American Journal of Therapeutics 21, 462–469 (2014)
Cloning and Expression of Recombinant Human GMCSF From Pichia pastoris GS115-A Progressive Strategy for Economic Production K. Srinivasa Babu, MTech, PhD,1 Krishna Kanth Pulicherla, MTech, PhD,2* Aju Antony, MS,1 and Sankaranarayanan Meenakshisundaram, MTech, PhD1
Human granulocyte–macrophage colony-stimulating factor (hGMCSF) is a proinflammatory cytokine and hematopoietic growth factor. Recombinant human granulocyte–macrophage colonystimulating factor (rhGMCSF) serves as a biotherapeutic agent in bone marrow stimulations, vaccine development, gene therapy approaches, and stem cell mobilization. The objective of the present study includes construction of rhGMCSF having N-terminal intein tag, expression of protein both extracellularly and intracellularly from yeast expression system followed by its purification in a single step by affinity chromatography. The soluble and biologically active rhGMCSF was obtained from Pichia pastoris GS115. About 122 g DCW/L of final yield was obtained for both cytosolic and secretory expression of Pichia GS115 strain. Purified intracellular hGMCSF was 420 mg/L with a specific activity of 2.1 3 108 IU/mg, and the purified extracellular recombinant protein was 360 mg/L with a specific activity of 1.9 3 108 IU/mg. The data presented here indicate the possibilities of exploring the economic ways of producing the rhGMCSF. Keywords: Pichia pastoris, methylotrophic yeast, hGMCSF, intein tag, chitin affinity chromatography
INTRODUCTION Human granulocyte–macrophage colony-stimulating factor (hGMCSF) is a cytokine secreted in response to inflammatory and immune stimuli by T cells, macrophages, endothelial cells, mast cells, and fibroblasts. This cytokine is crucial for stimulation of proliferation and differentiation of many hematopoietic cells.1 GMCSF is used in treating myeloid leukemia, neutropenia, and aplastic anemia, and it greatly lowers the risk of infection during bone marrow transplantation, by accelerating neutrophil formation.2 Recombinant 1
Centre for Biotechnology, Anna University, Chennai, India; and Centre for Bioseparation Technology, VIT University, Vellore, India. The authors have no conflicts of interest to declare. *Address for correspondence: Centre for Bioseparation Technology, VIT University, Vellore 632014, India. E-mail: kkpulicherla@ gmail.com 2
1075–2765 Ó 2014 Lippincott Williams & Wilkins
human granulocyte–macrophage colony-stimulating factor (rhGMCSF) is used as a biotherapeutic in chemotherapy for immunocompromised patients.3 Owing to its biological and pharmaceutical importance, production of rhGMCSF has been made available from different recombinant expression systems, such as Escherichia coli,4 Saccharomyces cerevisiae,5 baculovirus,6 transgenic animals,7 mammalian cell lines,8 and plant cell system.9 But with overexpression systems like E. coli, it was found that inclusion bodies were formed10,11 where their inaccurate processing or protein misfolding leads to the formation of biologically inactive protein and also final yield of the protein was observed to be compromised. Hence, many optimization studies concerned to expression and refolding are required to attain an active protein.12 Such problems were overcome later by using yeast systems that offered certain advantages such as they help in correct folding of the proteins and also has the ability of glycosylation, which is very crucial for biological activity of the eukaryotic protein. The first eukaryotic www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115
expression system that came into usage is the S. cerevisiae, but the problems of hyperglycosylation, low protein yield, etc, were noticed.5 Methylotrophic yeast Pichia pastoris has been used as an alternative expression host due to the advantages such as huge cell densities in simple defined medium, having strong inducible promoters, and commercially available vectors and hosts for genetic manipulations.13,14 Recombinant protein can be expressed either intracellularly or extracellularly by P. pastoris expression system. Secretion of protein is preferred and referred to as the first step in purification of heterologous protein as it separates the protein from bulk of the cellular proteins15–17 so that the recombinant protein forms a major portion of the total protein in the expression medium. The obtained recombinant protein can be purified by the use of fusion protein and affinity technology. Various conventional purification strategies and also fusion tags have been tried to express and purify the rhGMCSF.18 But the major drawback lies with the removal of protease after separating affinity tag that involves huge cost, quantity compromise, etc. Hence, in the present work, chitin-based intein-mediated protein purification has been used successfully for easy purification of intracellular and extracellular rhGMCSF protein from P. pastoris GS115 in a single step.
MATERIALS AND METHODS Strains and vector Escherichia coli Top 10F9 strain was used as maintenance host. Bacteria were cultured in LB medium having 0.5% yeast extract, 0.5% NaCl, and 1% of tryptone with 100 mg/mL of ampicillin. Pichia pastoris GS115 (his 4) (Invitrogen, San Diego, CA) was used as a host strain for both intracellular and extracellular expression of the rhGMCSF. The media and procedures, used for P. pastoris growth and transformation, were described in Pichia protocols. pTYB11 vector was purchased from New England Bio Labs (Ipswich, MA), and vectors pPICZB and pPCIZaB were obtained from Invitrogen. The parental clone pVM1 (pRSETB: hGMCSF) was kindly provided by Dr. V. Murugan, Centre for Biotechnology, Anna University. Vector construction and transformation studies Construction of pPICZB:hGMCSF vector The hGMCSF gene (408 bp) was amplified from the parental clone pVM1 (pRSETB:hGMCSF) by polymerase chain reaction (PCR) with the following primers: hGMCSF (intein) forward 59-CAGGTTG TTGTACA GAACGCACCCGCCCGCTCGCC C-39 and GMCSF www.americantherapeutics.com
463
reverse 59-TGCTCTAGATCACTCCTGGACTGGCTCC CA-39. The gene sequence coding for the chitin-binding domain (CBD)-intein tag was amplified using the plasmid pTYB11 and the primers: intein forward 59CCGGAATTCATGTGCTTTGCCAAGGGTAC-39 and intein (GMCSF) reverse 59-GGGCGAGCGGGCGGG TGCGTTCTGTACAACAACCTG-39. The hGMCSF forward primer and the CBD-intein reverse primer were designed to contain a short stretch of complementary sequences and so by using the overlap extention PCR of the 2 amplification products, the overlapping ends of the 2 fragments annealed and got extended. The fusion product had EcoRI site at the 59 end and XbaI site at the 39 end. The PCR product was double digested and inserted in the multiple cloning site of pPICZB, resulting in pPICZB/hGMCSF plasmid. Construction of pPICZaB:hGMCSF vector As said above, the fusion was made by overlap extention PCR. It was further digested and inserted into the pPICZaB for extracellular expression of the rhGMCSF. All the recombinant DNA methods were performed essentially as described in Molecular Cloning.19 The hGMCSF expression plasmids pPICZB:hGMCSF and pPCIZaB:hGMCSF were digested with SacI and transformed to P. pastoris GS115 cells (80 mL) by electroporation using an Electroporater 2510 at 1500 V at a time constant of 4.8–5.0 seconds with a 0.2-cm cuvette. After electroporation, 1 mL of ice-cold 1 M sorbitol was immediately added to the cuvette and incubated for 1 hour at 30°C. The cells were selected on YPDS plates (1% yeast extract, 2% peptone, 2% glucose, and 1 M sorbitol) with zeocin (0.1 mg/mL). The genomic DNA was isolated from the transformants, and the integration of the gene was confirmed with insert-specific primers. Selection of multicopy clones Putative clones of GS115 (pPICZB:hGMCSF and pPCIZaB:hGMCSF) harboring multiple copies of the constitutive hGMCSF expression cassette were selected on YPD plates containing 0.5, 1.0, 1.5, and 2.0 mg/mL of zeocin. After 4 days of incubation at 30°C, clones were evaluated for their ability to grow in the presence of increased concentration of the antibiotics. Clones that survived under highest concentrations of antibiotics were cultured to screen their hGMCSF expression level by Western blot using anti-hGMCSF antibodies. Fermentation of recombinant P. pastoris GS115 (pPICZB:hGMCSF and pPCIZaB:hGMCSF) Fermentation was carried out in a 2-L bioreactor (Bioengineering KLF 2000) with 1.2 L of basal salts American Journal of Therapeutics (2014) 21(6)
