Gene, 91 (1990) 63-69 Elsevier

63

GENE 03587

Cloning and expression in Escherichia coli of a hypoxanthine-guanine phosphoribosykransferaseencoding cDNA from Plasmodiumfalciparum (Target enzyme; purine de nova pathway; human malarial parasite; purine salvage)

Geetha Vasanthakumarq Richard L. Davis Jr.*, Mark A. SuEivanb and John P. Donahue c a Molecular Biology Section, Departmentof Biochemistry.Southern Research Institute:Binningham. AL 35255-5305 (U.S.A.)j b Kodak Research Labs, Life Sciences Division,Rochester,NY 14650 (U.S.A.) Tel. 716-722-6134, and c Departmentof Microbiologyand Immunology, VanderbiltUniversitySchool of Medicine,Nashville,TN 37232 (U.S.A.) Tel. 615-343-8270 Received by M. Bagdasarian: 7 September 1989 Revised: 10 November 1989 Accepted: 20 December 1989

SUMMARY

The enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT) of Plasmodiumfalc@arum plays a key role in the salvage of preformed purine nucleotides from parasite-infected erythrocytes. Since P. falciparum cannot synthesize purines de novo, development of inhibitors specific for the parasite HGPRT should be an effective method of chemotherapy. To provide sufficient amounts of HGPRT for biochemical and crystallographic analysis, we have isolated the P. falciparum HPR T cDNA sequence and expressed it in an Escherichiacolistrain deficient for both de novo purine synthesis and guanine utilization (strain GP120). GP120 cells containing the P. falcipanrmHPRT plasmid vector (pRDSOO),when grown in the presence of isopropyl-b-D-thiogalactopyranoside(IPTG) which induces the fat promoter of the expression vector, produce a novel protein of 26 kDa, which is in agreement with the predicted M, deduced from the HPR T cDNA open reading frame. In addition, we have demonstrated significant HGPRT activity in cell-free extracts of GP120[pRDSOO]cultures grown in minimal medium containing xanthine, as the sole source of purines, and IPTG.

INTRODUCIION

Plasmodium fakipatum, the most lethal of the malarial parasites that infect humans, undergoes three cycles of development in its vertebrate host and elicits stage-specific immune responses. This stage specificity of the immune response has made it dficult to isolate antigens that would Correspondence to: Dr. G. Vasanthakumar, Department of Biochemistry, Southern Research Institute, 2000 Ninth Avenue South, P.O. Box 55305, Birmingham, AL 35255-5305 (U.S.A.) Tel. (205)581-2259; Fax (205) 58 l-2726. Abbreviations: aa, amino acid(s); Ap, ampicillin; bp, base pair(s); HGPRT, hypoxanthine-guanine phosphoribosyltransferase;HPRT, gene (DNA) encoding HGPRT; IPTG, isopropyl-@thiogalactopyranoside; kb, kilobase or 1000 bp; MB, mung-bean nuclease, MCS, multiple cloning site; nt, nucleotide(s); ORF, open reading frame; PAGE, polyacrylamidedgelelectrophoresis; P, Plasmodium; PBS, phosphate-buffered 0378-I119/90/$03.500 1990 ElsavierSciencePublishersB.V.(BiomedicalDivision)

be useful in developing a vaccine against malaria, so malaria is currently treated by chemotherapy. Recent increases in the frequency of chloroquine and pyrimethamine-resistant malarial strains (Wemsdorfer, 1983)have emphasized the urgent need for development of new chemotherapeutic agents to deal with these diseases. A more efficient and rational approach to the development of chemotherapeutic saline containing (g/liter) CaClz (O.l)/KCl (0.2)/KH2P04 (O.Z)/MgCI, (O.l)/NaCl(8)/Na,HPO, (2.16); pBS( + ), plasmid Bluescribe ( + ); PolIk, Klenow (large) fragmentof E. coli DNA polymerase I; PRPP, phosphoribosyl pyrophosphate; ptac-mHPT, ptac-85 vector containing the mouse HPRT cDNA; pSV2gpt, plasmid containing the E. coli gene encoding XGPRT; rbs, ribosome-binding site; SDS, sodium dodecyl sulfate; SSPE, 0.18 M NaCl/O.OlM Na. phosphate/l.0mM EDTA pH 7.4; SD, Shine-Dalgamo sequence; tsp. transcription start point(s); XGPRT, xanthine-guanine phosphoribosyltransferase; 2 x YT medium, 1.6% tryptone/l % yeast extract/0.5% NaCl; [ 1, denotes plasmid-carrierstate.

