JIPB
Journal of Integrative Plant Biology
Research Article
Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation Wang Li†, Bing Wang†, Man Wang, Min Chen, Jing‐Ming Yin, Ghullam Murtaza Kaleri, Rui‐Jie Zhang, Tie‐Niu Zuo, Xiong You and Qing Yang* College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. †These authors contributed equally to this work. *Correspondence: [email protected]
Abstract Anthocyanins are a class of products of plant secondary metabolism and are responsible for tubers color in potato. The biosynthesis of anthocyanins is a complex biological process, in which multiple genes are involved including structural genes and regulatory genes. In this study, StAN11, a WD40‐repeat gene, was cloned from potato cultivar Chieftain (Solanum tuberosum L.). StAN11 (HQ599506) contained no intron and its open reading frame (ORF) was 1,029 bp long, encoding a putative protein of 342 amino acids. In order to verify its role in anthocyanin biosynthesis, StAN11 was inserted behind the CaMV‐35S promoter of pCMBIA1304 and the recombination vector was introduced into the potato cultivar Désirée plants by Agrobacterium‐mediated transformation. The color of transgenic tuber skin was significantly deepened, compared to the wild‐type control, which was highly consistent with the accumulation of anthocyanin and expression of StAN11 in transgenic lines tuber skin. Further analysis on the expression of Flavonone‐3‐hydroxylase (F3H),
INTRODUCTION Anthocyanins are flavonoid pigments commonly found in plants, where they impart vivid colors to flowers, fruits, and their vegetative tissues (Tanaka et al. 2008; Zhang et al. 2008). Anthocyanins also play important ecophysiological roles in protecting plants from various biotic and abiotic stresses, attracting the insects and animals for pollination, and promoting seed dispersal (Schaefer et al. 2007; Petroni and Tonelli 2011). Furthermore, due to its high antioxidant activity, it is extensively used in human nutrition and treatment as anti‐ cancer, anti‐mutagenic, anti‐microbial, anti‐inflammatory, and anti‐atherosclerotic agents (Butelli et al. 2008; de Pascual‐ Teresa and Sanchez‐Ballesta 2008; Zhao et al. 2009). The action of multiple enzymes encoded by the structural genes is responsible for the synthesis of anthocyanin in many plant species (Holton and Cornish 1995; Liu et al. 2005). It has been known that there are three classes of transcriptional regulators involved in anthocyanin synthesis, which are R2R3‐ MYB, basic helix‐loop‐helix (bHLH), and WD40‐repeat (WDR) proteins, respectively (Grotewold 2006). Combination and interaction of these regulatory proteins determine the set of downstream genes to be expressed (Mol et al. 1998; Koes et al. 2005). In Arabidopsis, the biosynthesis of anthocyanins is April 2014 | Volume 56 | Issue 4 | 364–372
Dihydroflavonol reductase (DFR), Anthocyanidin synthase (ANS), and Flavonoid 3‐O‐glucosyl transferase (3GT) in transgenic plants revealed that only DFR was upregulated. This result suggested that StAN11 regulated anthocyanin biosynthesis in potato by controlling DFR expression and accumulation of anthocyanin could be increased through overexpression of StAN11 in the tubers with the genetic background of anthocyanin biosynthesis. Keywords: Anthocyanin biosynthesis; cloning genetic transformation; potato; StAN11 Citation: Li W, Wang B, Wang M, Chen M, Yin JM, Kaleri GM, Zhang RJ, Zuo TN, You X, Yang Q (2014) Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation. J Integr Plant Biol 56: 364–372. doi: 10.1111/jipb.12136 Edited by: Shan Lu, Nanjing University, China Received Aug. 25, 2013; Accepted Nov. 25, 2013 Available online on Dec. 4, 2013 at www.wileyonlinelibrary.com/ journal/jipb © 2013 Institute of Botany, Chinese Academy of Sciences
mainly regulated by a ternary complex TTG1/bHLH/MYB by activating the structural genes DFR an LDOX (Cominelli et al. 2008; Gonzalez et al. 2008). Anthocyanin accumulation induced by blue light and jasmonate might also be mediated by the WD‐repeat/Myb/bHLH transcriptional complexes in Arabidopsis Seedlings (Chen et al. 2006; Peng et al. 2011). In potato, the MYB tissue‐special transcription factor (TF) StMtf1 and StAN2 were successfully isolated and they have all been shown to be involved in the regulation of anthocyanin biosynthesis (Rommens et al. 2008; Jung et al. 2009). In recent years, numerous WD40‐repeat TF about anthocyanin synthesis have been well characterized in Arabidopsis, maize, petunia and snapdragon, and all of them contain a special highly conserved tryptophan‐aspartate (WD) repeat, but have no intrinsic enzyme or TF activity so far (Xu and Min 2011; Davies et al. 2012). In Arabidopsis, TTG1 encoding a WD40‐repeat protein was demonstrated to be involved in the formation and stability of MBW complex that control the biosynthesis of anthocyanins and the formation of trichomes and root hairs (Broun 2005; Feller et al. 2011), while the mutant ttg1 lacks anthocyanins in all tissues (Koornneef 1981). Homologs of this gene have been identified in other plant species, such as AN11 from Petunia hybrid (de Vetten et al. 1997), PAC1 from Zea mays (Carey et al. 2004), MtWD40‐1 from www.jipb.net
A WD40‐repeat gene StAN11 in potato Matthiola incana (Pang et al. 2009). WDR could also promote the nuclear localization of bHLH in Perilla frutescens (Sompornpailin et al. 2002), and was likely to be involved in post‐translational control of MYB (de Vetten et al. 1997) and control of vacuolar pH and the morphology of the seed coat epidermis in P. hybrid (Quattrocchio et al. 2006; Zenoni et al. 2011). Most isolated WD‐repeat proteins were shown to be essential for anthocyanin biosynthesis regulation. Colored potato tubers contain abundant anthocyanins and are widely recognized as a potent source of antioxidants for human health (De Jong et al. 2004; Stushnoff et al. 2008). As the interest in anthocyanin‐rich potatoes increases and the science of biotechnology develops, metabolic engineering is a popular method to obtain new potato species by overexpressing key regulatory genes (Kosieradzka et al. 2004; Lukaszewicz et al. 2004). Jung’s report indicated that overexpression of the regulatory gene StAN2 in potato could improve tuber anthocyanin content (Jung et al. 2009). AN11, a regulatory gene encoding a WD40‐repeat protein, has been first identified in P. hybrid, but it has not been reported in potato. In this paper, the StAN11 gene was isolated from potato cultivar Chieftain and its function was analyzed by overexpression of the gene in potato cultivar Désirée.
RESULTS The StAN11 gene is a homolog of a regulatory gene that is involved in anthocyanin biosynthesis pathway The full length of the StAN11 cDNA was obtained using a pair of specific primers designed according to the assembled sequence of the gene. Two 1,100 bp fragments were separately amplified from the cDNA and genomic DNA of potato. The sequence was deposited in GenBank (accession number HQ599506). StAN11 contained an open reading frame (ORF) of 1,029 bp, encoding a protein of 342 amino acids with a molecular mass of 38.3 kDa and an isoelectric point (pI) of 4.95. Comparison of the cDNA and DNA sequences showed that the StAN11 gene had no intron. Comparison of the StAN11 protein sequence with those from other plants in the Genbank and EMBL databases indicated that it had a significant sequence similarity with NcWDR (93.86%), PhAN11 (88.63%), MdTTG1 (83.33%), and VvWD40 (80.70%), respectively (Figure 1A). All of these genes are involved in anthocyanin biosynthesis pathway (Ben‐Simhon et al. 2011). Conserved domain analysis of StAN11 protein revealed that it contained four WD‐repeat motifs (the amino acid residues are at 67–112, 117–162, 165–203, and 254–294) and a 40‐amino acid stretch typically ending in Trp‐Asp (Figure 1B). In three‐ dimensional structure, StAN11 comprised three sheets, which contained 11 strands and nine beta hairpins (Figure 1C). Further, a phylogenetic tree was constructed using StAN11 and its homologous proteins from 12 species in GenBank (Figure 2). StAN11 was clustered in a clade and group with VvWDR1 from Vitis vinifera. Tissue expression pattern of StAN11 To study the expression pattern of StAN11 gene, StAN11 mRNA levels were measured in various tissues of cultivar Chieftain by semi‐quantitative reverse transcription‐polymerase chain reaction (RT‐PCR). As shown in Figure 3, StAN11 transcript could www.jipb.net
365
be detected in all the tissues with a highest level in stolon and a lowest one in roots (Figure 3). Production of StAN11 transgenic potato plants For transformation, the expression vector pCMBIA1304‐StAN11 was constructed (Figure 4A) and examined by PCR (Figure 4B). Transformation of Désirée plants was performed using Aagrobacterium tumefaciens‐mediated method and regeneration of transgenic plants was shown in Figure 4C. The potato callus were induced on the stem explants 2 weeks after infection with A. tumefaciens and shoots regenerated about 4 weeks later. When the shoots grew up to 2–3 cm high, they were placed on rooting medium for Hyg B selection. Surviving shoots were transplanted in pots in a greenhouse. In total, 17 Hyg B‐resistant lines were obtained and examined for transgene insertion by PCR. Six lines showed an expected 837 bp amplification band and no band appeared in the Désirée control (Figure 5A). In order to know whether StAN11 expresses in the PCR‐positive plants, semi‐quantitative RT‐PCR analysis was carried out with potato leaves. The result showed that the level of StAN11 transcript was noticeably higher in the transgenic lines than that in the control (Figure 5B). This result confirmed that StAN11 was successfully overexpressed in six transgenic potato lines. Overexpression of StAN11 promotes anthocyanin accumulation in transgenic potato tuber skin The colors of 50‐day‐old tubers looked distinctly different between transgenic tubers and wild‐type tubers, the former appearing purple while the latter was light‐red (Figure 6). To clarify the relation between tuber color and anthocyanins, the content of anthocyanins in tuber skin was analyzed (Figure 7A). The result showed that the contents of anthocyanins in all the transgenic lines selected were higher than in the control, about two‐ to sixfold. We further examined the expression level of StAN11 in the tubers of the transgenic lines. The qRT‐PCR result showed that StAN11 expression was increased with different degrees, which was consistent with the results of anthocyanin measurement in these lines (Figure 7B). This result indicated that the expression of StAN11 increased the accumulation of anthocyanin in transgenic potato lines. StAN11 modulates the expression of StDFR in potato To elucidate how StAN11, as a regulatory gene, modulates structural genes in anthocyanin biosynthesis, the expression of StF3H, StDFR, StANS, and St3GT was examined in the leaves and tubers of transgenic line 2 using semi‐quantitative PCR (Figure 8). The result showed that the expression of StDFR was remarkably increased in transgenic tubers compared to wild‐type control but no difference was observed for StF3H, St3GT, and StANS. This result suggested that StDFR was the target of StAN11 in the biosynthesis of potato anthocyanins.
