\. 1991 Oxford University Press

Nucleic Acids Research, Vol. 19, No. 5 1007

Cloning and characterization of the Mboll restrictionmodification system Hubertus Bocklage, Karin Heeger and Benno MulIer-Hill* Institut fur Genetik der Universitat zu Koln, Weyertal 121, 5000 Koln 41, FRG Received January 4, 1991; Revised and Accepted February 8, 1991

ABSTRACT The two genes encoding the class IIS restrictionmodification system Mboll from Moraxella bovis were cloned separately in two compatible plasmids and expressed in E. coil RR1AM15. The nucleotide sequences of the Mboll endonuclease (R.Mboll) and methylase (M.Mboll) genes were determined and the putative start codon of R.Mboll was confirmed by amino acid sequence analysis. The mbollR gene specifies a protein of 416 amino acids (MW: 48,617) while the mbollM gene codes for a putative 260-residue polypeptide (MW: 30,077). Both genes are aligned in the same orientation. The coding region of the methylase gene ends 11 bp upstream of the start codon of the restrictase gene. Comparing the amino acid sequence of M.Mboll with sequences of other N6-adenine methyltransferases reveals a significant homology to M.Rsrl, M.Hinfi and M.DpnA. Furthermore, M.Mboll shows homology to the N4-cytosine methyltransferase BamHl. INTRODUCTION Class IIS restriction endonucleases (ENases) and methyltransferases (MTases) are enzymes that recognize specific, mostly asymmetric DNA sequences 4-6 bp in length (1). ENases cleave within both DNA strands at fixed positions 1 to 20 bases to the right of their target site. MTases modify DNA by the addition of a methylgroup either at adenines or at cytosines in the recognition sequence (2). Like the enzymes of class II R-M systems, ENases require only Mg++ ions, and MTases need only S-adenosylmethionine (AdoMet) as sole cofactor. A recent compilation of R-M systems listed 28 enzymes belonging to class IIS (3). Class IIS enzymes appear especially suited as model proteins to study protein-DNA interaction, because the spatial separation of their DNA recognition and cleavage sites suggests a two domain structure: one being necessary for DNA recognition, the second bearing the catalytic center to introduce a double strand break into the DNA. If so, the different functions could be uncoupled. DNA specificity may then be altered by switching domains as has been achieved in phage repressors (4), whereas *

To whom correspondence should be addressed

EMBL accession no. X56977

abolishing catalytic activity should not affect the sequence specificity of binding. Moreover, a thorough examination of the structural and functional features of class US ENases may help to improve our knowledge about the mode of endonucleolytic activity. According to the prevalent model of 'allosteric activation' which emerged from a combination of crystallographic, biochemical and genetic analyses of the EcoRI system (5, 6, 7), it is evident that upon binding to its target sequence, this ENase isomerizes to an active conformation which allows for DNA strand cleavage. To elucidate the molecular mechanisms directing the mode of action of class IIS ENases the cloning and expression of their genes is required. To date, only two class US R-M systems, HgaI from Haemophilus gallinarum and FokI from Flavobacteriwn okeanokoites, have been cloned completely (8,9). MboII ENase recognizes a pentanucleotide sequence, 5'-GAAGA-3', and cleaves the DNA 8 and 7 nucleotides, respectively, downstream, leaving a single 3' protruding nucleotide (10). Furthermore, the MboH target sequence displays a peculiar kind of asymmetry in that one strand is composed of only purines and the other containes only pyrimidine nucleotides. In this respect, MboH is related to Ksp632I and MnlI which recognize the hexanucleotide 5 '-CTCTTC-3' and the tetranucleotide 5'-CCTC-3', respectively (11). With respect to the cleavage position, HphI is the closest class HS enzyme to MboH. It also cuts to the right of the recognition sequence, 8 nucleotides away on the top and 7 on the bottom strand (12). MboII MTase methylates the 3' adenine, producing 5'-GAAGmeA-3' (13). After replication, however, one daughter DNA molecule will be unmethylated and therefore sensitive to restriction. This is in contrast to MTases with palindromic targets where both daughter molecules are hemimethylated, thus providing sufficient protection against the cognate ENase. It is unclear how M. bovis DNA is protected against MboH ENase activity during replication. Whether the cytosine residues within the MboH complementary strand, 5'-TCTTC-3', are modified by an alternative activity of the Mbol methylase or perhaps by a completely different methylase is still a matter in question. Our report about the cloning, sequencing and expression of the genes encoding the MboH R-M system does suggest the existence of a gene coding for a MboII site-specific methylase but does not provide a comprehensive answer how methylation functions in vivo.