464
medium: (composition per liter) 26.7 mL of 85% H3PO4, 0.93 g of CaSO4$2H2O, 18.2 g of K2SO4, 14.9 g of MgSO4$7H2O, 4.13 g of KOH, 40.0 g of glycerol, and 4 mL/L PTM1 solution: (composition per liter) 6.0 g of CuSO4$5H2O, 0.08 g of NaI, 3.0 g of MnSO4$H2O, 0.2 g of Na2MoO4$2H2O, 0.02 g of H3BO3, 0.5 g of CaSO4$2H2O, 0.5 g of CoCl2, 20.0 g of ZnCl2, 65.0 g of FeSO4$7H2O, 0.2 g of biotin, and 5 mL of concentrated H2SO4. A 50 mL of BMGY medium, grown for 36 hours, was used as inoculum and the initial batch cultivation was carried until the exhaustion of glycerol. A fed-batch phase using 50% glycerol at the feed rate 15 mL/h was then initiated, and after 4 hours, the feed was switched to 100% methanol (containing 1 mL/L PTM1 solution) at an initial feed rate 2 mL/h. This feed rate was then increased stepwise to maintain residual concentration of 0.5% methanol in the reactor. The pH during entire fermentation was adjusted and controlled at 5.0 with the addition of 28% ammonia solution and the temperature was maintained at 28°C. Samples were withdrawn at regular intervals and analyzed for the biomass, expression, and activity of rhGMCSF. Affinity purification pPICZB:hGMCSF The fermentation broth was harvested by centrifugation and the cell pellet was disrupted by ultrasound after resuspending 10 g of the cell pellet in 50 mL of ice-cold sonication buffer (100 mM Tris buffer containing 1 mM EDTA, 500 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride, pH 8.0). The suspension was centrifuged at 10,000 rpm for 10 minutes and the clear supernatant was loaded onto a 10-mL column of chitin beads (New England Biolabs) that had been equilibrated with 100 mM Tris buffer containing 1 mM EDTA and 500 mM NaCl, pH 8.0. The column was washed with 10 column volumes of equilibration buffer and on-column cleavage induction was carried out using 100 mM Tris buffer containing 30 mM dithiothreitol (DTT), 1 mM EDTA, and 100 mM NaCl (pH 8.0) at 4°C for 40 hours. The rhGMCSF was then eluted with 5 column volumes of equilibration buffer. pPCIZaB:hGMCSF The fermentation broth was harvested and the clarification was done by centrifugation. The clear supernatant was collected and clarified using 0.45 mm filtration to remove the cell debris and small suspended particles. This supernatant was concentrated using 10 kDa ultrafiltration membranes, and the concentrated broth was loaded on to a gel filtration matrix Superdex 75 (GE Healthcare) for the final purification. Different American Journal of Therapeutics (2014) 21(6)
Srinivasa Babu et al
elution fraction of gel filtration was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) to identify the hGMCSF fraction. Analysis of biomass Cell density was measured at 600 nm in a UV-visible spectrophotometer (Hitachi U-2000). Samples having higher optical density were diluted to show absorbance of 0.2–0.6. Dry cell weight (g DCW/L) was determined by taking 5 mL of culture sample in a preweighed centrifuge tube and centrifuged at 10,000 rpm for 5 minutes. The cell pellets were washed and dry cell weight was measured by drying the wet pellet to a constant weight at 80°C. The expression of hGMCSF was analyzed using SDS-PAGE, and Western blot analysis was done with anti-CBD antibody for the fusion product and anti-hGMCSF monoclonal antibody for the purified product. Biological activity assay The biological activity of rhGMCSF was determined by its growth-promoting action on TF1 cell line.20 The TF1 cell lines were maintained in RPMI-1640 medium (Gibco, Grand Island, NY) containing 10% fetal bovine serum (Hyclone). To initiate cellular proliferation, different concentrations (1–25 ng/mL) of rhGMCSF were added to the culture medium. WHO samples of hGMCSF having specific activity of 1.5 3 107 U/mg was used as standard. The assay was set in a 96-well flat bottom culture plates using RPMI-1640 as control. Growth-promoting activity was evaluated by MTT colorimetric assay. MTT solution (10 mL) was added to all wells, and plates were incubated at 37°C for 4 hours. Acid–isopropanol (100 mL of 0.04 N HCl in isopropanol) was added to all wells and mixed thoroughly to dissolve the crystals. The plates were read on a Dynatech MR600 microplate reader. A test wavelength of 570 nm and reference wavelength of 630 nm were used for calculation of units of activity. The experiments were carried out in triplicates, and cells were incubated in 5% CO2 incubator maintained at 37°C.
RESULTS Expression vector construction and transformation studies Construction of pPICZB:hGMCSF vector The individual and specific primer-based PCR for amplification of hGMSCF and CBD-intein genes followed by overlapping extension PCR step were effectively and successfully optimized. The hGMCSF www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115
gene was amplified from parental clone as 408-bp product and the intein gene from pTYB11 as 1.560kb product. Overlap-extension PCR resulted in the fusion of CBD-intein and hGMCSF genes shown in Figure 1, and the recombinant plasmid was generated upon ligation of pPICZB with the inteinCBD–hGMCSF fusion gene and subsequent E. coli Top 10F9 transformation. After PCR confirmation of the recombinant plasmids (Figure 2), electroporation of the plasmid in P. pastoris GS115 had produced more than 25 colonies in lower zeocin concentration of 100–200 mg/mL and 3 colonies in 1.5 mg/mL of zeocin concentration. PCR analysis of the genomic DNA extracted from the Pichia recombinants (1.5 mg/mL of zeocin concentration) confirmed the presence of the fusion hGMCSF gene and was selected for expression studies. Construction of pPCIZaB:hGMCSF vector The fusion gene containing hGMCSF with N-terminal intein tag was successfully cloned into pPCIZaB and were transformed into E. coli Top 10F9. After PCR confirmation of the recombinant plasmids, electroporation of the plasmid in P. pastoris has resulted in the expression clones of GS115 with hGMCSF. High-copynumber transformants were selected that have the ability to tolerate increased zeocin concentrations (1.5 mg/mL). Among them, one of the high-copynumber clones was used for the expression of hGMCSF.
465
FIGURE 2. Amplification of hGMCSF. Lane 1 5 100-bp DNA ladder, lane 2 5 408-bp hGMCSF, lane 3 5 hGMCSF (amplified from pPICZB:hGMCSF as a positive control), and lane 4 5 negative control.