64 agents is to exploit defined differences in host and parasite metabolism as a means of developing inhibitors specific for those parasite enzymes identified as possible targets for chemotherapeutic attack. The choice of a potential target enzyme for malarial parasites is suggested by their inability to synthesize purines de hove during the intra-erythrocytic stages of their life cycle in the mammalian host (Wang, 1984; Berens et al., 1981; Van Dyke et al., 1970; Walsh and Sherman, 1968). They, therefore, rely on the host to provide the necessary free preformed purines and have an efficient purine salvage machinery of their own. One important enzyme involved in the salvage of purines from Plasmodium-infected erythrocytes is HGPRT. The activity of this enzyme is present in P.falciparum blood-stage parasites at high levels (Reyes et al., 1982). The reliance that the parasites have on their own HGPRT activity during intra-erythrocytic stages makes this enzyme a potential target for drug therapy in the treatment of malaria. The aim of this study was to clone and isolate eDNA containing an ORF corresponding to the HGPRT ofP. falciparum and to demonstrate the expression of this gene product in an E. coli strain deficient in purine salvage. These studies will facilitate the development of new antimalarial agents.

stream from the putative HPRT sequence. To verify this interpretation it was necessary to obtain a complete cDNA clone of the parasite HPRT. A full-length parasite HPRT eDNA was identified by screening a P. falciparum eDNA library (Ravetch and Kochan, 1985) using the previously isolated parasite genomic DNA as a probe, followed by subcloning of the putative H P R T eDNA into plasmid pBS( + ) to yield recombinant plasmid plA7. A partial restriction map ofthe 1250-bp PstI eDNA fragment is shown in Fig. 1. Also shown is the location within the fragment of an ORF that has been tentatively identified as the parasite ItPR T-coding region. It is noteworthy that nearly 500 bp of s" . , ~'

;~ r~

ATG

,,a~

I

[

3' I

I TAA ~

"!"

T

' lkb t MCS

RESULTS AND DISCUSSION

(a) Bacterial strains and culture The bacterial strain used for synthesis of P.falciparum HGPRT was E. coil strain GP120 (purEAlac-pro-gpt) (obtained from J. Gets, Univ. of Pennsylvania, Philadelphia, PA). Bacterial cultures containing recombinant plasraids were routinely grown in 2 × YT broth containing 100/~g Ap/ml. Selective plates used for assaying HPRT expression contained M9 salts/20/~g guanine per ml/1 mM proline/100 #g Ap per ml/1 mM IPTG/2~o agar.

(b) The nt sequence of H P R T and deduced aa sequences Sullivan et al. (1987) have isolated a P.falciparum genomic clone that could encode a 194-aa polypeptide that exhibited approx. 49~o homology to mammalian HGPRT. However, the P. falciparum genomic clone did not contain sequences that correspond to the first 29 aa of the mammalian HGPRT and a start codon was absent. Furthermore, there was a UAG stop codon at the 5' end of the sequence that was in-frame with the putative P. falciparum HPR T sequence. Inspection ofthe nt sequence at the 5' end of the clone suggested that it contained part of an intervening sequence and the complete 3' exon of the gene. Correct splicing of the mRNA would result in the removal of the in-frame UAG stop codon located immediately up-

~

-'"

4.4 kb

Fig. I. Structure ofplasmid plAT that contains the P.faldparum HPRT eDNA. Drawing is not to scale. Expanded is a partial restriction map of the 1250-bp eDNA ligated into the Pstl site of plasmid pBS( + ). The proposed location and orientation of the HPRT structural gene is shown. To isolate the complete eDNA encoding the parasite HPRT, a eDNA library (Ravetch and Kochan, 1985; Sullivan et al., 1987)(obtained from J. Ravetch, Memorial Sloan-Kcttering Cancer Center, New York) of P.falciparum (FCR-3, Gambia) was plated and incubated at 37°C for I0 h. Replicas of the plates were transferred to nitrocellulose paper and hybridized with the 32P-labeled P.falciparum HPRT genomic DNA (Sullivan et al., 1987). The filters were hybridized at 50°C for 16 h in 5 × SSPE/I × Denhardt's/100~g per ml of denatured herring-sperm DNA. After hybridization, the filters were washed several times at room temperature in 2 × SSPE/0.1% SDS. One of the isolates (PIAT) was selected for further characterization. A partial restriction endonuclease map of the 1250-bp Pstl eDNA fragment is shown. Also shown is the location, within the fragment, of a long ORF that has been tentatively identified as the parasite HPRT structural gene. Thi~ eDNA contains nearly 500 bp of untranslated sequence located up:~.ream from the putative HPRT structural gene. Ap a, ampicillin resistance; B, BamHl; BII, Bglll; D, Dral; E, EcoRl; H, Hindlll; PI, Pstl; S, Smal; SI, Sall; X, Xbal; XI, Xmnl.