1008 Nucleic Acids Research, Vol. 19, No. S

MATERIALS AND METHODS Bacterial strains and plasmids E. coli strain RR1AM15: leu, pro, thi, strA, hsd r-m-, lacZAM15 F' laclq ZAM15 pro+ (14), and plasmids pUC9 (15), pACYC 184 (16) and pMO320 (17) were used for cloning and expression. Moraxella bovis (ATCC 10900) was purchased from American Type Culture Collection and cultivated in dYT Medium at 37°C under aerobic conditions (18). Enzymes and chemicals Restriction endonucleases were purchased either from New England Biolabs or Boehringer Mannheim. T4-DNA Ligase was from BRL. Terminal deoxyribonucleotidyltransferase was from Boehringer Mannheim. Taq-Polymerase was from Perkin-ElmerCetus. Proteinase K and RNase A were from Sigma Chemicals. IPTG was from Bachem Biochemicals. All radiochemicals were obtained from Amersham Buchler. Purification of MboII ENase About 250g of M. bovs cells were suspended in 300ml of 1OmM Tris-HCl buffer (pH 7.5) containing lOmM 2-mercaptoethanol and disrupted by French press. The cell debris were removed by centrifugation (100,OOOg for 3h). To the supernatant a 25% solution of streptomycin sulfate was added to a final concentration of 5 %. The precipitate was removed by centrifugation and solid ammonium sulfate was added to 50% saturation. After removal of the precipitate solid ammonium sulfate was added to a final concentration of 70%. The resulting precipitate was collected by centrifugation, dissolved in lOmM K-phosphate buffer (pH 7.4) containing lOmM 2-mercaptoethanol, 10% glycerol (buffer 1), and dialysed against the same buffer. The dialysate was loaded onto a phophocellulose column (3 x29cm; Whatman P-il) and chromatographed with 1000ml of a linear KCl gradient from 0.0-0.8M in buffer 1. The R.MbolI activity was eluted at 0.3 -0.4M KCl. The active fraction was dialysed against buffer 1, loaded onto a Hydroxyapatite column (2 27cm; CalbioChem), and eluted with 400 ml of a linear gradient of Kphosphate (pH 6.8) from 0.1 -0.5M. The active fraction was dialysed against Heparin-Agarose buffer (1OmM Na-phosphate buffer (pH 6.8) containing lOmM 2-mercaptoethanol), loaded on a Heparin-Agarose column (2 x 13cm), and eluted with 400ml of a linear gradient of NaCl from 0.0-0.6M. R.Mbol activity was eluted at 0.2-0.3M NaCl. The active fractions were washed and concentrated by ultrafiltration with Centricon tubes (Amicon Corp.). The final recovery was about 2mg of homogenous R.MboII. Running aliquots of purified R.MboII on a 12% SDSPAGE gel gave rise to a unique band of 49 kD. Gel filtration on a Superose 12 HR 10/30 (Pharmacia) FPLC column revealed that Mboll ENase is a monomer under native conditions (data not shown). Analysis of the N-terminal amino acid sequence of R.Mboli 500 pMol of homogenous R.MboII were loaded onto an Applied Biosystems 470A gas-phase protein sequencer. The phenylthiohydantion (PTH) derivates of the amino acids were identified with an Applied Biosystems 120A PTH-analyser conncted to the sequencer. The first 19 PTH-amino acids, except the PTH-Serines in position 6, 13 and 14, were unambiguously identified. Preparation of genomic DNA framents with DNaseI Total cellular DNA from lg of frozen M. bovis cells was purified using Proteinase K/SDS, phenol/chloroform extraction, and

RNase A digestion, according to methods previously described (18, 19). 5yg M. bovis DNA were incubated in 501i of 33mM Tris-HCl (pH 7.6), lOmM MnC½2 containing 3ng of DNaseI (Boehringer Mannheim) at 37°C. After 2min the reaction was stopped by adding 5M1 of 0. IM EDTA at pH 8.0. The digested DNA was purified on a 5% polyacrylamide gel. DNA of the required size was cut out and eluted overnight in 333 buffer (300mM NaCl, 30mM Tris-HCl pH 7.6, 3mM EDTA). The eluted DNA was precipitated with ethanol, dried and dissolved in 30,d4 TE-buffer (20mM Tris-HCl pH 7.6, 1mM EDTA).

Selection of clones expressing the MboiI M phenotype DNA of M. bovis was digested by DNaseI to produce fragments with an average size of 2.5Kb. lOpMol digested DNA were tailed by adding poly dC residues and then annealed into the PstI cut, poly dG tailed expression vector pUC9. Annealed DNA was transformed into competent E. coli RR1AM15. 22,000 transformants were collected from Yeast-Tryptone(YT), ampicillin plates by rinsing with 5ml saline. 2ml of this mixture were inoculated into 400ml dYT-Medium containing 200gg/ml ampicillin and grown to saturation. 51&g of the plasmid population purified by CsCl/EtBr centrifugation were incubated with an at

M1 2 34 5 6M kb -5 - 3 - 2

X

Fig. 1. Plasmid pMboM1.1 carying the Mboli MTase gene is resistant to digestion with MboII restrictase. 1. pUC9 digested with PstI. 2. pMboMl. 1 digested with PstI. 3. pUC9 digested with Mboll. 4. pMboMl.1 and pUC9 digested with Mboll. 5. pMboMl.1 digested with Mboll. 6. pMboMl.1 undigested. M. BRL 1Kbladder. 0

1D

0.5

M

MI

tS

2D

b)

4

Mbdo Mboll K I Ii R

pMbtoMlJ pMboRl.5

pMboR2A

+

MboR13 -4.