Fermentation of recombinant P. pastoris GS115 The expression of rhGMCSF in P. pastoris GS115 was done by the high-cell density fermentation process involving 3 phases: the glycerol batch phase, fed-batch phase, and the methanol fed-batch phase. The switchover between the phases has been identified by sharp rise in DO concentration due to the exhaustion of carbon source. The initial glycerol batch and the glycerol fed-batch phases produced biomass concentrations of 28 g/L and 52 g/L (DCW), respectively. The methanol fed-batch phase involves the production phase of the fermentation process and the cell density had increased along with the production of recombinant protein. Cells were harvested after 118 hours (when the methanol utilization declined) and the final dry weight of 122 g/L was obtained. The cultivation profile is shown in Figure 3, and the hGMCSF fusion protein expression at different hours is shown in Figures 4 and 5. Affinity purification pPICZB:hGMCSF
FIGURE 1. Fusion of hGMCSF and intein-CBD by overlap extension PCR. Lane 1 5 DNA ladder, lane 2 5 408-bp hGMCSF gene from pRSETB, lane 3 5 1.56-kb intein gene from pTYB11, and lane 4 5 1.935-kb InteinhGMCSF overlapped product. www.americantherapeutics.com
Purification of the intracellular protein was carried out in the chitin affinity column by loading the clarified supernatant after cell disruption and the recombinant protein was eluted by inducing the on column cleavage with DTT. SDS-PAGE analysis of the purified sample (Figure 4) showed single band slightly above 14 kDa, which is consistent with the molecular weight of hGMCSF and was confirmed by Western blot analysis (Figure 6). Single-step purification was achieved with the yield of 420 mg/L for rhGMCSF. pPCIZaB:hGMCSF The supernatant of fermentation broth was centrifuged, collected, and clarified using 0.45 mm filtration American Journal of Therapeutics (2014) 21(6)
466
Srinivasa Babu et al
FIGURE 3. Growth kinetics of Pichia pastoris GS115. 1 5 Start of glycerol fed batch, 2 5 start of methanol fed batch.
to remove the cell debris. This supernatant was concentrated using 10 kDa ultrafiltration membranes and the concentrated broth was loaded on to a gel filtration matrix Superdex 75 for the final purification. The eluted fraction of the gel filtration was analyzed by SDS-PAGE (Figure 5) to identify the pure hGMCSF fraction and was confirmed by Western blot analysis (Figure 6) after deglycosylation with PNGase F (Roche Diagnostics, GmbH, Mannheim, Germany). The yield
of the extracellular purified hGMCSF was found to be 360 mg/L. Biological assay of rhGMCSF The specific biological activity of the purified rhGMCSF from intracellular P. pastoris GS115 was 2.1 3 108 IU/mg and for the extracellular was 1.9 3 108 IU/mg, and these specific activities are comparable with the values reported from the protein derived from others.21,22 Purified rhGMCSF showed no significant loss in its activity when stored for more than 4 weeks at 220°C at pH 7.0.
DISCUSSION
FIGURE 4. SDS-PAGE profile of intracellular hGMCSF expressed from Pichia pastoris GS115. Lane 1 5 molecular weight marker; lane 2 5 uninduced pellet; lanes 3, 4, 5, and 6 5 induced pellet 48, 60, 72, and 96 hours, respectively; lanes 7, 8 5 purified fractions of hGMCSF. American Journal of Therapeutics (2014) 21(6)
Most of the currently marketed biotherapeutics (.50%) are produced in mammalian cell lines even though other platforms, such as bacteria, yeasts, and plant cells, are available8 due to need of cell lines for accurate posttranslational modifications. The property of glycosylation is very significant as glycans that are bound to proteins influence biological activity, halflife, tissue distribution, and sometimes also show immunogenicity.23 GMCSF is a biotherapeutic that belongs to the family of colony-stimulating factors and known to regulate differentiation and proliferation of hematopoietic cells.24 It is used in the treatment of neutropenia, neurological seizures, myeloid leukemia, www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115
467
FIGURE 5. SDS-PAGE profile of extracellular hGMCSF expressed from Pichia pastoris GS115. Lane 1 5 molecular weight marker, lane 2 5 uninduced culture supernatant, lanes 3, 4, 5, and 6 5 culture supernatant after induction at 36, 48, 72, and 96 hours, respectively; lane 7 5 purified hGMCSF (by gel chromatography—Superdex 75).
FIGURE 6. Western blot analysis of purified hGMCSF probed with mouse anti-hGMCSF monoclonal antibody. Lane 1 5 molecular weight marker, lane 2 5 induced pPCIZB vector in Pichia pastoris GS115 (control), lane 3 5 induced pPCIZaB vector P. pastoris GS115 (control), Lane 4 5 purified hGMCSF from pPCIZB; hGMCSF (internal), lane 5 5 purified hGMCSF from pPCIZaB:hGMCSF (external).
and aplastic anemia.1 The hGMCSF is a glycoprotein of 127 amino acids having 2 antiparallel b-sheets and 4 bundles of a-helix.25 Although many trials have been made to produce rhGMCSF using various prokaryotic and eukaryotic expression hosts, E. coli and yeast systems are in focus of current research due to advantage of GMCSF being more active in nonglycosylated form. In the present trial, a comparative study has been conducted between productivity and activity of cytosolic and secretory expression of rhGMSCF having N-terminal fusion of intein–chitin–binding domain expressed in P. pastoris GS115 host system using pPICZ. The standard AOX-based vector was modified to introduce the intein-CBD and the expression cassette was integrated into P. pastoris GS115 host. The screening of multi-copy integrants was carried out with the increasing concentrations of zeocin. The expression of heterologous proteins is generally carried out using 3stage high cell density cultivation in P. pastoris.14 Similar strategy was used here to express this protein, and yield up to 420 mg/L was obtained in the intracellular expression using Pichia GS115 strain. Previously, similar expression studies were carried using P. pastoris SMD1168 in comparison between E. coli BL21 (DE3) and E. coli GJ1158. In the former, the protein was expressed as inclusion bodies with an yield of 7 mg/L with a specific activity of 0.59 3 107 IU/mg. In the case of salt-inducible E. coli GJ1158, hGMCSF was expressed in a soluble form at 20 mg/L with a specific activity of 0.9 3 107 IU/mg. Pal et al26 reported the extracellular protein expression of 250 mg/L where toxicity of the protein was eliminated to a larger extent. Attempts were also made to produce murine
granulocyte–macrophage colony-stimulating factor by using glycoengineered P. pastoris strain. It was found that GMCSF was produced at high levels (hundreds of milligrams per liter)23 where conventional purification system was used. But in our present attempt, we obtained an extracellular protein expression of 360 mg/L. The yield from P. pastoris GS115 was found to be higher compared with E. coli and P. pastoris SMD1168-based expression reported in our previous publications for the same protein.27,28 The amount of GMCSF produced was lower than murine granulocyte–macrophage colony-stimulating factor produced in Pichia, but production of hGMCSF with intein tag has a scope to cut down the production cost and purification of this biotherapeutic agent at larger scale. Normally, histidine ligand affinity chromatography has been reported to be in use for purification of proteins.29 Later, to eliminate the 2-step purification problem and the expensive enzymatic cleavage of fusion proteins, the intein-based systems with chitinbinding domain was developed.30 The use of intein as a fusion technology simplifies the protein purification31, wherein the DTT induces self-cleavage of intein and thereby separates the recombinant protein from the intein tag. Intein-mediated purification has been used for expression and purification of proteins with an in vitro DTT-induced intein cleavage.32,33 The intein tag can be placed either at the N-terminus or C-terminus of the protein. It was reported that DTT concentrations of more than 30 mM leads to destabilization of the disulfide bonds34 and use of DTT could hinder the 2 disulfide bonds that are crucial for hGMCSF activity.1 In our earlier attempt, we used intein-based expression
www.americantherapeutics.com
American Journal of Therapeutics (2014) 21(6)
468
system for expressing hGMCSF in E. coli where 50 mM DTT was used and obtained a reasonable biological activity.27 In the present work, DTT concentration that is required to cleave the intein tag has been gradually decreased and finally optimized to 30 mM. This technology was overcome with other histidine or GST-based fusion protein purification protocols where the problems of nonspecific protein binding, expensive enzymatic cleavage, and further purification of the enzyme is required. Purification by intein tag distinguishes itself from all other purification systems by its ability to purify, in a single chromatographic step along with good yield and activity.27,28 Further fermentation trials can enhance yield and will make it an economical process for large-scale production of this valuable biotherapeutic.