DISCUSSION In recent years, due to the role of anthocyanins in human health, there has been a growing interest in the development of colored potato rich in anthocyanins (Brown et al. 2003; Lachman and Hamouz 2005). The requirement of colored potato breeding promoted studies on the mechanism of April 2014 | Volume 56 | Issue 4 | 364–372
366
Li et al.
Figure 1. Sequence alignment of StAN11 and the Domain architecture and Tertiary structure model analysis of StAN11 (A) Alignment of StAN11 and its homologs. NcWDR (FJ795022), PhAN11 (U94748), MdWD40 (AAF27919), and VvWDR1 (ABF66625). Fully conserved resides are highlighted with a black background and 75% conserved resides by a grey background. (B) The Domain architecture analysis of StAN11 (http://smart.embl‐heidelberg.de/). The WD40 repeat domains are indicated with green triangle. (C) Tertiary structure model of StAN11 (http://swissmodel.expasy.org/workspace). The strands and beta hairpins are shown by sheets and lines, respectively.
anthocyanin biosynthesis in this species. Following identification of structural genes in anthocyanins biosynthetic pathway, some of its regulatory genes such as StAN1b (JX848660) and StAN2 (Jung et al. 2009) were also isolated. These genes belong to bHLH and MYB, respectively. In this study, we cloned April 2014 | Volume 56 | Issue 4 | 364–372
an anthocyanin biosynthesis regulatory gene named StAN11, which belonged to a WD40 gene family, from potato cultivar Chieftain. The gene coding protein shared high sequence identity and close phylogenetic relationship with grapevine VvWDR1 (Matus et al. 2010). www.jipb.net
A WD40‐repeat gene StAN11 in potato
Figure 2. Phylogenetic analysis of StAN11and its homologous proteins from different species Arabidopsis thaliana (AtAN11, NP172751), A. thaliana (AtTTG1, NP851069), Caragana jubata (CjWDR1, ABQ18246), Cucmis sativus (CsTTG, ABY64743), Ipomoea nil (InWD40, BAE94405), Malus domestica (MdTTG1, AAF27919), Medicago truncatula (MtWD40, ABW08112), Nicotiana tabacum (NtWDR, ACT35693), Perilla frutescens (PfAN11, BAB58883), Petunia hybrida (PhAN11, AAC18914), Ricinus communis (RcAN11, XP002530884), Saussurea medusa (SmTTG1, ACN58396), and Vitis vinifera (VvWDR, ABF66625).
Figure 3. Expression analysis of StAN11 in different tissues RT‐PCR was performed on total RNAs from different tissues as indicated. 28 cycles were performed for amplification of StAN11. 1, root; 2, stem; 3, leaf; 4, bud; 5, stolon; 6, mature tuber. www.jipb.net
367
In anthocyanin biosynthesis, WD40 protein plays a role in favor of protein–protein interactions between MYB and bHLH regulators (Baudry et al. 2004). The protein has a common and defining feature of WD40 motif, a 40‐amino acid stretch typically ending in Trp‐Asp (Neer et al. 1994). The motif is found as several repeated units in tandem in a typical WD40 protein and at least four WD40‐repeats are believed to be required to form a higher‐ order and functional structure (Chothia et al. 1997). In this study, StAN11 contains four WD40 motifs and is consistent with WD40 proteins from other species in structure. The expression of AN11 often exhibited in specific tissues, such as a higher level detected in floral buds in Arabidopsis thaliana (Walker et al. 1999), while high expression level was observed in fruit in Malus domestica (Brueggemann et al. 2010) In this study, StAN11 transcript can be detected in all the tissues of Chieftain, but the highest level was observed in buds and stolons. This specificity of expression could relate to the functional site of the gene. The ectopic expression of anthocyanins biosynthetic regulatory genes has been studied in some plants such as in Arabidopsis, where the expression of the grapevine VvWDR1 and apple MdTTG1 enhanced anthocyanin accumulation in transgenic plants (Matus et al. 2010; An et al. 2012). In potato, the overexpression of StAN2 in transgenic Désirée potato deepened the color of tuber skin (Jung et al. 2009). In this study, the overexpression of StAN11 resulted in significant increase in anthocyanin content in transgenic potato lines. This result suggests that StAN11 plays an important role in the regulation of potato anthocyanin biosynthesis. In plant transformation, some variation among transgenic lines is often observed, which is probably caused by inserted copy number, position of integration or silencing of the transgene (Kortstee et al. 2011). In this study, a similar result was found and anthocyanin contents among four transgenic lines were quite different. This difference totally conforms to the transcriptional expression of StAN11 gene in these transgenic lines (Figure 7). To clarify the regulatory mechanism of the StAN11 gene on anthocyanin biosynthesis, we detected the expression of four anthocyanin biosynthetic structural genes StF3H, StDFR, StANS, and St3GT in transgenic line 2. Of the genes examined, only StDFR showed upregulated expression. This result reveals that StAN11 could regulate anthocyanin biosynthesis in potato tubers by modulating StDFR expression and further confirms that DFR was the target of a regulatory complex MYB/WD40/ bHLH in Arabidopsis (Nesi et al. 2000; Yang et al. 2012). In summary, in this study we cloned a WD40‐repeat gene StAN11 from potato cultivar Chieftain using RT‐PCR. Function analysis indicated StAN11 gene was involved in the regulation of potato anthocyanin biosynthesis, in which structural gene StDFR was its target. This result provides valuable evidence for its application in the improvement in the anthocyanin content of potato varieties, and may also improve our ability to develop novel biotechnological tools for the generation of new potato cultivars with enhanced anthocyanin content by utilizing molecular‐genetic approaches.
MATERIALS AND METHODS Plant materials and growth conditions In vitro tubers of potato cultivar Chieftain (Solanum tuberosum L.) were grown in a greenhouse with natural light. After April 2014 | Volume 56 | Issue 4 | 364–372
368
Li et al.
Figure 4. Genetic transformation and plant regeneration of potato with StAN11 gene (A) Schematic representation of the T‐DNA region of pCAMBIA1304‐StAN11 vector. LB, T‐DNA left border; HYG, hygromycin (R); 35S‐P, cauliflower mosaic virus. 35S promoter; lacZ, lacZ lapha; GFP, GFP; gusA, gusA; nos, Nos poly‐A; RB, T‐DNA right border. (B) Agarose gel electrophoresis of PCR amplification of StAN11. M, DL2000 marker; 1, water control; 2, ORF of StAN11. (C) Regeneration of StAN11 transgenic potato. a, callus formation on stem explants; b, shoot formation; c, the selection of transgenic shoots; d, plant in pot.
1 month, the younger leaves were collected for extraction of RNA and DNA. After 2 months, roots, stem, leaves, bud, and tuber were taken for spatial expression analysis of StAN11.
Figure 5. Identification of transgenic potato lines (A) PCR analysis of genomic DNA from Hygromycin B‐resistant potato. P, plasmid containing the potato pCAMBIA1304‐StAN11 (positive control); WT, potato Désirée (negative control); M, DL2000 marker, 1–7, Hygromycin B‐resistant plants. (B) Semi‐ quantitative PCR confirmed expression of StAN11 in leaves of transgenic potato lines. WT, potato Désirée (control); 1, 2, 3, 4, 5, 7, transgenic potato lines. April 2014 | Volume 56 | Issue 4 | 364–372
In vitro plantlets of potato cultivar Désirée (S. tuberosum L.), which were obtained from established tissue cultures in the lab, were cultured on MS medium (Murashige and Skoog 1962) containing 30 g/L sucrose and 0.8% agar at pH 5.8 in a climate chamber with a day/night cycle of 12/12 h at 24 °C. The stem segments of 4‐week‐old plantlets were used as explants for a transformation experiment. Isolation of StAN11 cDNA and genomic DNA Total RNA was isolated from 0.1 g of fresh leaves of “Chieftain” with total RNA isolation reagent and treated with DNase prior (TaKaRa Biotech, Dalian, China). Integrity was confirmed by gel electrophoresis in a 1% agarose gel. RNA concentration was determined by absorbance at 260 nm and purity was established with a 260/280 ratio. First‐strand cDNA was synthesized with M‐MLV reverse transcriptase from Promega (Madison, WI, USA) according to the manufacturer’s instructions. All the PCR was carried out in 1 mL of the prepared cDNA, 25 mL in 1 Taq reaction buffer containing 2.5 mM MgCl2, 250 nM each dNTP, 1 mM each primer and 2.5 U Taq polymerase (TaKaRa Biotech). The full length of the StAN11 cDNA was amplified with gene‐specific forward primers (50 ‐TCAAAATGGAGAATTCAAGTC‐ 30 ) and reverse primers (50 ‐TCTTACAGGAAAAATTC AATCAT‐30 ) designed according to the cDNA sequence of PhAN11(U94748), NcWDR (GQ260131), and InWD40 (AB232779). The amplification condition was 5 min at 94 °C, then 35 cycles of 40 s at 94 °C, 40 s at 52 °C, 1 min at 72 °C, then with a final extension for 10 min at 72 °C. www.jipb.net
A WD40‐repeat gene StAN11 in potato
369
Figure 6. Foliage and tuber phenotypes of transgenic Désirée of 50 days old WT, potato Désirée; Control, transgenic Désirée expressing empty vector pCAMBIA1304; 2, transgenic line 2 transformed with pCAMBIA1304‐StAN11.