.

|~~~~~~

Fig. 2. Schematic map of the Mboll R-M region. Bold arrows indicate extent and orientation of the Mboll genes. Below the genes, the size of DNaseI fragments inserted in pUC9 are shown. MboR1.3 represents a fragment thut was isolated from chromosomal M. bovis DNA by the polymerase chain reaction (PCR). - signifies N- and C-terminal specific primers. To the left of the fragments, the Mbol activities specified by the clones are summaized. The M column refers to the state of MboIl modification of the plasmids, as measured by their resistance to Mboll digestion 'in vitro'. The R column refers to whether or not MboIIR activity was detected in sonicated cell extracts. Symbols: +, presence of ENase/MTase; -, absence of ENase/MTase. Details of subcloning of MboRl.3 are outlined in Fig. 4B.

Nucleic Acids Research, Vol. 19, No. 5 1009 least ten fold surplus of MboH restrictase in a total volume of 100tid for 3h at 37°C. Transformation of this digest into E. coli RR1AM15 gave rise to 450 ampR colonies. Plasmid DNA from 12 individual clones was prepared and incubated with MboH as described above. DNA sequence analysis DNA was sequenced either by the Maxam-Gilbert method (20) or by the chain termination method (21) with the T7 polymerase

sequencing kit provided by Pharmacia. Oligo primers were synthesized with a 380A Applied Biosystems DNA synthesizer using the cyanoethyl phosphoramidite chemistry. Southern hybridisation and colony screening

Southern blots

were performed as described (22). Colony screening was done according to standard protocols (22), except that filters were washed only once in 6 x SSC for 15min after

hybridisation. SD

aaaatcaattagaatatatggaaaacagaaacaattgttatgcaatttccgtaagagatttaaaccaaataggtacactaatagatattatttaccaaa atg gtt gaa aat atg cta gaa

(;) Cv) (e) (n)

L E

1

120

3

ata aat aaa ata cat caa atg aac tgc ttt gat ttt tta gac caa gtg gaa aat aaa agc gtt caa tta gcc gtc att gac ccg cct tac aat ctt agt aag gcg gat tgg gat agt ttt I N K I H Q N N C F D F L 0 Q V E N K S V Q L A V I D P P Y N L S K A D V D S F

240

gat agc cat aat gaa ttt ttg cca ttt act tat cgt tgg att gat aaa gtt tta gat aaa ctg gat aaa gac ggc tcg ctt tat att ttt aat aca cca ttt aat tgt gct ttt att tgt D S H N E F L P F T Y R W I D K V L D K L D K D G S L Y I F N T P F N C A F I C

360

caa tac ttg gta agt aaa ggt atg att ttt caa aat tgg att act tgg gat aaa aga gat gga atg ggt agt gcc aaa agg ggt ttt tcc aca gga caa gaa acc att tta ttt ttt tca Q Y L V S K G N I F Q N W I T W D K R 0 G N G S A K R G F S T 6 Q E T I L F F S

480 123

aaa tcc aaa aat cac act ttt aat tat gac gaa gtg cga gtg cct tat gaa agc acc gac aga ata aag cac gcc agt gaa aaa ggc att tta aaa aat ggt aaa cgc tgg ttt ccc aat K S K N H T F N Y D E V R V P Y E S T D R I K H A S E K 6 I L K N G K R V F P N

600 163

cct aat ggc agg tta tgt ggt gaa gtt tgg cat ttt tct agc caa cgc cac aaa gaa aaa gtc aat ggc aaa acc gtc aaa P N G R L C G E V V H F S S Q R H K E K V N G K T V K -35 cgc att att aga gca agt tcc aac ccc aac gat ttg gta tta gat tgt ttt atg gga agt ggc aca aca gca atc qtt acc R I I R A S S N P N D L V L D C f N G S G T T A I V A SD gct gaa tat gtt aat caa gcc aat ttt gtg tta aat caa ctt gaa atc aat atgaaa aat tat gtc agc_aac A E Y V N Q A N F V L N Q L E I N * Y V | SI N I.