65

(A) ,amn

ApR

s

[e,meo~ . . , c .

I

BAP

] PH.--Y4.DNA Po,.4dNTl~ J imlm eoo4~HPRTfrqmqmt

T4 DNA |~4MB .............!-TTTTCTTI'GT-ATATATTA'IrTACTATATATTTATATAATA'A I-TAO AA~

i VeclorDNA. HPRYeDNA

X

~

(

~

mM N

X H H

X

HPRT B

81 nuohllm

MB

B

81 nuolem BAP E

led

,Lpn

ell

I~

APn

1'4 ONA

1"4DNA

,im

/

Z l

:

E

'Apn

(13)

~n

Om. HPR7 eDNA Jun~lonmuen~m:

pROS" .... 6' T T T C A C A ~ A A A ~ A A T A 3' .... Met I~Ile pR060Q

....

6° " r r r c , , , C A e ~ - ~ Adss ACAeAA,~:e,,,AT_A

3' ...... lt~n I~ro lie

Fig. 2. Construction ofpRDS00 and pRD336. Plasmid plAT (see Fig. 1), containing the 1250-bp P.falciparum HPRT cDNA fragment, was linearized at its unique EcoRl site and digested with BAL 31 exonuclease (Silhavy et al., 1984) to delete the 500 bp ofnoncoding upstream sequence to a region near the putative HPRT start codon. Three isolates (pRDL 14 and 25) were found by nt sequence analysis to have deletion endpoints 45 bp upstream from the HPRT start codon. Plasmid pRDI was

untranslated sequence is located upstream from the putative HPR T. The significance of this observation as it relates to gene structure and the mechanism of gene expression in this organism remains to be determined. The complete nt sequence of the DraI-PstI fragment of our P. falciparum HPRT cDNA is shown in Fig. 3. This sequence contains a long ORF that can encode a 231-aa polypeptide with a calculated Mr of 26 360. The evidence that this ORF encodes the parasite HGPRT is as follows. First, the sequence surrounding the putative AUG start codon matches the consensus sequence for functional eukaryotic translation initiation sites (Kozak, 1983). The preferred sequence context translation initiation is ANNAUGN or GNNAUGR (where N is any nt and R is a purine). Second, two stop codons in the same reading frame are located 6 and 12 nt upstream from the putative linearized with EcoRl and digested with BAL 31 using conditions described by Silhavy et al. (1984) (see Fig. 1). The EcoRl and BAL 31-treated plasmid DNA was repaired with Pollk and T4 DNA polymerase (Boehringer-Mannheim) to ensure the presence of blunt ends and then digested with HindIII to isolate and subsequently clone the HPRT cDNA into a plasmid vector. The resulting 800-bp HPRT insert was lignted to pBS(+) vector DNA that had been digested with Xbal, repaired with Pollk, and finally digested with HindIll. The ligated DNA was transformed into £. coli strain JMI09 (obtained from Stratagene, La Jolla, CA), and recombinant plasmids were isolated by a 'miniprep' procedure (Maniatis et al., 1982). Miniprep DNA samples were analyzed by digestion with XbaI, since BAL 31-truncated insert fragments terminating in an A : T base pair when fused to the repaired XbaI site of pBS( + )would regenerate the Xbal site. Plasmids pRDI89 and pRD206 were found to contain HPRT inserts having a unique XbaI site. The nt sequence determination of these isolates demonstrated that both of these isolates terminated at an A : T pair 5 bp upstream from the P. falciparum HPRT start codon, which allowed the HPRT sequence to be isolated as an XbaI-Hindlll fragment for subsequent cloning into an expression vector, pRD206 was digested with Xbal and HindlI! and the resulting HPRT fragment was isolated. The HPRT insert DNA was blunted with MB, and ligated to the expression vector ptac-85 that had been digested with BamHl and treated with MB. The ptac-85 expression vector (Marsh, 1986) contains the strong hybrid tac promoter which is regulated by IPTG. Transformation ofE. coli GPI20 with the ligated DNA resulted in the isolation of plasmid pRD336 containing the P.falciparum HPRT insert in the correct orientation rclative to the tac promoter of ptac-85. The nt sequence analysis ofthejunction between SD of the ptac-85 vector and the 5' end of the P.faiciparum HPRT gene in plasmid pRD336 indicated that the SD-ATG start codon spacing was 4 bp, whereas a spacing of 5-9 bp has been shown to be optimal for the expression of foreign proteins in E. coil(Kozak, 1983). To isolate cDNA containing an optimal SD-ATG spacing we chose S 1 nuclease to blunt both ptac-85 vector DNA as well as the HPRT insert from pRD206. Ligation and transformation of these Sl-treated DNAs into E. coil strain GPI20 resulted in the isolation of plasmid pRD500, with an SD-ATG spacing of 9 bp. For site symbols see Fig. 1. P, Pollk; B3 !, BAL 31; BAP, bacterial alkaline phosphatase. GPI20 lacks the ability to synthesize purines de novo and is also unable to utilize guanine as a sole source of purine in minimal growth medium due to the absence of the bacterial XGPRT. Only cells containing a plasrnid that expresses a functional HGPRT which complements the gpt mutation of strain GPI20 are able to grow on minimal plates containing guanine.