REFERENCES 1. Schwanke RC, Renard G, Chies JM, et al. Molecular cloning, expression in Escherichia coli and production of bioactive homogeneous recombinant human granulocyte and macrophage colony stimulating factor. Int J Biol Macromol. 2009;45:97–102. 2. Neumanaitis J. Granulocyte-macrophage-colony-stimulating factor: a review from preclinical development to clinical application. Transfusion. 1993;33:70–83. 3. Seeger RC. Immunology and immunotherapy of neuroblastoma. Semin Cancer Biol. 2011;21:229–237. 4. Thomson CA, Olson M, Jackson LM, et al. A simplified method for the efficient refolding and purification of recombinant human GM-CSF. PLOS One. 2012;7:e49891. 5. Romanos MA, Scorer CA, Clare JJ. Foreign gene expression in yeast: a review. Yeast. 1992;8:423–488. 6. Au LC, Liu TJ, Shen HD, et al. Secretory production of bioactive recombinant human granulocyte–macrophage colony-stimulating factor by a baculovirus expression system. J Biotechnol. 1996;51:107–113. 7. Ryoo ZY, Kim MO, Kim KE, et al. Expression of recombinant human granulocyte macrophage-colony stimulating factor (hGM-CSF) in mouse urine. Transgenic Res. 2001; 10:193–200. 8. Walsh G. Biopharmaceutical benchmarks. Nat Biotechnol. 2006;24:769–776. 9. Lee JH, Kim NS, Kwon TH, et al. Increased production of human granulocyte–macrophage colony stimulating factor (hGM-CSF) by the addition of stabilizing polymer in plant suspension cultures. J Biotechnol. 2002;96:205–211. 10. Vallejo LF, Rinas U. Strategies for the recovery of active proteins through refolding of bacterial inclusion body proteins. Microb Cell Fact. 2004;3:11. 11. Speed MA, Wang DI, King J. Specific aggregation of partially folded polypeptide chains: the molecular basis of inclusion body composition. Nat Biotechnol. 1996;14: 1283–1287. American Journal of Therapeutics (2014) 21(6)
Srinivasa Babu et al 12. Das KM, Banerjee S, Shekhar N, et al. Cloning, soluble expression and purification of high yield recombinant hGMCSF in Escherichia coli. Int J Mol Sci. 2011;12: 2064–2076. 13. Cregg JM, Vedvick TS, Raschke WC. Recent advances in the expression of foreign genes in Pichia pastoris. Biotechnology (N Y). 1993;11:905–910. 14. Cereghino JL, Cregg JM. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev. 2000;24:45–66. 15. Eldin P, Pauza ME, Hieda Y. High-level secretion of two antibody single chain fv fragments by Pichia pastoris. J Immunol Methods. 1997;201:67–75. 16. Higgins DR, Cregg JM. Methods in molecular biology. In: Pichia Protocols. Totowa, NJ: Humana Press; John M. Walker, Ed. 1998:1–16. 17. Shen S, Sulter G, Jeffries TW, et al. A strong nitrogen source-regulated promoter for controlled expression of foreign genes in the yeast Pichia pastoris. Gene. 1998;216: 93–102. 18. Valeria DM, Gunter S, Stephanie B, et al. The solubility and stability of recombinant proteins are increased by their fusion to NusA. Biochem Biophys Res Commun. 2004;322:766–771. 19. Sambrook J. Molecular Cloning: A Laboratory, Manual. 2nd ed. Cold Spring Harbor Laboratory Press; Woodbury, NY. 1989. 20. Kitamura TK, Tance T, Terasawa T. Established and characterization of a unique human cell line that proliferates dependently on GMCSF, IL-3, or erythropoietin. J Cell Physiol. 1989;140:323–334. 21. Wong GG, Witek JS, Temple PA, et al. Human GM-CSF: molecular cloning of the complementary DNA and purification of the natural and recombinant proteins. Science. 1985;228:810–815. 22. Burgess AW, Begley CG, Johnson GR, et al. Purification and properties of bacterially synthesized human granulocyte–macrophage colony stimulating factor. Blood. 1987;69:43–51. 23. Jacobs PP, Inan M, Festjens N, et al. Fed-batch fermentation of GM-CSF-producing glycoengineered Pichia pastoris under controlled specific growth rate. Microb Cell Fact. 2010;9:93. 24. Alexander WS. Cytokines in hematopoiesis. Int Rev Immunol. 1998;16:651–682. 25. Walter MR, Cook WJ, Ealick SE, et al. Three-dimensional structure of recombinant human granulocyte-macrophage colony-stimulating factor. J Mol Biol. 1992;224:1075–1085. 26. Pal Y, Khushoo A, Mukherjee KJ. Process optimization of constitutive human granulocyte-macrophage colonystimulating factor (hGM-CSF) expression in Pichia pastoris fed-batch culture. Appl Microbiol Biotechnol. 2006;69: 650–657. 27. Srinivasa Babu K, Muthukumaran T, Antony A, et al. Construction of intein-mediated hGMCSF expression vector and its purification in Pichia pastoris. Protein Expr Purif. 2008;57:201–205. www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115 28. Srinivasa Babu K, Muthukumaran T, Antony A, et al. Single step intein-mediated purification of hGMCSF expressed in salt-inducible E. coli. Biotechnol Lett. 2009; 31(5):659–664. 29. Kaur J, Reinhardt DP. Immobilized metal affinity chromatography co-purifies TGF-b1 with histidine-tagged recombinant extracellular proteins. PLoS One. 2012;7: e48629. 30. Chong S, Mersha FB, Comb DG, et al, Single-column purification of free recombinant proteins using a selfcleavable affinity tag derived from a protein splicing element. Gene. 1997;192:277–281. 31. Sharma SS, Chong S, Harcum SW. Intein mediated protein purification of fusion proteins expressed under high
www.americantherapeutics.com
469
cell density conditions in E. coli. J Biotechnol. 2006;125: 48–56. 32. Krivenko AA, Kazantsev AV, Adamidi C, et al. Expression, purification, crystallization and preliminary diffraction analysis of RNase P protein from thermotoga maritima. Acta Crystallogr D Biol Crystallogr. 2002;58: 1234–1236. 33. Laloraya M, Davoodi-Semiromi A, Kumar GP, et al. Impaired Crkl expression contributes to the defective DNA binding of Stat5b in nonobese diabetic mice. Diabetes. 2006;55:734–741. 34. Cowgill C, Ozturk AG, John R, et al. Process Scale Bioseparations for the Biopharmaceutical Industry. In: Shukla AA, Etzel MR, Gadam S. Protein Refolding and Scale up. New York, NY: Taylor & Francis; 2007:124–158.