cca cgc gat tta ata gaa P R 0 L I E

720 203

att ggg tgc gat atg aat I 6 C D N N

840 243

taaWaaaact

ttg acc cat att act cca aaa L T H I T P K -10 aaa aaa ctg ggt cgt aat ttt K K L G R N F

tc ctt gat aat tca tca tta aat

a

I

N

L

N1 S S [L

G

tagaa

tc

K

F

I

DI

E

43 83

962 20

aga ttg caa tct gaa aat tat cgt ggc att cat tta agt cag cat aac cgc tat gat ttg cca aaa tta ata gat att ttg aca ttg tta aat aaa cac gcc ccc aac caa tct tta atg 1082

R

L

Q

S

E

N Y

R G

I

H

L

S

Q

H

N R

Y

D

L

P

K

L

I

D

I

L

T

L

K

L N

H A P

N Q

S

L N

60

NboII

E

caa atc aga aca act gac atc agc aaa aga ccg cag aat atc cca Q I R T T 0 I S K R P Q N I P E

at caa tct tat gcc gaa ttt tgc aat gaa gcc aaa agt tta acc aat att ggc acg caa gat gca atg cgt 1202

E

Q

S

Y

A

E

F

C

N

E

A

K

S

L

N

T

I

G

T

Q

D

A

N

R

100

aaa aat ctt ttt gtg gat ttt gca aga atg gga cta atc aac cga tat aac gac aaa aaa gta tta act gac cca ttc aaa agg ggc gta aca aaa tat gtt gct ttg tcc gat atg gga 1322

K

N

L

F

V

D

F

A

R

N

G

L

I

N

R

Y

N

D

K

K

V

L

T

D

P

F

K

R

G

V

gta aag tta ata gac cca aaa tta gat ata tta agt aaa aat tta att ttt tct aag tcg tta aat aaa cta tta aca ggc ttt V K L I D P K L D I L S K N L I F S K S L N K L L T G F V

tta aaa gaa atc agc ttt gat gag ttt atg ctg ttt gtt tca gca atg aat tgt aat ttt aat ttt agc att tcc aca gag caa tgc

L

K

E

I

S

F

D

E

F

N

L

F

V

S

A

N

N

C

N

F

N

F

S

I

S

T

E

Q

C

E

K

T

MboII gtg[ gt

Y

V

A

L

S

D

N

6

140

gtt tta agt ttg cta acc aat agt gat 1442

D

V

L

S

L

L

T

N

S

0

180

gaa agt ttg ata aaa gaa tac cga tta tta tca 1562 E

S

L

I

K

E

Y

R

L

L

S

220

cga gta caa aaa aat gcg gtg att gac act tta aaa tca gag ctt att cca gac aat ttt aac ggc gat aaa aaa gat aag cga gat tat cat aat tgg gca aat gaa aat caa caa ata 1682 R V Q K N A V I 0 T L K S E L I P D N F N G D K K D K R D Y H N W A N E N Q Q I 260

tgg act ttg ttt gaa aat att cca ttt ttc att atg gaa aaa gac agt aga aaa ctt att tta ata act tct gat gta gat ttg tca aaa tac agt aaa tca aaa atg aaa cgc tca caa 1802 W T L F E N I P F F I N E K D S R K L I L I T S D V D L S K Y S K S K N K R S Q 300 caa gcc aaa aat gat tat ttt aaa cac cac aaa gtc aat aaa ata aaa ggc tat gaa tta gac cac atc att cct tta ttg gaa gca gaa agc gtg gat gaa tat cgt tat tta gat aac 1922

Q

A

K

N

D

Y

F

K

H

H

K

V

N

K

I

K

G

Y

E

L

0

H

I

I

P

L

L

E

A

E

S

V

D

E

Y

R

Y

L

D

N

340

tgg ctt aat tta ttg tac att gat ggc aaa aca cac gcc att aaa agt caa agc ggt tca aaa tat tat atc ttt aca ttt gat gac aat gat tat aat cag att tat ttt ttg gac acc 2042 W L N L L Y I D G K T H A I K S Q S G S K Y Y I F T F 0D D N D Y N Q I Y F L D T 380 caa ggc gat aaa ctg tca att aac aat gac gat act gct tta ttt gac aag aat aaa gta cca aaa att tat gaa tac aat caa aac ttt atc aac gcc aaa aca tca taa ttatttttaag 2164 Q G D K L S I N N D D T A L F D K N K V P K I Y E Y N Q N F I N A K T S *

gaaacccaatgaccaccctacccgactatgtccgtgccattattaccgcaaccgtttatgatgtcgccattcgcacaccgcttgataaggcaagcaaactctctgcccgttttggcaacgacattcgcctaaaacgagaagacctgcaacctgtattta 2323 gctttaaagtgcgtggggcgtacaacaaaatcagccaactttcggcagagcaaaaagcaaaaggcatcatctgtgcctcggctggcaaccacgcacaaggggtagcgtatcggcaaatcgcttaaaaatcaataacttaattgtaatgcccaaaaccac 2480 gcccgacatcaaagtgcaagcggtcaaagcctttggtggtacggtgcatttgcatggtgacagttttgacgaagccaaccgctatgccatggaaaaggcaacaacggacggtatgcctactcgcc