Genomic DNA was isolated from young potato leaves by cetyl trimethylammonium bromide (CTAB) method (Hu et al. 2003). StAN11 DNA sequence was obtained from direct PCR of genomic DNA using the same gene‐specific primers above. All PCR products were separated on 1% agarose gels and target DNA bands were recovered by gel extraction, then cloned into pMD19‐T vector (TaKaRa Biotech), and finally
transformed into competent cells of Escherichia coli strain DH5a. White colonies were checked by PCR and the positive colonies were sequenced. Sequence analysis of StAN11 The comparative sequence analyses were performed using BLASTP (Altschul et al. 1997) search at National Center for Biotechnology Information (NCBI)with StAN11 as a query.
Figure 7. Analysis of anthocyanin contents and StAN11 expression intransgenic potato (A) Anthocyanin contents in tuber skins of transgenic potato lines and control plants. Con, Désirée expressing empty vector; 1, 2, 5, 7, transgenic lines. Significance is determined by t‐test (P < 0.05). Values are means SD (n ¼ 3). (B) Quantitative RT‐PCR expression analysis of the StAN11 in the tubers of 50‐day‐old transgenic plants. Con, Désirée expressing empty vector; 1, 2, 5, 7, transgenic lines. Significance is determined by t‐test (P < 0.05). Values are means SD (n ¼ 3). www.jipb.net
April 2014 | Volume 56 | Issue 4 | 364–372
370
Li et al. Construction of pCMBIA1304‐StAN11 vector The StAN11 ORF was amplified with PCR using forward primer (50 ‐ CATGCCATGGAAAATTCAAGTCAAG‐30 ; the restriction site is underlined) and reverse primer (50 ‐GGAAGATCTTCTTACAGGAAAAATTCAATCAT‐30 ). The PCR product was confirmed by sequencing and then inserted into pCMBIA1304 behind 35S promoter. The recombination vector, named as pCMBIA1304‐ StAN11, was transformed into Agrobacterium strain GV3101 using the freeze–thaw method (Hofgen and Willmitzer 1988).
Figure 8. Expression levels of 4 anthocyanin biosynthetic genes in Désirée plant expressing empty vector (Control) and StAN11 transgenic potato line 2 of 50 days old
Multiple sequence alignment and phylogenetic analysis were done using DNAMAN program. Conserved domain analysis was done using SMART (http://smart.embl‐heidelberg.de/). Swiss Model Server was used for prediction of protein tertiary structure (http://swissmodel.expasy.org/workspace). The phylogenetic tree of the AN11 protein was constructed using neighbor‐joining (NJ) method through MEGAv 4.1. Bootstrap test of phylogeny was analyzed with 1,000 replications (Thompson et al. 1994). Tissue expression analysis of StAN11 For the spatial expression studies, RNA was extracted from roots, stem, leaves, buds, and tubers of “Chieftain” and treated with DNase prior (TaKaRa Biotech). First‐strand cDNA was synthesized with M‐MLV reverse transcriptase from Promega according to the manufacturer’s instructions. The conserved region of StAN11 cDNA was specifically amplified by the primers AN11‐S and AN11‐A (Table 1). A 350 bp fragment was amplified as RNA standard with the primers: GAPDH‐S (50 ‐TCAACGAGAATGAATACAAGCCA‐30 ) and GAPDH‐A (50 ‐TCGACAACA GA AACATCAGCAGT‐30 ), which were designed according to the potato StGAPDH (glyceraldehyde‐3‐phosphate dehydrogenase) sequence. All the PCRs were performed under the following reaction condition: 5 min at 94 °C; then, 35 cycles of 40 s at 94 °C, 40 s at 54 °C, 1 min at 72 °C; then with a final extension step for 10 min at 72 °C. PCRs were amplified for 28 cycles. Table 1. Oligo nucleotide primers used for semi‐quantitative RT‐PCR Primer
Sequence (50 –30 )
AN11‐S AN11‐A F3H‐S F3H‐A DFR‐S DFR‐A ANS‐S ANS‐A 3GT‐S 3GT‐A EF‐1a‐S EF‐1a‐A
TGGAATGAAGTTGAGCCTAAAAG CAGCAGAGTACATCGACATGGGATC GGCTTCAACACTAACAGCTCTA ACTTAAGCAAGAATTTCCTCAA GATTTATCGGCTCTTGGCTTGT GTGCATTCTCCTTGCCACTTGA ACCCTCTGGTAATGTCCAAGGCTAT TCTTGTACTTTCCGTTGCTTAGGAT CTTCTCAACTTCATATTGCACT GCTTGTGACATTTAACTAGCTC ATTCAAGTATGCCTGGGTGCT GTGGTGGAGTCAATAATGAGGAC
April 2014 | Volume 56 | Issue 4 | 364–372
Potato transformation and regeneration Segments of Stem (0.5–1.0 cm) of 4‐week‐old potato plantlets were pre‐cultured on Y2 medium (MS þ 2 mg/L 6‐Benzylaminopurine þ 0.2 mg/L a‐naphthalene acetic acid þ 0.2 mg/L 2, 4‐ dichlorophenoxy acetic acid) in darkness at 24 °C for 2 d, and immersed in bacterial suspension of A. tumefaciens (optical density, OD600 ¼ 0.6) carrying the pCMBIA1304‐StAN11 plasmids for 8 min, after which they were co‐cultivated on Y2 medium for 2 d with the same conditions above. Then the infected Stem segments were replaced onto MGT medium (MS þ 0.03 mg/L gibberellic acid þ 0.5 mg/L N‐phenyl‐N0 ‐1, 2, 3‐ thidiazol‐5‐yl‐urea þ 200 mg/L Cefotaxime þ 10 mg/L Hygromycin B) and were cultured under a photoperiod of 12/12 h at 24 °C for callus induction. After 4 weeks, regenerated shoots were harvested from stem segments, which were placed on MS medium containing 10 mg/L Hyg B to test for rooting. The Hyg B‐resistant plants were grown in the greenhouse. PCR identification of transgenic plants To identify transgenic plants, genomic DNA was extracted from the leaves of the Hyg B‐resistant plants and wild‐type Désirée plant, respectively. The transgenic potato lines were identified by PCR using forward primer (50 ‐TTGCCATTGCGTTTTCTAAC‐30 ) and reverse primer (50 ‐TCACGGGTTGGGGTTTCTAC‐30 ), under the following reaction program: 94 °C for 4 min, followed by 35 cycles of 30 s at 94 °C, 30 s at 56 °C, 40 s at 72 °C, and 10 min extension at 72 °C. The PCR product was expected to be a 837 bp fragment containing the partial sequence of pCAMBIA1304 vector and the partial sequence of StAN11 ORF. qRT‐PCR analysis of StAN11 expression The transcript levels of the StAN11 gene in transgenic potato were measured by Quantitative RT‐PCR. The total RNA was isolated from the tuber skin of 50‐day‐old empty‐control and transgenic potato lines and treated with DNase prior (TaKaRa Biotech). The synthesis of first‐strand cDNA was the same as above. StEF‐1a gene (Eukaryotic elongation factor 1a) was used as an internal control and specific primers were designed for qRT‐PCR, forward primer (50 ‐AGTTTTTGCGTCCGTTTCTG‐30 ) and reverse primer (50 ‐ACACTCGCCTGATGCCTTT‐30 ). It is carried out by using SYBR Premix Ex Taq reaction system (TaKaRa Biotech) on the ABI PRISM 7500HT FAST Real‐Time PCR System. We used comparative Ct method to calculate the expression levels of StAn11 (Applied Biosystems, Foster City, CA, USA). All qRT‐ PCR analysis for each sample was repeated three times. Extraction and content analysis of anthocyanins Total anthocyanins were extracted from the tuber skin of 50‐day‐old transgenic and wild‐type potato using the method as described by Kumar and Yadav (2012). One hundred milligrams of tuber skin was soaked using 1 mL methanol www.jipb.net
A WD40‐repeat gene StAN11 in potato
371
containing 1% HCl (v:v) for 12 h in darkness after 50 d of growth. The total volume of the supernatant was brought up to 10 mL with extracting solvent after centrifugation at 6 000 g at 4 °C for 10 min. Measurement was done on the UV‐Vis spectrophotometry at 520 nm and repeated three times. The anthocyanin content was calculated as pelargonidin equivalents (Sachse 1973).
Brueggemann J, Weisshaar B, Sagasser M (2010) A WD40‐repeat gene from Malus domestica is a functional homologue of Arabidopsis thaliana TRANSPARENT TESTA GLABRA1. Plant Cell Rep 29: 285– 294
Semi‐quantitative RT‐PCR analysis of structural genes Total RNA was isolated from the 50‐day‐old transgenic and Désirée plants using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and treated with DNase prior (TaKaRa Biotech). cDNA was prepared using oligo (dT) and a reverse transcription system kit (TaKaRa Biotech). The expression level of four anthocyanin biosynthesis genes StF3H, StDFR, StANS, and St3GT was estimated semi‐quantitatively by altering the cycles of PCR amplification with the primers described in Table 1. Potato EF‐ 1a gene was used as an internal control for normalizing the level of the transcripts to be tested. The amplified products were separated on 1% agarose gel and visualized with ethidium bromide staining.
Carey CC, Strahle JT, Selinger DA, Chandler VL (2004) Mutations in the pale aleurone color1 regulatory gene of the Zea mays anthocyanin pathway have distinct phenotypes relative to the functionally similar TRANSPARENT TESTA GLABRA1 gene in Arabidopsis thaliana. Plant Cell 16: 450–464
ACKNOWLEDGEMENTS We specially thank Professor Xiu‐Qing Li and Miss Chidie Yang for assistance in writing the manuscript. This study was supported financially by grants from the Jiangsu Agricultural Science and Technology Innovation Fund (cx (11)1020), National Natural Science Foundation of China (11171155), and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions: Modern horticultural science (PAPD).