American Journal of Therapeutics (2014) 21(6)
Cloning and Expression of Recombinant Human GMCSF From Pichia pastoris GS115-A Progressive Strategy for Economic Production K. Srinivasa Babu, MTech, PhD,1 Krishna Kanth Pulicherla, MTech, PhD,2* Aju Antony, MS,1 and Sankaranarayanan Meenakshisundaram, MTech, PhD1
Human granulocyte–macrophage colony-stimulating factor (hGMCSF) is a proinflammatory cytokine and hematopoietic growth factor. Recombinant human granulocyte–macrophage colonystimulating factor (rhGMCSF) serves as a biotherapeutic agent in bone marrow stimulations, vaccine development, gene therapy approaches, and stem cell mobilization. The objective of the present study includes construction of rhGMCSF having N-terminal intein tag, expression of protein both extracellularly and intracellularly from yeast expression system followed by its purification in a single step by affinity chromatography. The soluble and biologically active rhGMCSF was obtained from Pichia pastoris GS115. About 122 g DCW/L of final yield was obtained for both cytosolic and secretory expression of Pichia GS115 strain. Purified intracellular hGMCSF was 420 mg/L with a specific activity of 2.1 3 108 IU/mg, and the purified extracellular recombinant protein was 360 mg/L with a specific activity of 1.9 3 108 IU/mg. The data presented here indicate the possibilities of exploring the economic ways of producing the rhGMCSF. Keywords: Pichia pastoris, methylotrophic yeast, hGMCSF, intein tag, chitin affinity chromatography
INTRODUCTION Human granulocyte–macrophage colony-stimulating factor (hGMCSF) is a cytokine secreted in response to inflammatory and immune stimuli by T cells, macrophages, endothelial cells, mast cells, and fibroblasts. This cytokine is crucial for stimulation of proliferation and differentiation of many hematopoietic cells.1 GMCSF is used in treating myeloid leukemia, neutropenia, and aplastic anemia, and it greatly lowers the risk of infection during bone marrow transplantation, by accelerating neutrophil formation.2 Recombinant 1
Centre for Biotechnology, Anna University, Chennai, India; and Centre for Bioseparation Technology, VIT University, Vellore, India. The authors have no conflicts of interest to declare. *Address for correspondence: Centre for Bioseparation Technology, VIT University, Vellore 632014, India. E-mail: kkpulicherla@ gmail.com 2
1075–2765 Ó 2014 Lippincott Williams & Wilkins
human granulocyte–macrophage colony-stimulating factor (rhGMCSF) is used as a biotherapeutic in chemotherapy for immunocompromised patients.3 Owing to its biological and pharmaceutical importance, production of rhGMCSF has been made available from different recombinant expression systems, such as Escherichia coli,4 Saccharomyces cerevisiae,5 baculovirus,6 transgenic animals,7 mammalian cell lines,8 and plant cell system.9 But with overexpression systems like E. coli, it was found that inclusion bodies were formed10,11 where their inaccurate processing or protein misfolding leads to the formation of biologically inactive protein and also final yield of the protein was observed to be compromised. Hence, many optimization studies concerned to expression and refolding are required to attain an active protein.12 Such problems were overcome later by using yeast systems that offered certain advantages such as they help in correct folding of the proteins and also has the ability of glycosylation, which is very crucial for biological activity of the eukaryotic protein. The first eukaryotic www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115
expression system that came into usage is the S. cerevisiae, but the problems of hyperglycosylation, low protein yield, etc, were noticed.5 Methylotrophic yeast Pichia pastoris has been used as an alternative expression host due to the advantages such as huge cell densities in simple defined medium, having strong inducible promoters, and commercially available vectors and hosts for genetic manipulations.13,14 Recombinant protein can be expressed either intracellularly or extracellularly by P. pastoris expression system. Secretion of protein is preferred and referred to as the first step in purification of heterologous protein as it separates the protein from bulk of the cellular proteins15–17 so that the recombinant protein forms a major portion of the total protein in the expression medium. The obtained recombinant protein can be purified by the use of fusion protein and affinity technology. Various conventional purification strategies and also fusion tags have been tried to express and purify the rhGMCSF.18 But the major drawback lies with the removal of protease after separating affinity tag that involves huge cost, quantity compromise, etc. Hence, in the present work, chitin-based intein-mediated protein purification has been used successfully for easy purification of intracellular and extracellular rhGMCSF protein from P. pastoris GS115 in a single step.
MATERIALS AND METHODS Strains and vector Escherichia coli Top 10F9 strain was used as maintenance host. Bacteria were cultured in LB medium having 0.5% yeast extract, 0.5% NaCl, and 1% of tryptone with 100 mg/mL of ampicillin. Pichia pastoris GS115 (his 4) (Invitrogen, San Diego, CA) was used as a host strain for both intracellular and extracellular expression of the rhGMCSF. The media and procedures, used for P. pastoris growth and transformation, were described in Pichia protocols. pTYB11 vector was purchased from New England Bio Labs (Ipswich, MA), and vectors pPICZB and pPCIZaB were obtained from Invitrogen. The parental clone pVM1 (pRSETB: hGMCSF) was kindly provided by Dr. V. Murugan, Centre for Biotechnology, Anna University. Vector construction and transformation studies Construction of pPICZB:hGMCSF vector The hGMCSF gene (408 bp) was amplified from the parental clone pVM1 (pRSETB:hGMCSF) by polymerase chain reaction (PCR) with the following primers: hGMCSF (intein) forward 59-CAGGTTG TTGTACA GAACGCACCCGCCCGCTCGCC C-39 and GMCSF www.americantherapeutics.com
463
reverse 59-TGCTCTAGATCACTCCTGGACTGGCTCC CA-39. The gene sequence coding for the chitin-binding domain (CBD)-intein tag was amplified using the plasmid pTYB11 and the primers: intein forward 59CCGGAATTCATGTGCTTTGCCAAGGGTAC-39 and intein (GMCSF) reverse 59-GGGCGAGCGGGCGGG TGCGTTCTGTACAACAACCTG-39. The hGMCSF forward primer and the CBD-intein reverse primer were designed to contain a short stretch of complementary sequences and so by using the overlap extention PCR of the 2 amplification products, the overlapping ends of the 2 fragments annealed and got extended. The fusion product had EcoRI site at the 59 end and XbaI site at the 39 end. The PCR product was double digested and inserted in the multiple cloning site of pPICZB, resulting in pPICZB/hGMCSF plasmid. Construction of pPICZaB:hGMCSF vector As said above, the fusion was made by overlap extention PCR. It was further digested and inserted into the pPICZaB for extracellular expression of the rhGMCSF. All the recombinant DNA methods were performed essentially as described in Molecular Cloning.19 The hGMCSF expression plasmids pPICZB:hGMCSF and pPCIZaB:hGMCSF were digested with SacI and transformed to P. pastoris GS115 cells (80 mL) by electroporation using an Electroporater 2510 at 1500 V at a time constant of 4.8–5.0 