66 *A *A *T AAAATTTATA CAAATTTTAATATAAACTTT CACCACACCAAAAACCAAAAATATATATTT AATTCATAAT ÷1 ATTAAACAAAATATATTTTT CTTTGTATAT ATTATTACTA TATATTTATA TAATATTAGAAAATC (CA 6 M P (2) ATA CCA AATAAT (CA GGA GCT GGT GAAAAT GCC TTT CAT CCC GET TTC GTAAAG GAT 63 I P N N P G A G E N A F D P V F V K D (21) UAC G A T G G T TAT GAC C T T G A T TCT T T T A T U AT( CCT GCA CAT TAT A A A A A A T A T CTT 120 D D G Y D L D S F M I P A H Y K K Y L (40) A C C A A G GTC TTA G T T C C A A A T G G T GTC A T A A A A A A C CGT A T T G A G A A A T T G GCT TAT 177 T K V L V P N G V I K N R I E K L A Y (59) GAT A T T A A A A A G GTG TAC AAC AAT G A A G A G TTT CAT ATT CTT TGT TTG T T G A A A G G T 234 D I K K V Y N N E E F H I L C L L K G (78) TCT CGT CC~ TTT TTC ACT GCT CTC T T A A A G CAT TTA AGT AGA ATA CAT AAT" TAT AGT 291 $ g G F F T A L L K H L S R I H N Y S (97) *T GCC G T T G A G ACG TCC A A A C C A T T A T T T GGA GAA CA( TAC GTA CGT GTG A A A T C C TAT 348 A V E T S K P L F G E H Y V g V K S Y (116) T G T A A T GAC C A A T C A ACA GGT A C A T T A G A A A T T GTA AGT G A A G A T TTA TCT TGT TTA 405 C N D Q S T G T L E I V S E D L S C L (135) A A A G G A A A A CAT G T A T T A ATT GTT GAA GAT ATT ATT GAT ACT GGT A A A A C A T T A GTA 462 K G K H V L I V E D Z Z D T G K T L V (154) AAG TTT TGT G A A T A C T T A A A G AAA TTT G A A A T A A A A A C C GTT GCC ATC GCT TGT CTT 519 K F C E Y L K K F E I K T V A I A. C L (173) T T T A T T A A A A G A ACA CCT TTG T G G A A T GGT T T T A A A G C T GAT TTC GTT G G A T T C TCA 576 F I K R T P L W N G F K A D F V G F S (192) ATT CCT GAT CA( TTT GTT GTT GGT TAT AGT TTA GAC TAT AAT G A A A T T TTC AGA GAT 633 I P D H F V V G Y S L D Y N E I F R D (211) C T T G A C CAT TGT TGT TTG G T T A A T GAT GAG G G A A A A A A G A A A T A T A A A G C A A C T TCA 690 L D H C C L V N D E G K K K Y K A T S (230) TTA TAAATACATTTAT TGAAGTGATC AAAAATGTCA CAACCTTTCT ATTTATATCA ATTTACCCCC L End CCCCCCCCCC CCCCTGCAGG Fig. 3. Nucleotidesequenceof/'.falc~arumDral.PstleDNAfragmentand the deducedaa sequence.Deviationsfrom Kingand Melton(1987)sequence are markedwithasterisks.The EMBLaccessionnumberis X!6279.The nt sequencewas determinedusingthe dideoxychain-terminationmethod(Sanger et al.. 1977), utilizing Pollk (Boehringer-Mannheim),MI3 universal and reverse primers (International Biotechnologies, Inc.), and [ot-35S]dATP (Amersham). Determinationof the completent sequence of the putative HPRT eDNA was facilitatedby subcloningfragmentswithinthe ORF into plasmidpBS(+ ). Sequenceswereanalyzedusingthe programsdevelopedby Pustelland Kafatos (1984).The nt and aa are numberedon the rightmargin (aa in parentheses). At present we do not knowthe tsp.