REFERENCES Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI‐BLAST: A new generation of protein database search programs. Nucleic Acids Res 25: 3389– 3402 An XH, Tian Y, Chen KQ, Wang XF, Hao YJ (2012) The apple WD40 protein MdTTG1 interacts with bHLH but not MYB proteins to regulate anthocyanin accumulation. J Plant Physiol 169: 710– 717 Baudry A, Heim MA, Dubreucq B, Caboche M, Weisshaar B, Lepiniec L (2004) TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J 39: 366–380 Ben‐Simhon Z, Judeinstein S, Nadler‐Hassar T, Trainin T, Bar‐Ya’akov I, Borochov‐Neori H, Holland D (2011) A pomegranate (Punica granatum L.) WD40‐repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development. Planta 234: 865–881 Broun P (2005) Transcriptional control of flavonoid biosynthesis: A complex network of conserved regulators involved in multiple aspects of differentiation in Arabidopsis. Curr Opin Plant Biol 8: 272–279 Brown C, Wrolstad R, Durst R, Yang C‐P, Clevidence B (2003) Breeding studies in potatoes containing high concentrations of anthocyanins. Am J Potato Res 80: 241–249
www.jipb.net
Butelli E, Titta L, Giorgio M, Mock H‐P, Matros A, Peterek S, Schijlen EG, Hall RD, Bovy AG, Luo J (2008) Enrichment of tomato fruit with health‐promoting anthocyanins by expression of select transcription factors. Nat Biotechnol 26: 1301–1308
Chen DQ, Li ZY, Pan RC, Wang XJ (2006) Anthocyanin accumulation mediated by blue light and cytokinin in Arabidopsis seedlings. J Integr Plant Biol 48: 420–425 Chothia C, Hubbard T, Brenner S, Barns H, Murzin A (1997) Protein folds in the all‐b and all‐a classes. Annu Rev Biophys Biomol Struct 26: 597–627 Cominelli E, Gusmaroli G, Allegra D, Galbiati M, Wade HK, Jenkins GI, Tonelli C (2008) Expression analysis of anthocyanin regulatory genes in response to different light qualities in Arabidopsis thaliana. J Plant Physiol 165: 886–894 Davies KM, Albert NW, Schwinn KE (2012) From landing lights to mimicry: The molecular regulation of flower colouration and mechanisms for pigmentation patterning. Funct Plant Biol 39: 619– 638 De Jong W, Eannetta N, De Jong D, Bodis M (2004) Candidate gene analysis of anthocyanin pigmentation loci in the Solanaceae. Theor Appl Genet 108: 423–432 de Pascual‐Teresa S, Sanchez‐Ballesta MT (2008) Anthocyanins: From plant to health. Phytochem Rev 7: 281–299 de Vetten N, Quattrocchio F, Mol J, Koes R (1997) The an11 locus controlling flower pigmentation in petunia encodes a novel WD‐ repeat protein conserved in yeast, plants, and animals. Gene Dev 11: 1422–1434 Feller A, Machemer K, Braun EL, Grotewold E (2011) Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J 66: 94–116 Gonzalez A, Zhao M, Leavitt JM, Lloyd AM (2008) Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J 53: 814– 827 Grotewold E (2006) The genetics and biochemistry of floral pigments. Annu Rev Plant Biol 57: 761–780 Hofgen R, Willmitzer L (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res 16: 9877–9877 Holton TA, Cornish EC (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7: 1071 Hu J, Nakatani M, Lalusin AG, Kuranouchi T, Fujimura T (2003) Genetic analysis of sweetpotato and wild relatives using inter‐simple sequence repeats (ISSRs). Breed Sci 53: 297–304 Jung CS, Griffiths HM, De Jong DM, Cheng S, Bodis M, Kim TS, De Jong WS (2009) The potato developer (D) locus encodes an R2R3 MYB transcription factor that regulates expression of multiple anthocyanin structural genes in tuber skin. Theor Appl Genet 120: 45–57 Koes R, Verweij W, Quattrocchio F (2005) Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci 10: 236–242 Koornneef M (1981) The complex syndrome of ttg mutanis. Arabidopsis Inf Serv 18: 45–51
April 2014 | Volume 56 | Issue 4 | 364–372
372
Li et al.
Kortstee A, Khan S, Helderman C, Trindade L, Wu Y, Visser R, Brendolise C, Allan A, Schouten H, Jacobsen E (2011) Anthocyanin production as a potential visual selection marker during plant transformation. Transgenic Res 20: 1253–1264 Kosieradzka I, Borucki W, Matysiak‐Kata I, Szopa J, Sawosz E (2004) Transgenic potato tubers as a source of phenolic compounds. Localization of anthocyanins in the peridermis. J Anim Feed Sci 13: 87–92 Kumar V, Yadav SK (2012) Overexpression of CsANRincreased flavan‐3‐ ols and decreased anthocyanins in transgenic tobacco. Mol Biotechnol 54: 1–10 Lachman J, Hamouz K (2005) Red and purple coloured potatoes as a significant antioxidant source in human nutrition‐a review. Plant Soil Environ 51: 477 Liu MS, Wang F, Dong YX, Zhang XS (2005) Expression analysis of dihydroflavonol 4‐reductase genes involved in anthocyanin biosynthesis in purple grains of wheat. J Integr Plant Biol 47: 1107–1114 Lukaszewicz M, Matysiak‐Kata I, Skala J, Fecka I, Cisowski W, Szopa J (2004) Antioxidant capacity manipulation in transgenic potato tuber by changes in phenolic compounds content. J Agric Food Chem 52: 1526–1533 Matus J, Poupin M, Cañón P, Bordeu E, Alcalde J, Arce‐Johnson P (2010) Isolation of WDR and bHLH genes related to flavonoid synthesis in grapevine (Vitis vinifera L.). Plant Mol Biol 72: 607–620 Mol J, Grotewold E, Koes R (1998) How genes paint flowers and seeds. Trends Plant Sci 3: 212–217 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15: 473– 497 Neer EJ, Schmidt CJ, Nambudripad R, Smith TF (1994) The ancient regulatory‐protein family of WD‐repeat proteins. Nature 371: 297 Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L (2000) The TT8 gene encodes a basic helix‐loop‐helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12: 1863–1878
scription factors of the anthocyanin pathway. Plant Cell 18: 1274– 1291 Rommens CM, Richael CM, Yan H, Navarre DA, Ye J, Krucker M, Swords K (2008) Engineered native pathways for high kaempferol and caffeoylquinate production in potato. Plant Biotechnol J 6: 870– 886 Sachse J (1973) Anthocyane in den kartoffelsorten Urgenta und Desirée (Solanum tuberosum L.). Z Lebensm Unters Forsch 153: 294– 300 Schaefer HM, Schaefer V, Vorobyev M (2007) Are fruit colors adapted to consumer vision and birds equally efficient in detecting colorful signals? Am Nat 169: S159–S169 Sompornpailin K, Makita Y, Yamazaki M, Saito K (2002) A WD‐repeat‐ containing putative regulatory protein in anthocyanin biosynthesis in Perilla frutescens. Plant Mol Biol 50: 485–495 Stushnoff C, Holm D, Thompson M, Jiang W, Thompson H, Joyce N, Wilson P (2008) Antioxidant properties of cultivars and selections from the Colorado potato breeding program. Am J Potato Res 85: 267–276 Tanaka Y, Sasaki N, Ohmiya A (2008) Biosynthesis of plant pigments: Anthocyanins, betalains and carotenoids. Plant J 54: 733– 749 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 Walker AR, Davison PA, Bolognesi‐Winfield AC, James CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD, Gray JC (1999) The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11: 1337–1349 Xu C, Min J (2011) Structure and function of WD40 domain proteins. Protein Cell 2: 202–214 Yang CQ, Fang X, Wu XM, Mao YB, Wang LJ, Chen XY (2012) Transcriptional regulation of plant secondary metabolism. J Inter Plant Biol 54: 703–712
Pang Y, Wenger JP, Saathoff K, Peel GJ, Wen J, Huhman D, Allen SN, Tang Y, Cheng X, Tadege M (2009) A WD40 repeat protein from Medicago truncatula is necessary for tissue‐specific anthocyanin and proanthocyanidin biosynthesis but not for trichome development. Plant Physiol 151: 1114–1129
Zenoni S, D’Agostino N, Tornielli GB, Quattrocchio F, Chiusano ML, Koes R, Zethof J, Guzzo F, Delledonne M, Frusciante L, Gerats T, Pezzotti M (2011) Revealing impaired pathways in the an11 mutant by high‐throughput characterization of Petunia axillaris and Petunia inflata transcriptomes. Plant J 68: 11–27
Peng Z, Han C, Yuan L, Zhang K, Huang H, Ren C (2011) Brassinosteroid enhances jasmonate‐induced anthocyanin accumulation in Arabidopsis seedlings. J Integr Plant Biol 53: 632–640 Petroni K, Tonelli C (2011) Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant Sci 181: 219–229
Zhang J, Wang LS, Gao JM, Shu QY, Li CH, Yao J, Hao Q, Zhang JJ (2008) Determination of anthocyanins and exploration of relationship between their composition and petal coloration in crape myrtle (Lagerstroemia hybrid). J Integr Plant Biol 50: 581– 588
Quattrocchio F, Verweij W, Kroon A, Spelt C, Mol J, Koes R (2006) PH4 of petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic‐helix‐loop‐helix tran-
Zhao CL, Guo HC, Dong ZY, Zhao Q (2009) Pharmacological and nutritional activities of potato anthocyanins. Afr J Pharm Pharmacol 2: 463–468
April 2014 | Volume 56 | Issue 4 | 364–372
www.jipb.net
Journal of Integrative Plant Biology
Research Article
Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation Wang Li†, Bing Wang†, Man Wang, Min Chen, Jing‐Ming Yin, Ghullam Murtaza Kaleri, Rui‐Jie Zhang, Tie‐Niu Zuo, Xiong You and Qing Yang* College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. †These authors contributed equally to this work. *Correspondence: [email protected]
Abstract Anthocyanins are a class of products of plant secondary metabolism and are responsible for tubers color in potato. The biosynthesis of anthocyanins is a complex biological process, in which multiple genes are involved including structural genes and regulatory genes. In this study, StAN11, a WD40‐repeat gene, was cloned from potato cultivar Chieftain (Solanum tuberosum L.). StAN11 (HQ599506) contained no intron and its open reading frame (ORF) was 1,029 bp long, encoding a putative protein of 342 amino acids. In order to verify its role in anthocyanin biosynthesis, StAN11 was inserted behind the CaMV‐35S promoter of pCMBIA1304 and the recombination vector was introduced into the potato cultivar Désirée plants by Agrobacterium‐mediated transformation. The color of transgenic tuber skin was significantly deepened, compared to the wild‐type control, which was highly consistent with the accumulation of anthocyanin and expression of StAN11 in transgenic lines tuber skin. Further analysis on the expression of Flavonone‐3‐hydroxylase (F3H),