seconds with a 0.2-cm cuvette. After electroporation, 1 mL of ice-cold 1 M sorbitol was immediately added to the cuvette and incubated for 1 hour at 30°C. The cells were selected on YPDS plates (1% yeast extract, 2% peptone, 2% glucose, and 1 M sorbitol) with zeocin (0.1 mg/mL). The genomic DNA was isolated from the transformants, and the integration of the gene was confirmed with insert-specific primers. Selection of multicopy clones Putative clones of GS115 (pPICZB:hGMCSF and pPCIZaB:hGMCSF) harboring multiple copies of the constitutive hGMCSF expression cassette were selected on YPD plates containing 0.5, 1.0, 1.5, and 2.0 mg/mL of zeocin. After 4 days of incubation at 30°C, clones were evaluated for their ability to grow in the presence of increased concentration of the antibiotics. Clones that survived under highest concentrations of antibiotics were cultured to screen their hGMCSF expression level by Western blot using anti-hGMCSF antibodies. Fermentation of recombinant P. pastoris GS115 (pPICZB:hGMCSF and pPCIZaB:hGMCSF) Fermentation was carried out in a 2-L bioreactor (Bioengineering KLF 2000) with 1.2 L of basal salts American Journal of Therapeutics (2014) 21(6)
464
medium: (composition per liter) 26.7 mL of 85% H3PO4, 0.93 g of CaSO4$2H2O, 18.2 g of K2SO4, 14.9 g of MgSO4$7H2O, 4.13 g of KOH, 40.0 g of glycerol, and 4 mL/L PTM1 solution: (composition per liter) 6.0 g of CuSO4$5H2O, 0.08 g of NaI, 3.0 g of MnSO4$H2O, 0.2 g of Na2MoO4$2H2O, 0.02 g of H3BO3, 0.5 g of CaSO4$2H2O, 0.5 g of CoCl2, 20.0 g of ZnCl2, 65.0 g of FeSO4$7H2O, 0.2 g of biotin, and 5 mL of concentrated H2SO4. A 50 mL of BMGY medium, grown for 36 hours, was used as inoculum and the initial batch cultivation was carried until the exhaustion of glycerol. A fed-batch phase using 50% glycerol at the feed rate 15 mL/h was then initiated, and after 4 hours, the feed was switched to 100% methanol (containing 1 mL/L PTM1 solution) at an initial feed rate 2 mL/h. This feed rate was then increased stepwise to maintain residual concentration of 0.5% methanol in the reactor. The pH during entire fermentation was adjusted and controlled at 5.0 with the addition of 28% ammonia solution and the temperature was maintained at 28°C. Samples were withdrawn at regular intervals and analyzed for the biomass, expression, and activity of rhGMCSF. Affinity purification pPICZB:hGMCSF The fermentation broth was harvested by centrifugation and the cell pellet was disrupted by ultrasound after resuspending 10 g of the cell pellet in 50 mL of ice-cold sonication buffer (100 mM Tris buffer containing 1 mM EDTA, 500 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride, pH 8.0). The suspension was centrifuged at 10,000 rpm for 10 minutes and the clear supernatant was loaded onto a 10-mL column of chitin beads (New England Biolabs) that had been equilibrated with 100 mM Tris buffer containing 1 mM EDTA and 500 mM NaCl, pH 8.0. The column was washed with 10 column volumes of equilibration buffer and on-column cleavage induction was carried out using 100 mM Tris buffer containing 30 mM dithiothreitol (DTT), 1 mM EDTA, and 100 mM NaCl (pH 8.0) at 4°C for 40 hours. The rhGMCSF was then eluted with 5 column volumes of equilibration buffer. pPCIZaB:hGMCSF The fermentation broth was harvested and the clarification was done by centrifugation. The clear supernatant was collected and clarified using 0.45 mm filtration to remove the cell debris and small suspended particles. This supernatant was concentrated using 10 kDa ultrafiltration membranes, and the concentrated broth was loaded on to a gel filtration matrix Superdex 75 (GE Healthcare) for the final purification. Different American Journal of Therapeutics (2014) 21(6)
Srinivasa Babu et al
elution fraction of gel filtration was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) to identify the hGMCSF fraction. Analysis of biomass Cell density was measured at 600 nm in a UV-visible spectrophotometer (Hitachi U-2000). Samples having higher optical density were diluted to show absorbance of 0.2–0.6. Dry cell weight (g DCW/L) was determined by taking 5 mL of culture sample in a preweighed centrifuge tube and centrifuged at 10,000 rpm for 5 minutes. The cell pellets were washed and dry cell weight was measured by drying the wet pellet to a constant weight at 80°C. The expression of hGMCSF was analyzed using SDS-PAGE, and Western blot analysis was done with anti-CBD antibody for the fusion product and anti-hGMCSF monoclonal antibody for the purified product. Biological activity assay The biological activity of rhGMCSF was determined by its growth-promoting action on TF1 cell line.20 The TF1 cell lines were maintained in RPMI-1640 medium (Gibco, Grand Island, NY) containing 10% fetal bovine serum (Hyclone). To initiate cellular proliferation, different concentrations (1–25 ng/mL) of rhGMCSF were added to the culture medium. WHO samples of hGMCSF having specific activity of 1.5 3 107 U/mg was used as standard. The assay was set in a 96-well flat bottom culture plates using RPMI-1640 as control. Growth-promoting activity was evaluated by MTT colorimetric assay. MTT solution (10 mL) was added to all wells, and plates were incubated at 37°C for 4 hours. Acid–isopropanol (100 mL of 0.04 N HCl in isopropanol) was added to all wells and mixed thoroughly to dissolve the crystals. The plates were read on a Dynatech MR600 microplate reader. A test wavelength of 570 nm and reference wavelength of 630 nm were used for calculation of units of activity. The experiments were carried out in triplicates, and cells were incubated in 5% CO2 incubator maintained at 37°C.
RESULTS Expression vector construction and transformation studies Construction of pPICZB:hGMCSF vector The individual and specific primer-based PCR for amplification of hGMSCF and CBD-intein genes followed by overlapping extension PCR step were effectively and successfully optimized. The hGMCSF www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115
gene was amplified from parental clone as 408-bp product and the intein gene from pTYB11 as 1.560kb product. Overlap-extension PCR resulted in the fusion of CBD-intein and hGMCSF genes shown in Figure 1, and the recombinant plasmid was generated upon ligation of pPICZB with the inteinCBD–hGMCSF fusion gene and subsequent E. coli Top 10F9 transformation. After PCR confirmation of the recombinant plasmids (Figure 2), electroporation of the plasmid in P. pastoris GS115 had produced more than 25 colonies in lower zeocin concentration of 100–200 mg/mL and 3 colonies in 1.5 mg/mL of zeocin concentration. PCR analysis of the genomic DNA extracted from the Pichia recombinants (1.5 mg/mL of zeocin concentration) confirmed the presence of the fusion hGMCSF gene and was selected for expression studies. Construction of pPCIZaB:hGMCSF vector The fusion gene containing hGMCSF with N-terminal intein tag was successfully cloned into pPCIZaB and were transformed into E. coli Top 10F9. After PCR confirmation of the recombinant plasmids, electroporation of the plasmid in P. pastoris has resulted in the expression clones of GS115 with hGMCSF. High-copynumber transformants were selected that have the ability to tolerate increased zeocin concentrations (1.5 mg/mL). Among them, one of the high-copynumber clones was used for the expression of hGMCSF.
