Ann Bot 81: 503–12. Mùller IM, Berczi A, van der Plas LHW, Lambers H (1988) Measurement of the activity and capacity of the alternative pathway in intact plant tissues: identification of problems and possible solutions. Physiol Plant 72: 642–49. Paul A-L, Wheeler RM, Levine HG, Ferl RJ (2013) Fundamental plant biology enabled by the space shuttle. Am J Bot 100: 226–34. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45. Popova AF (2003) Comparative characteristic of mitochondria ultrastructural organization in Chlorella cells under altered gravity conditions. Adv Space Res 31: 2253–59. Porterfield DM (2002) The biophysical limitations in physiological transport and exchange in plants grown in microgravity. J Plant Growth Regul 21: 177–90. Rasmusson AG, Mùller IM (2011) Mitochondrial electron transport and plant stress. Adv Plant Biol 1: 357–81. Reynolds ES (1963) The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol 17: 208–12. Slocum RD, Gaynor JJ, Galston AW (1984) Cytological and ultrastructural studies on root tissues. Ann Bot 54: 65–76. Stout SC, Porterfield DM, Briarty LG, Kuang A, Musgrave ME (2001) Evidence of root zone hypoxia in Brassica rapa L. grown in microgravity. Int J Plant Sci 162: 249–55. Stutte GW, Monje O, Hatfield RD, Paul AL, Ferl RJ, Simone CG (2006) Microgravity effects on leaf morphology, cell structure,
Cell Biol Int 39 (2015) 475–483 © 2014 International Federation for Cell Biology
Mitochondria under clinorotation
carbon metabolism and mRNA expression of dwarf wheat. Planta 224: 1038–49. Sytnik KM, Kordium VA, Nedukcha EM, Sidorenko PG, Fomicheva VM (1984) Plant cell under changes of geophysical factors. Kiev: Nauka (in Russian). Sytnik KM, Popova AF (1998) Changes in plant mitochondria ultrastructure and respiration intensity in altered gravity. J Gravit Physiol 5: 169–70. Tairbekov MG (1979) The study of plant cell using “Bioficsator – 1” device Biological research on bio-satellites “Cosmos”. In: Tairbekov MG, Parfenov LG, Platonova RN eds. Biological research on bio-satellites “Cosmos“. Moskow: Nauka, pp. 161– 69 (in Russian). Tripathy BC, Brown CS, Levine HG, Krikorian AD (1996) Growth and photosynthetic responses of wheat plants grown in space. Plant Physiol 110: 801–06. Vanlerberghe GC (2013) Alternative oxidase: a mitochondrial respiratory pathway to maintain metabolic and signaling homeostasis during abiotic and biotic stress in plants. Int J Mol Sci 14: 6805–47. Van Aken O, Giraud E, Clifton R, Whelan J (2009) Alternative oxidase: a target and regulator of stress responses. Physiol Plantarum 137: 354–61. Wang II, Zheng HQ, Wet S, Zeng R, Xia QX (2006) A proteomic approach to analyzing responses of Arabidopsis thaliana callus cells to clinostat rotation. J Exp Bot 57: 827–35. Wolff SA, Coelho LH, Zabrodina M, Brinckmann E, Kittang A-I (2012) Plant mineral nutrition, gas exchange and photosynthesis in space: A review. Adv Space Res 51: 465–75. Received 26 August 2014; accepted 13 December 2014. Final version published online 2015.
483