2608

Fig. 3. Nucleotide sequence of the mboII R-M genes and the deduced amino acid sequence of the Mboll MTase and ENase. Shine-Dalgamo sequences are marked by dots and translational stop codons by asteriks. The N-terminal amino acids of the ENase that were determined by protein sequencing are boxed. The positions of the MboIl recognition sites in the ENase gene are shown. A potential - 10/-35 region refering to the mboIIR gene is indicated in the 3' end of the MTase gene. DPPY and FXGXG sequences of M.Mboll are underlined. The sequence of an N-terminal tetrapeptide that would be translated if the ATG codon at position 100 were used as start codon is shown in brackets, with lower case letters.

1010 Nucleic Acids Research, Vol. 19, No. 5

Polymerase chain reaction Total DNA from M. bovis was used as template. PCR reactions (1OOI) contained 20pmol of each primer, 500ng of template DNA, 10mM of each dNTP, 67mM Tris-HCl (pH 8.8), 16.6mM ammoniumsulfate, 6.7mM MgCl2, 6.7AtM EDTA, 10mM 2-mercaptoethanol, 5 units Taq DNA polymerase. Reaction mixtures were overlayered with paraffin and reactions were carried out using the Biozym DNA incubator. The cycle programm was programmed as follows: 1min at 50°C (annealing), 5min at 70°C (extension) and Imin at 95°C (denaturation). This profile was repeated for 35 cycles. The aqueous layer of the reaction mixtures were pooled and put onto a 1% agarose gel. The amplified DNA band was cut out, eluted and resuspended in TE-buffer.

RESULTS AND DISCUSSION Cloning of the mbol M gene Recombinants expressing a specific MTase activity will survive digestion by the corresponding ENase, and hence can be recovered by transformation back into an E. coli strain, if the formation of a new methylation pattern does not exert any damaging effects to the host cell. E. coli K12 is known to possess restriction systems that degrade DNA specifically when it is methylated (23-26). Because the MboH MTase modified sequence, 5'-GAAGmeA-3', overlaps with the suggested

Methods). A Shine-Dalgarno sequence, AAGG, positioned 6 nucleotides 5' to the start codon supported the assignment. The appropriate reading frame, however, covered only a part of the mboIIR gene coding for the first 59 amino acids. In order to isolate clones carrying the rest of the mboIIR gene, we screened our DNaseI library of the M. bovis genome with a 21mer oligonucleotide (5'-CATAACCGCTATGATTTGCCA-3') derived from the 3' end of the pMboM 1. 1 insert. Ten colonies, among 50000 tested, appeared positive. The plasmid pMboRl.5 (Fig. 2) contains a 1.5 Kb insert covering by far the largest section of the mbollR gene (3' end at nucleotide position 1990). Since no in-frame stop codon could be discovered on this fragment, we performed a second screening, now using a 20mer oligonucleotide (5'-GTGGATGAATATCGTTATlTT-3') derived from the 3' end of the mbollR part on pMboRl.5. Testing of 2000 transformants gave rise to the plasmid pMboR 2.4 (Fig. 2), possessing an insert of 2.4 Kb on which we localized the UAA stop codon of mbollR at nucleotide position 2151 (Fig. 3). By this means, we established the coding region of mboIIR as being 1248 bp long, corresponding to a protein of 416 amino acid residues (MW: 48,617).

A)

consensus sequence of the mrr restriction system, 5'-GmeAC-3' or 5'-CmeAG-3', we used E. coli RR1AM 15, a derivative of RR1, which is known to carry a deletion spanning the entire mrr region (26), as the host in constructing a genomic M. bovis library. M. bovis DNA was partially digested with DNaseI and

inserted into pUC9. After transformation into RR1IAM15 recombinants carrying the MboH MTase gene will be resistent to cutting by the MboH ENase. Pooled plasmid DNA was recovered, cut with MboI and retransformed into RR1AM 15. From 450 clones obtained after the first round of selection with MboI digestion, three, out of 12 recombinants tested, were found to be protected against the ENase attack. Restriction mapping revealed that two of the Mboll resistant clones had an identical insert of 2.3 Kb, while the third contained a fragment of 1.1 Kb. The latter, designated pMboM 1.1 (Fig. 1), was chosen for DNA sequence analysis.