465
FIGURE 2. Amplification of hGMCSF. Lane 1 5 100-bp DNA ladder, lane 2 5 408-bp hGMCSF, lane 3 5 hGMCSF (amplified from pPICZB:hGMCSF as a positive control), and lane 4 5 negative control.
Fermentation of recombinant P. pastoris GS115 The expression of rhGMCSF in P. pastoris GS115 was done by the high-cell density fermentation process involving 3 phases: the glycerol batch phase, fed-batch phase, and the methanol fed-batch phase. The switchover between the phases has been identified by sharp rise in DO concentration due to the exhaustion of carbon source. The initial glycerol batch and the glycerol fed-batch phases produced biomass concentrations of 28 g/L and 52 g/L (DCW), respectively. The methanol fed-batch phase involves the production phase of the fermentation process and the cell density had increased along with the production of recombinant protein. Cells were harvested after 118 hours (when the methanol utilization declined) and the final dry weight of 122 g/L was obtained. The cultivation profile is shown in Figure 3, and the hGMCSF fusion protein expression at different hours is shown in Figures 4 and 5. Affinity purification pPICZB:hGMCSF
FIGURE 1. Fusion of hGMCSF and intein-CBD by overlap extension PCR. Lane 1 5 DNA ladder, lane 2 5 408-bp hGMCSF gene from pRSETB, lane 3 5 1.56-kb intein gene from pTYB11, and lane 4 5 1.935-kb InteinhGMCSF overlapped product. www.americantherapeutics.com
Purification of the intracellular protein was carried out in the chitin affinity column by loading the clarified supernatant after cell disruption and the recombinant protein was eluted by inducing the on column cleavage with DTT. SDS-PAGE analysis of the purified sample (Figure 4) showed single band slightly above 14 kDa, which is consistent with the molecular weight of hGMCSF and was confirmed by Western blot analysis (Figure 6). Single-step purification was achieved with the yield of 420 mg/L for rhGMCSF. pPCIZaB:hGMCSF The supernatant of fermentation broth was centrifuged, collected, and clarified using 0.45 mm filtration American Journal of Therapeutics (2014) 21(6)
466
Srinivasa Babu et al
FIGURE 3. Growth kinetics of Pichia pastoris GS115. 1 5 Start of glycerol fed batch, 2 5 start of methanol fed batch.
to remove the cell debris. This supernatant was concentrated using 10 kDa ultrafiltration membranes and the concentrated broth was loaded on to a gel filtration matrix Superdex 75 for the final purification. The eluted fraction of the gel filtration was analyzed by SDS-PAGE (Figure 5) to identify the pure hGMCSF fraction and was confirmed by Western blot analysis (Figure 6) after deglycosylation with PNGase F (Roche Diagnostics, GmbH, Mannheim, Germany). The yield
of the extracellular purified hGMCSF was found to be 360 mg/L. Biological assay of rhGMCSF The specific biological activity of the purified rhGMCSF from intracellular P. pastoris GS115 was 2.1 3 108 IU/mg and for the extracellular was 1.9 3 108 IU/mg, and these specific activities are comparable with the values reported from the protein derived from others.21,22 Purified rhGMCSF showed no significant loss in its activity when stored for more than 4 weeks at 220°C at pH 7.0.
DISCUSSION
FIGURE 4. SDS-PAGE profile of intracellular hGMCSF expressed from Pichia pastoris GS115. Lane 1 5 molecular weight marker; lane 2 5 uninduced pellet; lanes 3, 4, 5, and 6 5 induced pellet 48, 60, 72, and 96 hours, respectively; lanes 7, 8 5 purified fractions of hGMCSF. American Journal of Therapeutics (2014) 21(6)
Most of the currently marketed biotherapeutics (.50%) are produced in mammalian cell lines even though other platforms, such as bacteria, yeasts, and plant cells, are available8 due to need of cell lines for accurate posttranslational modifications. The property of glycosylation is very significant as glycans that are bound to proteins influence biological activity, halflife, tissue distribution, and sometimes also show immunogenicity.23 GMCSF is a biotherapeutic that belongs to the family of colony-stimulating factors and known to regulate differentiation and proliferation of hematopoietic cells.24 It is used in the treatment of neutropenia, neurological seizures, myeloid leukemia, www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115
467
FIGURE 5. SDS-PAGE profile of extracellular hGMCSF expressed from Pichia pastoris GS115. Lane 1 5 molecular weight marker, lane 2 5 uninduced culture supernatant, lanes 3, 4, 5, and 6 5 culture supernatant after induction at 36, 48, 72, and 96 hours, respectively; lane 7 5 purified hGMCSF (by gel chromatography—Superdex 75).
FIGURE 6. Western blot analysis of purified hGMCSF probed with mouse anti-hGMCSF monoclonal antibody. Lane 1 5 molecular weight marker, lane 2 5 induced pPCIZB vector in Pichia pastoris GS115 (control), lane 3 5 induced pPCIZaB vector P. pastoris GS115 (control), Lane 4 5 purified hGMCSF from pPCIZB; hGMCSF (internal), lane 5 5 purified hGMCSF from pPCIZaB:hGMCSF (external).