INTRODUCTION Anthocyanins are flavonoid pigments commonly found in plants, where they impart vivid colors to flowers, fruits, and their vegetative tissues (Tanaka et al. 2008; Zhang et al. 2008). Anthocyanins also play important ecophysiological roles in protecting plants from various biotic and abiotic stresses, attracting the insects and animals for pollination, and promoting seed dispersal (Schaefer et al. 2007; Petroni and Tonelli 2011). Furthermore, due to its high antioxidant activity, it is extensively used in human nutrition and treatment as anti‐ cancer, anti‐mutagenic, anti‐microbial, anti‐inflammatory, and anti‐atherosclerotic agents (Butelli et al. 2008; de Pascual‐ Teresa and Sanchez‐Ballesta 2008; Zhao et al. 2009). The action of multiple enzymes encoded by the structural genes is responsible for the synthesis of anthocyanin in many plant species (Holton and Cornish 1995; Liu et al. 2005). It has been known that there are three classes of transcriptional regulators involved in anthocyanin synthesis, which are R2R3‐ MYB, basic helix‐loop‐helix (bHLH), and WD40‐repeat (WDR) proteins, respectively (Grotewold 2006). Combination and interaction of these regulatory proteins determine the set of downstream genes to be expressed (Mol et al. 1998; Koes et al. 2005). In Arabidopsis, the biosynthesis of anthocyanins is April 2014 | Volume 56 | Issue 4 | 364–372
Dihydroflavonol reductase (DFR), Anthocyanidin synthase (ANS), and Flavonoid 3‐O‐glucosyl transferase (3GT) in transgenic plants revealed that only DFR was upregulated. This result suggested that StAN11 regulated anthocyanin biosynthesis in potato by controlling DFR expression and accumulation of anthocyanin could be increased through overexpression of StAN11 in the tubers with the genetic background of anthocyanin biosynthesis. Keywords: Anthocyanin biosynthesis; cloning genetic transformation; potato; StAN11 Citation: Li W, Wang B, Wang M, Chen M, Yin JM, Kaleri GM, Zhang RJ, Zuo TN, You X, Yang Q (2014) Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation. J Integr Plant Biol 56: 364–372. doi: 10.1111/jipb.12136 Edited by: Shan Lu, Nanjing University, China Received Aug. 25, 2013; Accepted Nov. 25, 2013 Available online on Dec. 4, 2013 at www.wileyonlinelibrary.com/ journal/jipb © 2013 Institute of Botany, Chinese Academy of Sciences
mainly regulated by a ternary complex TTG1/bHLH/MYB by activating the structural genes DFR an LDOX (Cominelli et al. 2008; Gonzalez et al. 2008). Anthocyanin accumulation induced by blue light and jasmonate might also be mediated by the WD‐repeat/Myb/bHLH transcriptional complexes in Arabidopsis Seedlings (Chen et al. 2006; Peng et al. 2011). In potato, the MYB tissue‐special transcription factor (TF) StMtf1 and StAN2 were successfully isolated and they have all been shown to be involved in the regulation of anthocyanin biosynthesis (Rommens et al. 2008; Jung et al. 2009). In recent years, numerous WD40‐repeat TF about anthocyanin synthesis have been well characterized in Arabidopsis, maize, petunia and snapdragon, and all of them contain a special highly conserved tryptophan‐aspartate (WD) repeat, but have no intrinsic enzyme or TF activity so far (Xu and Min 2011; Davies et al. 2012). In Arabidopsis, TTG1 encoding a WD40‐repeat protein was demonstrated to be involved in the formation and stability of MBW complex that control the biosynthesis of anthocyanins and the formation of trichomes and root hairs (Broun 2005; Feller et al. 2011), while the mutant ttg1 lacks anthocyanins in all tissues (Koornneef 1981). Homologs of this gene have been identified in other plant species, such as AN11 from Petunia hybrid (de Vetten et al. 1997), PAC1 from Zea mays (Carey et al. 2004), MtWD40‐1 from www.jipb.net
A WD40‐repeat gene StAN11 in potato Matthiola incana (Pang et al. 2009). WDR could also promote the nuclear localization of bHLH in Perilla frutescens (Sompornpailin et al. 2002), and was likely to be involved in post‐translational control of MYB (de Vetten et al. 1997) and control of vacuolar pH and the morphology of the seed coat epidermis in P. hybrid (Quattrocchio et al. 2006; Zenoni et al. 2011). Most isolated WD‐repeat proteins were shown to be essential for anthocyanin biosynthesis regulation. Colored potato tubers contain abundant anthocyanins and are widely recognized as a potent source of antioxidants for human health (De Jong et al. 2004; Stushnoff et al. 2008). As the interest in anthocyanin‐rich potatoes increases and the science of biotechnology develops, metabolic engineering is a popular method to obtain new potato species by overexpressing key regulatory genes (Kosieradzka et al. 2004; Lukaszewicz et al. 2004). Jung’s report indicated that overexpression of the regulatory gene StAN2 in potato could improve tuber anthocyanin content (Jung et al. 2009). AN11, a regulatory gene encoding a WD40‐repeat protein, has been first identified in P. hybrid, but it has not been reported in potato. In this paper, the StAN11 gene was isolated from potato cultivar Chieftain and its function was analyzed by overexpression of the gene in potato cultivar Désirée.
RESULTS The StAN11 gene is a homolog of a regulatory gene that is involved in anthocyanin biosynthesis pathway The full length of the StAN11 cDNA was obtained using a pair of specific primers designed according to the assembled sequence of the gene. Two 1,100 bp fragments were separately amplified from the cDNA and genomic DNA of potato. The sequence was deposited in GenBank (accession number HQ599506). StAN11 contained an open reading frame (ORF) of 1,029 bp, encoding a protein of 342 amino acids with a molecular mass of 38.3 kDa and an isoelectric point (pI) of 4.95. Comparison of the cDNA and DNA sequences showed that the StAN11 gene had no intron. Comparison of the StAN11 protein sequence with those from other plants in the Genbank and EMBL databases indicated that it had a significant sequence similarity with NcWDR (93.86%), PhAN11 (88.63%), MdTTG1 (83.33%), and VvWD40 (80.70%), respectively (Figure 1A). All of these genes are involved in anthocyanin biosynthesis pathway (Ben‐Simhon et al. 2011). Conserved domain analysis of StAN11 protein revealed that it contained four WD‐repeat motifs (the amino acid residues are at 67–112, 117–162, 165–203, and 254–294) and a 40‐amino acid stretch typically ending in Trp‐Asp (Figure 1B). In three‐ dimensional structure, StAN11 comprised three sheets, which contained 11 strands and nine beta hairpins (Figure 1C). Further, a phylogenetic tree was constructed using StAN11 and its homologous proteins from 12 species in GenBank (Figure 2). StAN11 was clustered in a clade and group with VvWDR1 from Vitis vinifera. Tissue expression pattern of StAN11 To study the expression pattern of StAN11 gene, StAN11 mRNA levels were measured in various tissues of cultivar Chieftain by semi‐quantitative reverse transcription‐polymerase chain reaction (RT‐PCR). As shown in Figure 3, StAN11 transcript could www.jipb.net
365
be detected in all the tissues with a highest level in stolon and a lowest one in roots (Figure 3). Production of StAN11 transgenic potato plants For transformation, the expression vector pCMBIA1304‐StAN11 was constructed (Figure 4A) and examined by PCR (Figure 4B). Transformation of Désirée plants was performed using Aagrobacterium tumefaciens‐mediated method and regeneration of transgenic plants was shown in Figure 4C. The potato callus were induced on the stem explants 2 weeks after infection with A. tumefaciens and shoots regenerated about 4 weeks later. When the shoots grew up to 2–3 cm high, they were placed on rooting medium for Hyg B selection. Surviving shoots were transplanted in pots in a greenhouse. In total, 17 Hyg B‐resistant lines were obtained and examined for transgene insertion by PCR. Six lines showed an expected 837 bp amplification band and no band appeared in the Désirée control (Figure 5A). In order to know whether StAN11 expresses in the PCR‐positive plants, semi‐quantitative RT‐PCR analysis was carried out with potato leaves. The result showed that the level of StAN11 transcript was noticeably higher in the transgenic lines than that in the control (Figure 5B). This result confirmed that StAN11 was successfully overexpressed in six transgenic potato lines. Overexpression of StAN11 promotes anthocyanin accumulation in transgenic potato tuber skin The colors of 50‐day‐old tubers looked distinctly different between transgenic tubers and wild‐type tubers, the former appearing purple while the latter was light‐red (Figure 6). To clarify the relation between tuber color and anthocyanins, the content of anthocyanins in tuber skin was analyzed (Figure 7A). The result showed that the contents of anthocyanins in all the transgenic lines selected were higher than in the control, about two‐ to sixfold. We further examined the expression level of StAN11 in the tubers of the transgenic lines. The qRT‐PCR result showed that StAN11 expression was increased with different degrees, which was consistent with the results of anthocyanin measurement in these lines (Figure 7B). This result indicated that the expression of StAN11 increased the accumulation of anthocyanin in transgenic potato lines. StAN11 modulates the expression of StDFR in potato To elucidate how StAN11, as a regulatory gene, modulates structural genes in anthocyanin biosynthesis, the expression of StF3H, StDFR, StANS, and St3GT was examined in the leaves and tubers of transgenic line 2 using semi‐quantitative PCR (Figure 8). The result showed that the expression of StDFR was remarkably increased in transgenic tubers compared to wild‐type control but no difference was observed for StF3H, St3GT, and StANS. This result suggested that StDFR was the target of StAN11 in the biosynthesis of potato anthocyanins.