B)

/

co

R

EcofI

MboRl.3

pMO320

+

S

Ebal EcoRI

Xbai

EcRI Tc'

DNA sequence analysis and gene organization The nucleotide sequence of the 1.1 Kb DNaseI fragment of plasmid pMboM1. 1 (Fig. 2) was determined on both strands (Fig. 3). Only one long open reading frame was found that could code for a protein of a molecular weight corresponding to the average size of N6A-MTases (27). Potential ATG start codons were detected at nucleotide positions 100, 112 and 139, and the termination codon UAA at nucleotide position 892 (Fig. 3). We propose the ATG codon at 112 to be the initiation site for translation of the MTase gene since only this one is preceeded by a putative Shine-Dalgarno sequence, ATGG, in the appropriate position. The corresponding reading frame predicts a protein of 260 amino acids (MW: 30,077), displaying the motif DPPY which is characteristic of adenine-specific MTases (27). Examination of the region downstream of the MTase gene revealed on the same strand, only 11 bp apart, the start of a second open reading frame. The assignment of the Mboll ENase gene to this coding region (Fig.3) was achieved by N-terminal amino acid sequence analysis of R.MboII (s. Materials and

aee

pMbo Rl.3 jI ~~~~~~~~Smal

\t

R .0 EcoR

pACYC184

0

XbalXbaI

Fig. 4. Separate cloning of the MboJI R-M genes in two compatible vectors. (Symbols. R: mboIIR gene; M: mbolIM gene; P: wild type (wt) lac promoter; P/O: wt lac promoter with a wt lac operator between its -10 and -35 region; Lac: lac repressor gene; ori: origin of replication.) A) pMboMl.l was constructed by the insertion of a 1.1 Kb DNaseI fragment bearing the mboIIM gene into the PstI site of pUC9 via GC-tailing. B) Cloning of the mboIIR gene in pA CYC 184. First,the PCR fragment MboRl.3 (s. Fig.2) was ligated into the Smal site of pMO320.The resulting plasmid, pMboRl.3, was digested with EcoRI. To construct pMboR3.0, the 3 Kb EcoRI fragment which carries the lac control region as well as the genes for lacl and mboIIR was inserted into the unique EcoRI site of pACYC184.

Nucleic Acids Research, Vol. 19, No. 5 1011 The base composition of the MboH genes is characterized by a high A+T content: 68% for the ENase and 65% for the MTase. This is higher than the average A+T content of M. bovis (57%, 28). The base composition is reflected in the codon usage: A and U are strongly preferred nucleotides in the third position, less so at the second and first position. The operon-like arrangement in the MboH system appears logical. Close linkage and cotranscription of the two genes in the order M to R assures that MTase will always be coproduced with restriction activity and the cellular DNA will be modified and protected, whereas independent expression of the ENase gene should result in lethality. In addition to the MboH system, the organization of only one other class Us R-M system (FokI) has been determined (29). Different gene arrangements of 11 class II R-M systems (BsuRI, DdeI, DpnH, EcoRI, EcoRV, HhaH, Hinfi, MspI, PaeR7I, PstI, TaqI) have been recenfly reviewed (30). The arrangement of the Mboll genes is similiar to the FokI, HhaII, HinfI, PaeR7I and TaqI genes, but the length of the intergenic region is different ranging from a minimum of 11 bp between the MboII genes to a maximum of 132 bp between the TaqI genes.

Expression of the mboIIR gene Since the length of the Mbol R-M system did not exceed the average size of 2.5 Kb of DNaseI generated fragments used to establish the M. bovis library, we tried to isolate recombinants

possibly carrying both genes. We analysed 450 ampR transformants which were recovered from the first round of selection for MboII M activity (s. Materials and Methods). Attempts, however, to identify clones expressing both, methylase and restrictase activity, either by infecting phage restriction or by in vitro assays of cell extracts (30) were unsuccessful. A plausible explanation of this result may be that the E. coli-like promoter sequence we identified at the 3' end of the MTase gene (Fig. 3) does promote the transcription of the ENase in E. coli, while it is possibly without function in M. bovis. It is reasonable to suppose that an uncoordinated expression of the MboH genes will affect the viability of their host strain. Furthermore, the phenomenon that an endogenous promoter for ENase gene expression is located within its cognate MTase gene may possibly account for the negative outcome of various approaches to clone R-M systems as a whole. In the case of some Bacillus species only MTase genes have been cloned, but none has yet been associated with a functioning restriction gene (31, 32). A different approach was therefore used to clone the ENase gene. First, the PCR-generated fragment MboR1.3, carrying the mboIIR gene alone was ligated into the unique SmaI site of pMO320 (17). pMO320, a plasmid bearing the col El origin of replication, contains a weak, synthetic promoter [specific 3galactosidase activity (33): 390 U (+IPTG), 0.22 U (-IPTG); for comparison, wt lac promoter: 1000 U (+IPTG), 1 U (-IPTG)], two copies of wt lac operator and the lacI gene

M.Mboll

A.

M.Mboll B

.I

i

m

.

I

*.

K s

_/

-/

~~/ /- m -1"

_/ -

I

./ /

-

lo

//,

*I.,*

1/

C.