start codon of this polypeptide. Finally, Fig. 4 shows a comparison of the deduced aa sequences of the P. falciparum ORF and the human HGPRT (the human and mouse enzymes are identical except for 8 aa residues) (Kim et al., 1986; Melton et al., 1984; Konecki et al., 1982; Brennand et al., 1982). The results of this comparison indicate that the P. falciparum ORF encodes a polypeptide that is slightly larger than the human HGPRT protein, containing 8 additional N-terminal and 3 additional C-terminal aa. More importantly, the comparison shows that the putative P. falciparum HGPRT is 49~o homologous to human HGPRT. These results are similar to those of King and Melton (1987). This degree of homology, in addition to the other characteristics mentioned, makes it very likely that the designated ORF in the P.falciparum cDNA clone does

encode the parasite HGPRT. However, verification of its identity required expression of the cloned eDNA in E. coll. (c) Expression of HPRT in XGPRT-deficient Escherichia coil gptTo isolate a recombinant plasmid containing an optimal SD-ATG spacing both the ptac-85 vector and the HPRT insert from PRD206 were treated with S 1 nuclease or MB which resulted in isolation of pRD500 and pRD336 (Fig. 2). GP120[pRD500] cells exhibited a higher growth rate on minimal media containing guanine than E. coli GPI20 (Kalle and Gots, 1961). This experiment demonstrates that the P.falciparum HPRT gene product can complement the ~ t mutation in E. coli strain GP120. GP120 transformants containing (i) ptac-85 (negative con-

67 h

p h p

MATRSPG~/_IS MPI PNNI~GAGENAFDP_VFV

11 (19 )

DDEPGYDLDL~CIPNHXAE K~DDGYDLDS_FMIPAI~XKK

30 (38 )

h

DLER_VFIPHGLIMDRTERL

49

p

YLTIC!LV~N_GVI K N E I E I ~

(57 )

h

~EaR~C~HHXV~

P

~¥]2T~NNEEFHILCLL

(76)

h p

KGGYKF_.~AD~YIKALNR KGSRGFFTALLKHLSRIHN

87 (95 )

h p

NS--DR~IPMTVD-FIRLK YSAVETSKPLFGEHYVSVI~

103 (114 )

h p

SYCNDOSTGDIKVIGGDD~ SYCNDOSTGTL-EIVSEDL

122 (132 )

h p

STLTGKNVLIVEDI I DTG~ SCI~KGKHVLIVE DI I DTGK

141 (151 )

h p

2MNTLLSLVRQYNP~ TLVKFCEYLKKFEIET~_AI

160 (170)

h p

~SLLVKRTPRSVGYE~PDFV ACLF I KRTPLWN~FEADFV

179 (189 )

h p

GFEIPDKFVVGYALDYNEY GFSLp. HFVVCYSLDYNEI

198 (20S)

h p

Ze£LSaVGVZSETN FRDLDHCCLVNDE

2X7 ( 227 )

h p

A ATSL

6S

KYK

Fig. 4. Comparison of the an sequences of human (h) HGPRT (Jolly et al., 1983) and the homologous P.falcipavum(p) ORF. Identical aa are underlined. Dashes indicate gaps introduced to allow maximum alignment.