DISCUSSION In recent years, due to the role of anthocyanins in human health, there has been a growing interest in the development of colored potato rich in anthocyanins (Brown et al. 2003; Lachman and Hamouz 2005). The requirement of colored potato breeding promoted studies on the mechanism of April 2014 | Volume 56 | Issue 4 | 364–372
366
Li et al.
Figure 1. Sequence alignment of StAN11 and the Domain architecture and Tertiary structure model analysis of StAN11 (A) Alignment of StAN11 and its homologs. NcWDR (FJ795022), PhAN11 (U94748), MdWD40 (AAF27919), and VvWDR1 (ABF66625). Fully conserved resides are highlighted with a black background and 75% conserved resides by a grey background. (B) The Domain architecture analysis of StAN11 (http://smart.embl‐heidelberg.de/). The WD40 repeat domains are indicated with green triangle. (C) Tertiary structure model of StAN11 (http://swissmodel.expasy.org/workspace). The strands and beta hairpins are shown by sheets and lines, respectively.
anthocyanin biosynthesis in this species. Following identification of structural genes in anthocyanins biosynthetic pathway, some of its regulatory genes such as StAN1b (JX848660) and StAN2 (Jung et al. 2009) were also isolated. These genes belong to bHLH and MYB, respectively. In this study, we cloned April 2014 | Volume 56 | Issue 4 | 364–372
an anthocyanin biosynthesis regulatory gene named StAN11, which belonged to a WD40 gene family, from potato cultivar Chieftain. The gene coding protein shared high sequence identity and close phylogenetic relationship with grapevine VvWDR1 (Matus et al. 2010). www.jipb.net
A WD40‐repeat gene StAN11 in potato
Figure 2. Phylogenetic analysis of StAN11and its homologous proteins from different species Arabidopsis thaliana (AtAN11, NP172751), A. thaliana (AtTTG1, NP851069), Caragana jubata (CjWDR1, ABQ18246), Cucmis sativus (CsTTG, ABY64743), Ipomoea nil (InWD40, BAE94405), Malus domestica (MdTTG1, AAF27919), Medicago truncatula (MtWD40, ABW08112), Nicotiana tabacum (NtWDR, ACT35693), Perilla frutescens (PfAN11, BAB58883), Petunia hybrida (PhAN11, AAC18914), Ricinus communis (RcAN11, XP002530884), Saussurea medusa (SmTTG1, ACN58396), and Vitis vinifera (VvWDR, ABF66625).
Figure 3. Expression analysis of StAN11 in different tissues RT‐PCR was performed on total RNAs from different tissues as indicated. 28 cycles were performed for amplification of StAN11. 1, root; 2, stem; 3, leaf; 4, bud; 5, stolon; 6, mature tuber. www.jipb.net
367
In anthocyanin biosynthesis, WD40 protein plays a role in favor of protein–protein interactions between MYB and bHLH regulators (Baudry et al. 2004). The protein has a common and defining feature of WD40 motif, a 40‐amino acid stretch typically ending in Trp‐Asp (Neer et al. 1994). The motif is found as several repeated units in tandem in a typical WD40 protein and at least four WD40‐repeats are believed to be required to form a higher‐ order and functional structure (Chothia et al. 1997). In this study, StAN11 contains four WD40 motifs and is consistent with WD40 proteins from other species in structure. The expression of AN11 often exhibited in specific tissues, such as a higher level detected in floral buds in Arabidopsis thaliana (Walker et al. 1999), while high expression level was observed in fruit in Malus domestica (Brueggemann et al. 2010) In this study, StAN11 transcript can be detected in all the tissues of Chieftain, but the highest level was observed in buds and stolons. This specificity of expression could relate to the functional site of the gene. The ectopic expression of anthocyanins biosynthetic regulatory genes has been studied in some plants such as in Arabidopsis, where the expression of the grapevine VvWDR1 and apple MdTTG1 enhanced anthocyanin accumulation in transgenic plants (Matus et al. 2010; An et al. 2012). In potato, the overexpression of StAN2 in transgenic Désirée potato deepened the color of tuber skin (Jung et al. 2009). In this study, the overexpression of StAN11 resulted in significant increase in anthocyanin content in transgenic potato lines. This result suggests that StAN11 plays an important role in the regulation of potato anthocyanin biosynthesis. In plant transformation, some variation among transgenic lines is often observed, which is probably caused by inserted copy number, position of integration or silencing of the transgene (Kortstee et al. 2011). In this study, a similar result was found and anthocyanin contents among four transgenic lines were quite different. This difference totally conforms to the transcriptional expression of StAN11 gene in these transgenic lines (Figure 7). To clarify the regulatory mechanism of the StAN11 gene on anthocyanin biosynthesis, we detected the expression of four anthocyanin biosynthetic structural genes StF3H, StDFR, StANS, and St3GT in transgenic line 2. Of the genes examined, only StDFR showed upregulated expression. This result reveals that StAN11 could regulate anthocyanin biosynthesis in potato tubers by modulating StDFR expression and further confirms that DFR was the target of a regulatory complex MYB/WD40/ bHLH in Arabidopsis (Nesi et al. 2000; Yang et al. 2012). In summary, in this study we cloned a WD40‐repeat gene StAN11 from potato cultivar Chieftain using RT‐PCR. Function analysis indicated StAN11 gene was involved in the regulation of potato anthocyanin biosynthesis, in which structural gene StDFR was its target. This result provides valuable evidence for its application in the improvement in the anthocyanin content of potato varieties, and may also improve our ability to develop novel biotechnological tools for the generation of new potato cultivars with enhanced anthocyanin content by utilizing molecular‐genetic approaches.
MATERIALS AND METHODS Plant materials and growth conditions In vitro tubers of potato cultivar Chieftain (Solanum tuberosum L.) were grown in a greenhouse with natural light. After April 2014 | Volume 56 | Issue 4 | 364–372
368
Li et al.
Figure 4. Genetic transformation and plant regeneration of potato with StAN11 gene (A) Schematic representation of the T‐DNA region of pCAMBIA1304‐StAN11 vector. LB, T‐DNA left border; HYG, hygromycin (R); 35S‐P, cauliflower mosaic virus. 35S promoter; lacZ, lacZ lapha; GFP, GFP; gusA, gusA; nos, Nos poly‐A; RB, T‐DNA right border. (B) Agarose gel electrophoresis of PCR amplification of StAN11. M, DL2000 marker; 1, water control; 2, ORF of StAN11. (C) Regeneration of StAN11 transgenic potato. a, callus formation on stem explants; b, shoot formation; c, the selection of transgenic shoots; d, plant in pot.
1 month, the younger leaves were collected for extraction of RNA and DNA. After 2 months, roots, stem, leaves, bud, and tuber were taken for spatial expression analysis of StAN11.
Figure 5. Identification of transgenic potato lines (A) PCR analysis of genomic DNA from Hygromycin B‐resistant potato. P, plasmid containing the potato pCAMBIA1304‐StAN11 (positive control); WT, potato Désirée (negative control); M, DL2000 marker, 1–7, Hygromycin B‐resistant plants. (B) Semi‐ quantitative PCR confirmed expression of StAN11 in leaves of transgenic potato lines. WT, potato Désirée (control); 1, 2, 3, 4, 5, 7, transgenic potato lines. April 2014 | Volume 56 | Issue 4 | 364–372
In vitro plantlets of potato cultivar Désirée (S. tuberosum L.), which were obtained from established tissue cultures in the lab, were cultured on MS medium (Murashige and Skoog 1962) containing 30 g/L sucrose and 0.8% agar at pH 5.8 in a climate chamber with a day/night cycle of 12/12 h at 24 °C. The stem segments of 4‐week‐old plantlets were used as explants for a transformation experiment. Isolation of StAN11 cDNA and genomic DNA Total RNA was isolated from 0.1 g of fresh leaves of “Chieftain” with total RNA isolation reagent and treated with DNase prior (TaKaRa Biotech, Dalian, China). Integrity was confirmed by gel electrophoresis in a 1% agarose gel. RNA concentration was determined by absorbance at 260 nm and purity was established with a 260/280 ratio. First‐strand cDNA was synthesized with M‐MLV reverse transcriptase from Promega (Madison, WI, USA) according to the manufacturer’s instructions. All the PCR was carried out in 1 mL of the prepared cDNA, 25 mL in 1 Taq reaction buffer containing 2.5 mM MgCl2, 250 nM each dNTP, 1 mM each primer and 2.5 U Taq polymerase (TaKaRa Biotech). The full length of the StAN11 cDNA was amplified with gene‐specific forward primers (50 ‐TCAAAATGGAGAATTCAAGTC‐ 30 ) and reverse primers (50 ‐TCTTACAGGAAAAATTC AATCAT‐30 ) designed according to the cDNA sequence of PhAN11(U94748), NcWDR (GQ260131), and InWD40 (AB232779). The amplification condition was 5 min at 94 °C, then 35 cycles of 40 s at 94 °C, 40 s at 52 °C, 1 min at 72 °C, then with a final extension for 10 min at 72 °C. www.jipb.net
A WD40‐repeat gene StAN11 in potato
369
Figure 6. Foliage and tuber phenotypes of transgenic Désirée of 50 days old WT, potato Désirée; Control, transgenic Désirée expressing empty vector pCAMBIA1304; 2, transgenic line 2 transformed with pCAMBIA1304‐StAN11.