M.Mboll

D.

I .

.

.

K

1@l~~

D *

M.Mboll

. I.I

-

,-.

-Ne

K

/

U

z1 //

.7

... ,

sZ~~~~~-I

_

_

,/

/'

,~~~~~~~

, "~~~~~~

/

I/

/

Fig. 5. Dot-plot representation of homologies between M.MboHl and four other MTases. A: M.RsrI; B: M.Hinfl; C: M.DpnA; D: M.BamHI The dot matrixes were generated by the program COMPARE. Diagonal lines indicate regions of strong homology. For all comparisons the window size and the stringency values were 30 and 14, respectively.

1012 Nucleic Acids Research, Vol. 19, No. 5 possessing the Iq promoter (Fig. 4). Under noninducing conditions lac repressor prevents the transcription of DNA sequences which are cloned to the SmaI restriction site located 3' to the operator elements. The general applicability of such a 'conditional-lethal' vector system had been demonstrated previously by the successful cloning of the PstIR gene (17). Under these conditions, it became possible to clone the mbolIR gene despite the absence of any Mboll MTase activity. The recombinant plasmid, named pMboRl.3 (Fig. 4), was digested with EcoRI. A 3 Kb fragment covering lacd, mbollR and the lac control region was prepared and subcloned into the EcoRI site of pACYC 184 whose origin of replication is different from that of pMboM1.1. The resulting plasmid, pMboR3.0, was transformed into RR1AM15 harboring the plasmid pMboMl . 1 where Mbol MTase was constitutively expressed. When examining the new strain, E. coli RR1 M15-Mbo, we found that the steady state level of R.Mboll activity was at least a factor of 20 lower than in Moraxella bovis. As yet, the reason for this low activity is not clear.

Location of the Mbol R-M system in M. bovis To determine whether the 7 Kb plasmid present in M. bovis carries the Mbol R-M system, we performed a Southern-blot, using as a labeled probe both the mboIIM gene and the PCR fragment MboR1.3. The mboHM gene as well as the mbollR gene hybridize to a >20 Kb HindIll fragment of total DNA, but not to plasmid DNA (data not shown). Thus, it is likely that the MboH R-M system is located on the chromosome of M. bovis. Protein sequence comparisons The amino acid sequences of the MboH proteins were compared with other known ENase and MTase sequences (EMBL protein library) by using the GAP program of UWCGG which calculates the degree of similarity between two protein sequences. As anticipated, comparing R.MboH and M.MboII revealed no significant homology. Similarily, no homology could be detected between R.Mboll and other sequenced ENases. M.Mboll is an adenine-specific MTase generating N6mA. All N6mA-MTases analysed to date share two common features: the tetrapeptide DPPY and its variants involved in the methylation of the exocyclic amino group and the FXGXG motif suggested to be the binding site of AdoMet (34). The two conserved sequence motifs are found within the M.MboII reading frame defined by the ATG at nucleotide position 112: DPPY at codons 27-30 and FXGXG at codons 220-224. Global alignment of M.Mboll to all available amino acid sequences of adenine-specific MTases demonstrated that the MboH MTase sequence is closely related to M.RsrI from Rhodobacter sphaeroides. We found an overall identity of 38% and a further 19.6% if conservative replacements are permitted. The extent of nucleotide identity is 44 %. Prior to this study, only the sequence comparisons between M.NlaIII and M.FokI had disclosed a comparable high degree of homology (35). By then, the maximal amount of amino acid sequence identity found among N6mA-MTases was about 30% (36). As shown in Fig. 5(A-C) the homologous regions are arranged in at least three clusters: DPPY at the N-terminus, FXGXG at the C-terminus and an as yet functionally not characterized region between them. The evident homology between M.MboH and M.Hinfl (protein identity: 32%), M.DpnA (protein identity: 38.5%) as well as M.BamHI (protein identity: 31 .4%)(Fig. 5 D) is expected because similar degrees of homology have been reported for M.RsrI (37). Furthermore, the

relatedness between M.MboII and M.BamHI, a N4-methylcytosine MTase, represents an additional example to confirm the notion that N4mC-MTases are more related to N6mA-MTases than to 5-methylcytosine (5mC) MTases. M.MboH has no significant homology to any of the known 5mCMTases.

ACKNOWLEDGEMENTS We thank K. Beyreuther for providing protein sequencing facilities, K. Otto for synthesizing the oligonucleotides, B. Kisters-Woike for help with the computer work, S.Corbach for technical assistance and B. Jack for critically reading the manuscript. This work was supported by a fellowship of the Studienstiftung des deutschen Volkes to H.B. and by the Deutsche Forschungsgemeinschaft through 'Schwerpunkt Gentechnologie' to B.M.-H.

REFERENCES 1. 2. 3. 4. 5.

6. 7.

8. 9. 10. 11.

12. 13.

14. 15. 16. 17.