trol), or (ii)pRD500, (iii)ptac-mHPT (ptac-85 vector containing the mouse HPR T cDNA; positive control), and (iv) pSV2gpt (a plasmid containing the E. coil gpt gene encoding XGPRT; positive control) were streaked onto minireal plates containing guanine, proline, Ap, and IPTG and evaluated for their growth characteristics on this selective medium (Fig. 5). The results presented in Fig. 5 show that recombinant plasmid pRD500 is expressing the P. falciparum HPR T as indicated by significant growth on minimal guanine or xanthine selective plates. The GP120[ptac-85] negative control strain grows slightly on these selective plates due to

the presence of the bacterial HPR 7" which enables the host cell to salvage guanine at a very low level. GPI20[pSV2~t] grows on all these selective plates because synthesis of E. coli XGPRT encoded by the pSV2gpt plasmid is constitutive and is not subject to lac repressor regulation. GPl20[ptac-mHPT] fails to grow on minimal medium containing xanthine due to the inability of the mammalian HGPRT enzyme to utilize xanthine as a substrate (Queen et al., 1988). The strain displaying the highest levels of P. falciparum HGPRT was GPI20[pRD500], which grew at a rate equal to that ofthe GP120[ptac-mHPT] strain and about 2/3 the rate of the GP120[pSV2~t] strain used as a positive control (Fig. 5). To date, the recombinant plasmid pRD500 appears to be the best isolate for expressing the recombinant P. falciparum HPR T gene product, at least in terms of its growth rate on the guanine-supplemented minimal selective medium. We have analyzed by PAGE the extracts of bacteria containing the P.falciparum HPRT-expressing plasmids and we see the appearance of a 26-kDa protein. This is in agreement with the predicted Mr of the protein encoded by the ORF identified in clone plA7 (Fig. 6). We measured the activity of HGPRT using guanine as a substrate (Vasanthakumar and Davis, 1989a, b) and found that the recombinant plasmid pRD500 showed the specific activity of 5.54 nmol/min/mg for HGPRT in the presence of IPTG, but only 0.48 nmol/min/mg in the absence of IPTG. Since HGPRT from P.falciparum can also use xanthine as a substrate, we measured the HGPRT activity in the presence of IPTG using xanthine as a substrate (Queen et al., 1988). The recombinant plasmid pRD500 containing the complete cDNA-encoding HGPRT showed the specific activity of 6.1 nmol/min/mg of protein for HGPRT activity in the presence of IPTG, while no HGPRT activity was detected in the absence of IPTG. The relatively efficient levels of expression of P. falcipa. rum HPR T in E. coli that we have observed are surprising in view of the high A + T content of the parasite HPRT cDNA. Expression of Piasmodium genes in E. coil would be predicted to be less than optimal due to the use of unpreferred codons present in the parasite gene (Weber, 1987). King and Melton (1987) were unable to express their HPR T cDNA clone in mammalian hosts and attributed their lack of success to codon usage problems. Our success in expressing the HPR T cDNA in bacteria suggests that other unknown factors may be involved in stabilizing this protein in a foreign host. (d) Conclusions

As described above, we have cloned a full=lengthcDNA coding for HGPRT from P. falciparum and demonstrated the expression of the cDNA in E. coli. We also show the induction of HGPRT activity in the presence of IPTG. We

68 M9 Medium Con~ninl

.IPTG

Guanine +lFr(3

M9 Medium Containing Xanthine .IPT(3 +IFIG

GP120 [ptac85]

A

GP120[ptac85mHPT]

B

GP120[pSV2Opt]

C

GP120[pRD5001

D

1

2

3

4

Fig. 5. The growth ofE. coli transformants on minimal medium containing guanine or xanthine. GP120[ptac-85] is E. coil strain GPI20 containing ptac-85 which served as a negative control. When grown in presence of guanine, the colony size was 0.2 mm (A2). GPI20[pSV~t] is strain GPi20 containing the pSV2gpt plasmid which encodes the £. coil XGPRT which served as a positive control. When grown in presence ofguanine the colony sL~ was 3.0 nun (C2). GP120[ptac-85mHPT] is GPI20 containing the mouse HPRT cDNA which served as a positive control. When grown in presence of guanine the colony size was 2.0 mm (B2). GPI20[pRD500] is GPI20 containing the recombinant P.falciparum HPRT cDNA plasmid. When grown in presence of guanine the colony size was 2.0 mm (D2). (A! and A3) GP120[ptac-85] - IPTG; (A2 and A4) GP120[ptac-85] + IPTG; (B1 and B3) GPl20[ptac8$mHPT] - IPTG; (!12 and !14) GPl20[ptac-8$mHPT] + lPTG; (C2 and C3) GPl20[pSV2gpt] - IPTG; (C2 and (:4) GPI20[pSV2~t] + IPTG; (DI and !)3) GPl20[pRDsoo] - IPTG; (D2 and D4) GPl20[pRDsoo] + lPTG.