Genomic DNA was isolated from young potato leaves by cetyl trimethylammonium bromide (CTAB) method (Hu et al. 2003). StAN11 DNA sequence was obtained from direct PCR of genomic DNA using the same gene‐specific primers above. All PCR products were separated on 1% agarose gels and target DNA bands were recovered by gel extraction, then cloned into pMD19‐T vector (TaKaRa Biotech), and finally
transformed into competent cells of Escherichia coli strain DH5a. White colonies were checked by PCR and the positive colonies were sequenced. Sequence analysis of StAN11 The comparative sequence analyses were performed using BLASTP (Altschul et al. 1997) search at National Center for Biotechnology Information (NCBI)with StAN11 as a query.
Figure 7. Analysis of anthocyanin contents and StAN11 expression intransgenic potato (A) Anthocyanin contents in tuber skins of transgenic potato lines and control plants. Con, Désirée expressing empty vector; 1, 2, 5, 7, transgenic lines. Significance is determined by t‐test (P < 0.05). Values are means SD (n ¼ 3). (B) Quantitative RT‐PCR expression analysis of the StAN11 in the tubers of 50‐day‐old transgenic plants. Con, Désirée expressing empty vector; 1, 2, 5, 7, transgenic lines. Significance is determined by t‐test (P < 0.05). Values are means SD (n ¼ 3). www.jipb.net
April 2014 | Volume 56 | Issue 4 | 364–372
370
Li et al. Construction of pCMBIA1304‐StAN11 vector The StAN11 ORF was amplified with PCR using forward primer (50 ‐ CATGCCATGGAAAATTCAAGTCAAG‐30 ; the restriction site is underlined) and reverse primer (50 ‐GGAAGATCTTCTTACAGGAAAAATTCAATCAT‐30 ). The PCR product was confirmed by sequencing and then inserted into pCMBIA1304 behind 35S promoter. The recombination vector, named as pCMBIA1304‐ StAN11, was transformed into Agrobacterium strain GV3101 using the freeze–thaw method (Hofgen and Willmitzer 1988).
Figure 8. Expression levels of 4 anthocyanin biosynthetic genes in Désirée plant expressing empty vector (Control) and StAN11 transgenic potato line 2 of 50 days old
Multiple sequence alignment and phylogenetic analysis were done using DNAMAN program. Conserved domain analysis was done using SMART (http://smart.embl‐heidelberg.de/). Swiss Model Server was used for prediction of protein tertiary structure (http://swissmodel.expasy.org/workspace). The phylogenetic tree of the AN11 protein was constructed using neighbor‐joining (NJ) method through MEGAv 4.1. Bootstrap test of phylogeny was analyzed with 1,000 replications (Thompson et al. 1994). Tissue expression analysis of StAN11 For the spatial expression studies, RNA was extracted from roots, stem, leaves, buds, and tubers of “Chieftain” and treated with DNase prior (TaKaRa Biotech). First‐strand cDNA was synthesized with M‐MLV reverse transcriptase from Promega according to the manufacturer’s instructions. The conserved region of StAN11 cDNA was specifically amplified by the primers AN11‐S and AN11‐A (Table 1). A 350 bp fragment was amplified as RNA standard with the primers: GAPDH‐S (50 ‐TCAACGAGAATGAATACAAGCCA‐30 ) and GAPDH‐A (50 ‐TCGACAACA GA AACATCAGCAGT‐30 ), which were designed according to the potato StGAPDH (glyceraldehyde‐3‐phosphate dehydrogenase) sequence. All the PCRs were performed under the following reaction condition: 5 min at 94 °C; then, 35 cycles of 40 s at 94 °C, 40 s at 54 °C, 1 min at 72 °C; then with a final extension step for 10 min at 72 °C. PCRs were amplified for 28 cycles. Table 1. Oligo nucleotide primers used for semi‐quantitative RT‐PCR Primer
Sequence (50 –30 )
AN11‐S AN11‐A F3H‐S F3H‐A DFR‐S DFR‐A ANS‐S ANS‐A 3GT‐S 3GT‐A EF‐1a‐S EF‐1a‐A
TGGAATGAAGTTGAGCCTAAAAG CAGCAGAGTACATCGACATGGGATC GGCTTCAACACTAACAGCTCTA ACTTAAGCAAGAATTTCCTCAA GATTTATCGGCTCTTGGCTTGT GTGCATTCTCCTTGCCACTTGA ACCCTCTGGTAATGTCCAAGGCTAT TCTTGTACTTTCCGTTGCTTAGGAT CTTCTCAACTTCATATTGCACT GCTTGTGACATTTAACTAGCTC ATTCAAGTATGCCTGGGTGCT GTGGTGGAGTCAATAATGAGGAC
April 2014 | Volume 56 | Issue 4 | 364–372
Potato transformation and regeneration Segments of Stem (0.5–1.0 cm) of 4‐week‐old potato plantlets were pre‐cultured on Y2 medium (MS þ 2 mg/L 6‐Benzylaminopurine þ 0.2 mg/L a‐naphthalene acetic acid þ 0.2 mg/L 2, 4‐ dichlorophenoxy acetic acid) in darkness at 24 °C for 2 d, and immersed in bacterial suspension of A. tumefaciens (optical density, OD600 ¼ 0.6) carrying the pCMBIA1304‐StAN11 plasmids for 8 min, after which they were co‐cultivated on Y2 medium for 2 d with the same conditions above. Then the infected Stem segments were replaced onto MGT medium (MS þ 0.03 mg/L gibberellic acid þ 0.5 mg/L N‐phenyl‐N0 ‐1, 2, 3‐ thidiazol‐5‐yl‐urea þ 200 mg/L Cefotaxime þ 10 mg/L Hygromycin B) and were cultured under a photoperiod of 12/12 h at 24 °C for callus induction. After 4 weeks, regenerated shoots were harvested from stem segments, which were placed on MS medium containing 10 mg/L Hyg B to test for rooting. The Hyg B‐resistant plants were grown in the greenhouse. PCR identification of transgenic plants To identify transgenic plants, genomic DNA was extracted from the leaves of the Hyg B‐resistant plants and wild‐type Désirée plant, respectively. The transgenic potato lines were identified by PCR using forward primer (50 ‐TTGCCATTGCGTTTTCTAAC‐30 ) and reverse primer (50 ‐TCACGGGTTGGGGTTTCTAC‐30 ), under the following reaction program: 94 °C for 4 min, followed by 35 cycles of 30 s at 94 °C, 30 s at 56 °C, 40 s at 72 °C, and 10 min extension at 72 °C. The PCR product was expected to be a 837 bp fragment containing the partial sequence of pCAMBIA1304 vector and the partial sequence of StAN11 ORF. qRT‐PCR analysis of StAN11 expression The transcript levels of the StAN11 gene in transgenic potato were measured by Quantitative RT‐PCR. The total RNA was isolated from the tuber skin of 50‐day‐old empty‐control and transgenic potato lines and treated with DNase prior (TaKaRa Biotech). The synthesis of first‐strand cDNA was the same as above. StEF‐1a gene (Eukaryotic elongation factor 1a) was used as an internal control and specific primers were designed for qRT‐PCR, forward primer (50 ‐AGTTTTTGCGTCCGTTTCTG‐30 ) and reverse primer (50 ‐ACACTCGCCTGATGCCTTT‐30 ). It is carried out by using SYBR Premix Ex Taq reaction system (TaKaRa Biotech) on the ABI PRISM 7500HT FAST Real‐Time PCR System. We used comparative Ct method to calculate the expression levels of StAn11 (Applied Biosystems, Foster City, CA, USA). All qRT‐ PCR analysis for each sample was repeated three times. Extraction and content analysis of anthocyanins Total anthocyanins were extracted from the tuber skin of 50‐day‐old transgenic and wild‐type potato using the method as described by Kumar and Yadav (2012). One hundred milligrams of tuber skin was soaked using 1 mL methanol www.jipb.net
A WD40‐repeat gene StAN11 in potato
371
containing 1% HCl (v:v) for 12 h in darkness after 50 d of growth. The total volume of the supernatant was brought up to 10 mL with extracting solvent after centrifugation at 6 000 g at 4 °C for 10 min. Measurement was done on the UV‐Vis spectrophotometry at 520 nm and repeated three times. The anthocyanin content was calculated as pelargonidin equivalents (Sachse 1973).
Brueggemann J, Weisshaar B, Sagasser M (2010) A WD40‐repeat gene from Malus domestica is a functional homologue of Arabidopsis thaliana TRANSPARENT TESTA GLABRA1. Plant Cell Rep 29: 285– 294
Semi‐quantitative RT‐PCR analysis of structural genes Total RNA was isolated from the 50‐day‐old transgenic and Désirée plants using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and treated with DNase prior (TaKaRa Biotech). cDNA was prepared using oligo (dT) and a reverse transcription system kit (TaKaRa Biotech). The expression level of four anthocyanin biosynthesis genes StF3H, StDFR, StANS, and St3GT was estimated semi‐quantitatively by altering the cycles of PCR amplification with the primers described in Table 1. Potato EF‐ 1a gene was used as an internal control for normalizing the level of the transcripts to be tested. The amplified products were separated on 1% agarose gel and visualized with ethidium bromide staining.
Carey CC, Strahle JT, Selinger DA, Chandler VL (2004) Mutations in the pale aleurone color1 regulatory gene of the Zea mays anthocyanin pathway have distinct phenotypes relative to the functionally similar TRANSPARENT TESTA GLABRA1 gene in Arabidopsis thaliana. Plant Cell 16: 450–464
ACKNOWLEDGEMENTS We specially thank Professor Xiu‐Qing Li and Miss Chidie Yang for assistance in writing the manuscript. This study was supported financially by grants from the Jiangsu Agricultural Science and Technology Innovation Fund (cx (11)1020), National Natural Science Foundation of China (11171155), and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions: Modern horticultural science (PAPD).