18. 19. 20. 21.

22.

Szybalski, W. (1985) Gene 40, 169-173. McClelland, M. and Nelson, M. (1988) Gene 74, 291-304. Kessler, C. and Manta, V. (1990) Gene 92, 1-248. Wharton, R. P. and Ptashne, M. (1985) Nature 316, 601-605. McClarin, J.A., Frederick, C.A., Wang, B.-C., Greene, P., Boyer, H.W., Grable, J., Rosenberg, J.M. (1986) Science 234, 1526-1541. Terry, B. J., Jack, W. E., Modrich, P. (1987) In Chirikjian, J. G. (ed.), Gene Amplification and Analysis. Elsevier, New York, Vol. 5, pp. 103-118. Jen-Jacobson, L., Kurpiewski, M., Lesser, D., Crable, J., Boyer, H. W., Rosenberg, J. M., and Greene, P. J. (1983) J. Biol. Chem. 258, 14638-14646. Barsomian, J. M. and Wilson, G. G., unpublished, quoted in 9. Looney, M. C., Moran, L. S., Jack, W. E., Fuhery, G. R. Benner, J. S., Slatko, B. E. and Wilson, G. G. (1989) Gene 80, 193-208. Brown, N. L., Hutchinson Ill, C. A. and Smith, M. (1980) J. Mol. Biol. 140, 143-148. Bolton, B. J., Schmitz, G. G., Jarsch, M., Comer, M. J., and Kessler, C. (1988) Gene 66, 31-43. Kleid, D., Humayun, A., Jeffrey, A. and Ptashne, M. (1976) Proc. Natl. Acad. Sci. U.S.A. 73, 293-297. McClelland, M., Nelson, M. and Cantor, C. R. (1985) Nucleic Acids Res. 13, 7171-7182. Ruther, U. (1982) Nucleic Acids Res. 10, 5765-5772. Messing, J. (1981) In Walton, A. G. (ed.), Ihird Cleveland Symposium on Macromolecules: Recombinant DNA. Elsevier, Amsterdam, pp. 143-153. Chang, A. C. Y. and Cohen, S. N. (1978) J. Bacteriol. 134, 1141-1156. Niemoller, M. (1988) Untersuchungen zum Repressionsmechanismus des lacOperons von E. coli, Ph. D. Thesis, University of Cologne. Bocklage, H. (1988) Identifizierung des Gens der Restriktionsendonuklease MbofI aus Moraxella bovis (AT CC 10900), Ph. D. Thesis, University of Cologne. Dillela, A. G. and Woo, S. L. C. (1985) BRL-Focus 7:2, 1-5. Maxam, A. M. and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 560-564. Sanger, F. Nicklen, S. and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467. Maniatis, T. Fritsch, E. F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor University Press, Cold Spring

Harbor. 23. Ehrlich, M., Gama-Sosa, M. A., Carreira, L. H., Ljungdahl, L. G., Kuo, K. C. and Gehrke, C. W. (1985) Nucleic Acids Res. 13, 1399-1412. 24. Noyer-Weidner, M., Diaz, R. and Reiners, L. (1986) Mol. Gen. Genet. 205, 469-475. 25. Ehrlich, M., Wilson, G. G., Kuo, K. C. and Gchrke, C. W. (1987) J. Bacteriol. 169, 939-943. 26. Heitman, J. and Model, P. (1987) J. Bacteriol. 169, 3243-3250. 27. Lauster, R. (1989) J. Mol. Biol. 206, 313-321. 28. Bergey's Manual of Determinative Bacteriology (1974) 8th edition, 434. 29. Wilson, G. G. (1988) Trends in Genetics 4, 314-318. 30. Kiss, A., Posfai, G., Keller, C.C., Venetianer, P. and Roberts, R.J. (1985) Nucleic Acids Res. 13, 6403-6421.

Nucleic Acids Research, Vol. 19, No. 5 1013 31. Janulaitis, A., Povilionis, P. and Sasnauskas, K. (1982) Gene 20, 197-204. 32. Kiss, A. and Baldauf, F. (1983) Gene 21, 111-119. 33. Miller, J. H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor. 34. Klimasauskas, S., Timinskas, A., Menkevicius, S., Butiene, D., Butkus, V. and Janulaitis, A. (1989) Nucleic Acids Res. 17, 9823-9832. 35. Labbe, D., Holtke, H. J. and Lau, P. C. K. (1990) Mol. Gen. Genet. 224, 101-110. 36. Mannarelli, B. M., Balganesh, T. S., Greenberg, B., Springhorn, S. S., Lacks, S. A. (1985) Proc. Natl. Acad. Sci. U.S.A. 82, 4464-4472. 37. Kaszubska, W., Aiken, C., O'Connor, C. D. and Gumport, R. I. (1989) Nucleic Acids Res. 17, 10402-10425.