1

2

3

4

6

6

KDa 43.0

25.5 o

17.9 14.5

Fig. 6. Analysis of proteins produced in E. coil Extracts were prepared by pelleting cells and resuspending the pellets in SDS sample buffer containing 0.125 M Tris.HCl pH 6.8/4% SDS/20~ glycerol, 10~ 2-mercaptoethanol. The samples were loaded onto a 0.1% SDS/I$% polyacrylamide gel, dectropho~'esod and stained with Coomassie brilliant blue. Lanes: I, GPl20[ptac-8$] in absence of IPTG; 2, GPI20[ptac-85] in presence of IPTG; 3, GPI20[pRD336] in absence of IPTG; 4, GPI20[pRD336] in presence of IPTG; S, GPI20[pRD$00] in absence of IPTG; 6, GPI20[pRD$00] in presence of IPTG. The arrow indicates the appearance of a 26-kDa protein (HGPRT). Bacterial cells (GPI20[pRD$00]) were centrifuged for 10min at 1000 × g, 4°C, and washed with cold PBS. The cell pellet was stored at -70°C until needed; the cell pellet was sonicated in 0.3 ml of a buffer composed of25 mM Tris pH 7.5/1 mM MgCI=/I mM PRPP/3/Ag each of several protease inhibitors, including leupeptin, antipain, chymostctin, pepstatin and phosphoramidone. The supernatant fraction resulting from centrifugution at 100000 × g for 30 rain served as the enzyme source for all subsequent studies. The samples were analyzed by 0.1% SDS/15% PAGE by using 15% slab gels and stained with Coomassie brilliant blue R250, as described by Laemmli (1970).

69 are currently purifying the HGPRT enzyme to homogeneity and will attempt to design an effective inhibitor based upon the three-dimensional structural information obtained from x-ray crystallography. ACKNOWLEDGEMENTS

We would like to thank Dr. J.V. Ravetch (DeWitt Wallace Research Laboratories, Memorial Sloan-Kettering Cancer Center, New York) for kindly providing cDNA library and Dr. J.S. Gots (Department of Microbiology, University of Pennsylvania, Philadelphia, PA) for E. coil strain GPI20. We would also like to thank Dr. Chi-Hsiung Chang (Department of Biochemistry, Southern Research Institute, Birmingham, AL) for performing the enzyme assays. The mouse probe (ptac-85mHPT) and plasmid ptac-85 were kindly provided by Dr. Thomas Caskey (Howard Hughes Medical Institute Laboratories, Baylor College of Medicine, Houston, TX) and Dr. Marsh (Department of Biophysics, King's College, London), respectively. This work was supported by Institute Sponsored Research Funds at Southern Research Institute, Birmingham, AL and BRSG SO7 RR05676 awarded by the BRSG Program, Division of Research Resources, NIH and partly supported by the UNDP/World Bank/World Health Organization Special Programme for Research and Training in Tropical Diseases.

REFERENCES Berens, R.L., Mart, J.J., LaFon, S.W. and Nelson, D.J.: Purine metabolism in 7~panosoma cruzi. Mol. Biochem. Parasitoi. 3 (198 I) 187-196. Brennand, J., Chinault, A.C., Konecki, D.S., Melton, D.W. and Caskey, C.T.: Cloned eDNA sequences of the hypoxanthine/guanine phosphoribosyltransferase gene from a mouse neuroblastoma cell line found to have amplified genomic sequences. Proc. Natl. Acad. Sci. USA 79 (1982) 1950-1954. Jolly, D.J., Okayama, H., Berg, P., Esty, A.C., Filpula, D., Bohlen, P., Johnson, G.G., Shively, J.E., Hunkapillar, T. and Friedmann, T.: Isolation and characterization of a full.length expressible eDNA for human hypoxanthine phosphoribosyltransferase. Proc. Natl. Acad. Sci. USA 80 (1983) 477-481. Kalle, G.P. and Gots, J.S.: Alterations in purine nucleotide pyrophosphorylase and resistance to purine analogues. Biochim. Biophys. Acta 53 (1961) 166-173. Kim, S.H., Moores, J.C., David, D., Respess, J.G., Jolly, D.J. and Friedmann, T.: The organization of the human HPRT gene. Nucleic Acids Res. 14 (1986) 3103-3118. King, A. and Melton, D.W.: Characterization of eDNA clones for hypoxanthine-guanine phosphoribosyltransferase from the human malarial parasite, Plasmodium falciparum: comparisons to the mammalian gene and protein. Nucleic Acids Res. 15 (1987) 10469-10481. Koza~ M.: Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles. Microbiol. Rev. 47 (1983) 1-45.

Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 41970) 680-685. McCutchan, T.F., Hansen, J.L., Dame, J.B. and Mullins, J.A.: Mungbean nuclease cleaves Plasmodium genomic DNA at sites before and al~er genes. Science 225 41984) 625-628. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY, 1982, pp. 368-369. Marsh, P.: ptac-85, anE. colivector for expression ofnon-fusion proteins. Nucleic Acids Res. 14 41986) 3603. Melton, D.W., Konecki, D.S., Brennand, J. and Caskey, C.T.: Structure, expression and mutation of the hypoxanthine phosphoribosyJtransferase gene. Proc. Natl. Acad. Sci. USA 81 (1984) 2147-2151. Pusteli, J. and Kafatos, F.C.: A convenient and adaptable package of computer programs for DNA and protein sequence management, analysis and homology determination. Nucleic Acids Res. 12 (1984) 643-655. Queen, S.A., Jagt, D.V. and Reyes, P.: Properties and substrate specificity of a purine phosphoribosyltransferase from the human malaria parasite, Plasmodium falcipanam. Mol. Biochem. Parasitol. 30 41988) 123-134. Ravetch, J.V. and Kochan, J.: Isolation of the gene for a glycophorinbinding protein implicated in erythrocyte invasion by a malaria parasite. Science 227 (1985) 1593-1597. Reyes, P., Rathod, P.K., Sanchez, D.J. Mrema, J.E.K., Rieckmann, K.H. and Heidrich, H.G.: Enzymes of purine and pyrimidine metabolism from the human malaria parasite, Piasmodium falciparum. Mol. Biochem. Parasitol. 5 41982) 275-290. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 41977) 5463-5467. Silhavy, T.J., Berman, M.L. and Enquist, L.W.: Experiments with Gene Fusions. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY, 1984, pp. 205-207. Sullivan, M.A., Lloyd, D.B. and Holland, L.E.: Isolation and characterization of the gone encoding hypoxanthine-guanine phosphoribosyltransferase from Plasmodlumfalcipamm. In Agabian, N., Goodman, H. and Nogueira, N. (Eds.), UCLA Symposia on Molecular and Cellular Biology, New Series, Voi. 42. Alan Liss, New York, 1987, pp. 575-584. Van Dyke, K., Tremblay, G.C., Lantz, C.H. and Szustkiewicz, C.: The source ofpurines and pyrimidines in Plasmodlumberghei. Am. J. Trop. Med. Hyg. 19 (1970) 203-208. Vasanthakumar, G. and Davis, R.L.: Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Plasmodiumfaiciparum in £. coll. J Cell. Biochem. 13E (1989a) 125. Vasanthakumar, G., Davis, R.L., Sullivan, M.A. and Donahue, J.P.: Nucle(~:ide sequence ofcDNA clone for hypoxanthine-guanine phosphoribosyltransferase from Plasmodium falc~varum. Nucleic Acids Res. 17 (1989b) 8382. Walsh, C.J. and Sherman, I.W.: Purine and pyrimidine synthesis by the avian malaria parasite Piasmodlum Iophurae. J. Protozool. 15 (1968) 763-770. Wang, C.C.: Parasite enzymes as potential targets for antiparasitic chemotherapy. J. Med. Chem. 27 (1984) 1-9. Weber, J.L.: Analysis of sequences from the extremely A + T-rich genome of Plasmodiumfalc~parum. Gene 52 (1987) 103-109. Wernsdorfer, W.: Urgent efforts needed to combat drug-resistant malaria. WHO Chron. 37 (1983) !1-13.