REFERENCES Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI‐BLAST: A new generation of protein database search programs. Nucleic Acids Res 25: 3389– 3402 An XH, Tian Y, Chen KQ, Wang XF, Hao YJ (2012) The apple WD40 protein MdTTG1 interacts with bHLH but not MYB proteins to regulate anthocyanin accumulation. J Plant Physiol 169: 710– 717 Baudry A, Heim MA, Dubreucq B, Caboche M, Weisshaar B, Lepiniec L (2004) TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J 39: 366–380 Ben‐Simhon Z, Judeinstein S, Nadler‐Hassar T, Trainin T, Bar‐Ya’akov I, Borochov‐Neori H, Holland D (2011) A pomegranate (Punica granatum L.) WD40‐repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development. Planta 234: 865–881 Broun P (2005) Transcriptional control of flavonoid biosynthesis: A complex network of conserved regulators involved in multiple aspects of differentiation in Arabidopsis. Curr Opin Plant Biol 8: 272–279 Brown C, Wrolstad R, Durst R, Yang C‐P, Clevidence B (2003) Breeding studies in potatoes containing high concentrations of anthocyanins. Am J Potato Res 80: 241–249
www.jipb.net
Butelli E, Titta L, Giorgio M, Mock H‐P, Matros A, Peterek S, Schijlen EG, Hall RD, Bovy AG, Luo J (2008) Enrichment of tomato fruit with health‐promoting anthocyanins by expression of select transcription factors. Nat Biotechnol 26: 1301–1308
Chen DQ, Li ZY, Pan RC, Wang XJ (2006) Anthocyanin accumulation mediated by blue light and cytokinin in Arabidopsis seedlings. J Integr Plant Biol 48: 420–425 Chothia C, Hubbard T, Brenner S, Barns H, Murzin A (1997) Protein folds in the all‐b and all‐a classes. Annu Rev Biophys Biomol Struct 26: 597–627 Cominelli E, Gusmaroli G, Allegra D, Galbiati M, Wade HK, Jenkins GI, Tonelli C (2008) Expression analysis of anthocyanin regulatory genes in response to different light qualities in Arabidopsis thaliana. J Plant Physiol 165: 886–894 Davies KM, Albert NW, Schwinn KE (2012) From landing lights to mimicry: The molecular regulation of flower colouration and mechanisms for pigmentation patterning. Funct Plant Biol 39: 619– 638 De Jong W, Eannetta N, De Jong D, Bodis M (2004) Candidate gene analysis of anthocyanin pigmentation loci in the Solanaceae. Theor Appl Genet 108: 423–432 de Pascual‐Teresa S, Sanchez‐Ballesta MT (2008) Anthocyanins: From plant to health. Phytochem Rev 7: 281–299 de Vetten N, Quattrocchio F, Mol J, Koes R (1997) The an11 locus controlling flower pigmentation in petunia encodes a novel WD‐ repeat protein conserved in yeast, plants, and animals. Gene Dev 11: 1422–1434 Feller A, Machemer K, Braun EL, Grotewold E (2011) Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J 66: 94–116 Gonzalez A, Zhao M, Leavitt JM, Lloyd AM (2008) Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J 53: 814– 827 Grotewold E (2006) The genetics and biochemistry of floral pigments. Annu Rev Plant Biol 57: 761–780 Hofgen R, Willmitzer L (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res 16: 9877–9877 Holton TA, Cornish EC (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7: 1071 Hu J, Nakatani M, Lalusin AG, Kuranouchi T, Fujimura T (2003) Genetic analysis of sweetpotato and wild relatives using inter‐simple sequence repeats (ISSRs). Breed Sci 53: 297–304 Jung CS, Griffiths HM, De Jong DM, Cheng S, Bodis M, Kim TS, De Jong WS (2009) The potato developer (D) locus encodes an R2R3 MYB transcription factor that regulates expression of multiple anthocyanin structural genes in tuber skin. Theor Appl Genet 120: 45–57 Koes R, Verweij W, Quattrocchio F (2005) Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci 10: 236–242 Koornneef M (1981) The complex syndrome of ttg mutanis. Arabidopsis Inf Serv 18: 45–51
April 2014 | Volume 56 | Issue 4 | 364–372
372
Li et al.
Kortstee A, Khan S, Helderman C, Trindade L, Wu Y, Visser R, Brendolise C, Allan A, Schouten H, Jacobsen E (2011) Anthocyanin production as a potential visual selection marker during plant transformation. Transgenic Res 20: 1253–1264 Kosieradzka I, Borucki W, Matysiak‐Kata I, Szopa J, Sawosz E (2004) Transgenic potato tubers as a source of phenolic compounds. Localization of anthocyanins in the peridermis. J Anim Feed Sci 13: 87–92 Kumar V, Yadav SK (2012) Overexpression of CsANRincreased flavan‐3‐ ols and decreased anthocyanins in transgenic tobacco. Mol Biotechnol 54: 1–10 Lachman J, Hamouz K (2005) Red and purple coloured potatoes as a significant antioxidant source in human nutrition‐a review. Plant Soil Environ 51: 477 Liu MS, Wang F, Dong YX, Zhang XS (2005) Expression analysis of dihydroflavonol 4‐reductase genes involved in anthocyanin biosynthesis in purple grains of wheat. J Integr Plant Biol 47: 1107–1114 Lukaszewicz M, Matysiak‐Kata I, Skala J, Fecka I, Cisowski W, Szopa J (2004) Antioxidant capacity manipulation in transgenic potato tuber by changes in phenolic compounds content. J Agric Food Chem 52: 1526–1533 Matus J, Poupin M, Cañón P, Bordeu E, Alcalde J, Arce‐Johnson P (2010) Isolation of WDR and bHLH genes related to flavonoid synthesis in grapevine (Vitis vinifera L.). Plant Mol Biol 72: 607–620 Mol J, Grotewold E, Koes R (1998) How genes paint flowers and seeds. Trends Plant Sci 3: 212–217 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15: 473– 497 Neer EJ, Schmidt CJ, Nambudripad R, Smith TF (1994) The ancient regulatory‐protein family of WD‐repeat proteins. Nature 371: 297 Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L (2000) The TT8 gene encodes a basic helix‐loop‐helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12: 1863–1878
scription factors of the anthocyanin pathway. Plant Cell 18: 1274– 1291 Rommens CM, Richael CM, Yan H, Navarre DA, Ye J, Krucker M, Swords K (2008) Engineered native pathways for high kaempferol and caffeoylquinate production in potato. Plant Biotechnol J 6: 870– 886 Sachse J (1973) Anthocyane in den kartoffelsorten Urgenta und Desirée (Solanum tuberosum L.). Z Lebensm Unters Forsch 153: 294– 300 Schaefer HM, Schaefer V, Vorobyev M (2007) Are fruit colors adapted to consumer vision and birds equally efficient in detecting colorful signals? Am Nat 169: S159–S169 Sompornpailin K, Makita Y, Yamazaki M, Saito K (2002) A WD‐repeat‐ containing putative regulatory protein in anthocyanin biosynthesis in Perilla frutescens. Plant Mol Biol 50: 485–495 Stushnoff C, Holm D, Thompson M, Jiang W, Thompson H, Joyce N, Wilson P (2008) Antioxidant properties of cultivars and selections from the Colorado potato breeding program. Am J Potato Res 85: 267–276 Tanaka Y, Sasaki N, Ohmiya A (2008) Biosynthesis of plant pigments: Anthocyanins, betalains and carotenoids. Plant J 54: 733– 749 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 Walker AR, Davison PA, Bolognesi‐Winfield AC, James CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD, Gray JC (1999) The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11: 1337–1349 Xu C, Min J (2011) Structure and function of WD40 domain proteins. Protein Cell 2: 202–214 Yang CQ, Fang X, Wu XM, Mao YB, Wang LJ, Chen XY (2012) Transcriptional regulation of plant secondary metabolism. J Inter Plant Biol 54: 703–712
Pang Y, Wenger JP, Saathoff K, Peel GJ, Wen J, Huhman D, Allen SN, Tang Y, Cheng X, Tadege M (2009) A WD40 repeat protein from Medicago truncatula is necessary for tissue‐specific anthocyanin and proanthocyanidin biosynthesis but not for trichome development. Plant Physiol 151: 1114–1129
Zenoni S, D’Agostino N, Tornielli GB, Quattrocchio F, Chiusano ML, Koes R, Zethof J, Guzzo F, Delledonne M, Frusciante L, Gerats T, Pezzotti M (2011) Revealing impaired pathways in the an11 mutant by high‐throughput characterization of Petunia axillaris and Petunia inflata transcriptomes. Plant J 68: 11–27
Peng Z, Han C, Yuan L, Zhang K, Huang H, Ren C (2011) Brassinosteroid enhances jasmonate‐induced anthocyanin accumulation in Arabidopsis seedlings. J Integr Plant Biol 53: 632–640 Petroni K, Tonelli C (2011) Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant Sci 181: 219–229
Zhang J, Wang LS, Gao JM, Shu QY, Li CH, Yao J, Hao Q, Zhang JJ (2008) Determination of anthocyanins and exploration of relationship between their composition and petal coloration in crape myrtle (Lagerstroemia hybrid). J Integr Plant Biol 50: 581– 588
Quattrocchio F, Verweij W, Kroon A, Spelt C, Mol J, Koes R (2006) PH4 of petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic‐helix‐loop‐helix tran-
Zhao CL, Guo HC, Dong ZY, Zhao Q (2009) Pharmacological and nutritional activities of potato anthocyanins. Afr J Pharm Pharmacol 2: 463–468
April 2014 | Volume 56 | Issue 4 | 364–372
www.jipb.net