and aplastic anemia.1 The hGMCSF is a glycoprotein of 127 amino acids having 2 antiparallel b-sheets and 4 bundles of a-helix.25 Although many trials have been made to produce rhGMCSF using various prokaryotic and eukaryotic expression hosts, E. coli and yeast systems are in focus of current research due to advantage of GMCSF being more active in nonglycosylated form. In the present trial, a comparative study has been conducted between productivity and activity of cytosolic and secretory expression of rhGMSCF having N-terminal fusion of intein–chitin–binding domain expressed in P. pastoris GS115 host system using pPICZ. The standard AOX-based vector was modified to introduce the intein-CBD and the expression cassette was integrated into P. pastoris GS115 host. The screening of multi-copy integrants was carried out with the increasing concentrations of zeocin. The expression of heterologous proteins is generally carried out using 3stage high cell density cultivation in P. pastoris.14 Similar strategy was used here to express this protein, and yield up to 420 mg/L was obtained in the intracellular expression using Pichia GS115 strain. Previously, similar expression studies were carried using P. pastoris SMD1168 in comparison between E. coli BL21 (DE3) and E. coli GJ1158. In the former, the protein was expressed as inclusion bodies with an yield of 7 mg/L with a specific activity of 0.59 3 107 IU/mg. In the case of salt-inducible E. coli GJ1158, hGMCSF was expressed in a soluble form at 20 mg/L with a specific activity of 0.9 3 107 IU/mg. Pal et al26 reported the extracellular protein expression of 250 mg/L where toxicity of the protein was eliminated to a larger extent. Attempts were also made to produce murine
granulocyte–macrophage colony-stimulating factor by using glycoengineered P. pastoris strain. It was found that GMCSF was produced at high levels (hundreds of milligrams per liter)23 where conventional purification system was used. But in our present attempt, we obtained an extracellular protein expression of 360 mg/L. The yield from P. pastoris GS115 was found to be higher compared with E. coli and P. pastoris SMD1168-based expression reported in our previous publications for the same protein.27,28 The amount of GMCSF produced was lower than murine granulocyte–macrophage colony-stimulating factor produced in Pichia, but production of hGMCSF with intein tag has a scope to cut down the production cost and purification of this biotherapeutic agent at larger scale. Normally, histidine ligand affinity chromatography has been reported to be in use for purification of proteins.29 Later, to eliminate the 2-step purification problem and the expensive enzymatic cleavage of fusion proteins, the intein-based systems with chitinbinding domain was developed.30 The use of intein as a fusion technology simplifies the protein purification31, wherein the DTT induces self-cleavage of intein and thereby separates the recombinant protein from the intein tag. Intein-mediated purification has been used for expression and purification of proteins with an in vitro DTT-induced intein cleavage.32,33 The intein tag can be placed either at the N-terminus or C-terminus of the protein. It was reported that DTT concentrations of more than 30 mM leads to destabilization of the disulfide bonds34 and use of DTT could hinder the 2 disulfide bonds that are crucial for hGMCSF activity.1 In our earlier attempt, we used intein-based expression
www.americantherapeutics.com
American Journal of Therapeutics (2014) 21(6)
468
system for expressing hGMCSF in E. coli where 50 mM DTT was used and obtained a reasonable biological activity.27 In the present work, DTT concentration that is required to cleave the intein tag has been gradually decreased and finally optimized to 30 mM. This technology was overcome with other histidine or GST-based fusion protein purification protocols where the problems of nonspecific protein binding, expensive enzymatic cleavage, and further purification of the enzyme is required. Purification by intein tag distinguishes itself from all other purification systems by its ability to purify, in a single chromatographic step along with good yield and activity.27,28 Further fermentation trials can enhance yield and will make it an economical process for large-scale production of this valuable biotherapeutic.
REFERENCES 1. Schwanke RC, Renard G, Chies JM, et al. Molecular cloning, expression in Escherichia coli and production of bioactive homogeneous recombinant human granulocyte and macrophage colony stimulating factor. Int J Biol Macromol. 2009;45:97–102. 2. Neumanaitis J. Granulocyte-macrophage-colony-stimulating factor: a review from preclinical development to clinical application. Transfusion. 1993;33:70–83. 3. Seeger RC. Immunology and immunotherapy of neuroblastoma. Semin Cancer Biol. 2011;21:229–237. 4. Thomson CA, Olson M, Jackson LM, et al. A simplified method for the efficient refolding and purification of recombinant human GM-CSF. PLOS One. 2012;7:e49891. 5. Romanos MA, Scorer CA, Clare JJ. Foreign gene expression in yeast: a review. Yeast. 1992;8:423–488. 6. Au LC, Liu TJ, Shen HD, et al. Secretory production of bioactive recombinant human granulocyte–macrophage colony-stimulating factor by a baculovirus expression system. J Biotechnol. 1996;51:107–113. 7. Ryoo ZY, Kim MO, Kim KE, et al. Expression of recombinant human granulocyte macrophage-colony stimulating factor (hGM-CSF) in mouse urine. Transgenic Res. 2001; 10:193–200. 8. Walsh G. Biopharmaceutical benchmarks. Nat Biotechnol. 2006;24:769–776. 9. Lee JH, Kim NS, Kwon TH, et al. Increased production of human granulocyte–macrophage colony stimulating factor (hGM-CSF) by the addition of stabilizing polymer in plant suspension cultures. J Biotechnol. 2002;96:205–211. 10. Vallejo LF, Rinas U. Strategies for the recovery of active proteins through refolding of bacterial inclusion body proteins. Microb Cell Fact. 2004;3:11. 11. Speed MA, Wang DI, King J. Specific aggregation of partially folded polypeptide chains: the molecular basis of inclusion body composition. Nat Biotechnol. 1996;14: 1283–1287. American Journal of Therapeutics (2014) 21(6)
Srinivasa Babu et al 12. Das KM, Banerjee S, Shekhar N, et al. Cloning, soluble expression and purification of high yield recombinant hGMCSF in Escherichia coli. Int J Mol Sci. 2011;12: 2064–2076. 13. Cregg JM, Vedvick TS, Raschke WC. Recent advances in the expression of foreign genes in Pichia pastoris. Biotechnology (N Y). 1993;11:905–910. 14. Cereghino JL, Cregg JM. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev. 2000;24:45–66. 15. Eldin P, Pauza ME, Hieda Y. High-level secretion of two antibody single chain fv fragments by Pichia pastoris. J Immunol Methods. 1997;201:67–75. 16. Higgins DR, Cregg JM. Methods in molecular biology. In: Pichia Protocols. Totowa, NJ: Humana Press; John M. Walker, Ed. 1998:1–16. 17. Shen S, Sulter G, Jeffries TW, et al. A strong nitrogen source-regulated promoter for controlled expression of foreign genes in the yeast Pichia pastoris. Gene. 1998;216: 93–102. 18. Valeria DM, Gunter S, Stephanie B, et al. The solubility and stability of recombinant proteins are increased by their fusion to NusA. Biochem Biophys Res Commun. 2004;322:766–771. 19. Sambrook J. Molecular Cloning: A Laboratory, Manual. 2nd ed. Cold Spring Harbor Laboratory Press; Woodbury, NY. 1989. 20. Kitamura TK, Tance T, Terasawa T. Established and characterization of a unique human cell line that proliferates dependently on GMCSF, IL-3, or erythropoietin. J Cell Physiol. 1989;140:323–334. 21. Wong GG, Witek JS, Temple PA, et al. Human GM-CSF: molecular cloning of the complementary DNA and purification of the natural and recombinant proteins. Science. 1985;228:810–815. 22. Burgess AW, Begley CG, Johnson GR, et al. Purification and properties of bacterially synthesized human granulocyte–macrophage colony stimulating factor. Blood. 1987;69:43–51. 23. Jacobs PP, Inan M, Festjens N, et al. Fed-batch fermentation of GM-CSF-producing glycoengineered Pichia pastoris under controlled specific growth rate. Microb Cell Fact. 2010;9:93. 24. Alexander WS. Cytokines in hematopoiesis. Int Rev Immunol. 1998;16:651–682. 25. Walter MR, Cook WJ, Ealick SE, et al. Three-dimensional structure of recombinant human granulocyte-macrophage colony-stimulating factor. J Mol Biol. 1992;224:1075–1085. 26. Pal Y, Khushoo A, Mukherjee KJ. Process optimization of constitutive human granulocyte-macrophage colonystimulating factor (hGM-CSF) expression in Pichia pastoris fed-batch culture. Appl Microbiol Biotechnol. 2006;69: 650–657. 27. Srinivasa Babu K, Muthukumaran T, Antony A, et al. Construction of intein-mediated hGMCSF expression vector and its purification in Pichia pastoris. Protein Expr Purif. 2008;57:201–205. www.americantherapeutics.com
Cloning and Expression of rhGMCSF From Pichia pastoris GS115 28. Srinivasa Babu K, Muthukumaran T, Antony A, et al. Single step intein-mediated purification of hGMCSF expressed in salt-inducible E. coli. Biotechnol Lett. 2009; 31(5):659–664. 29. Kaur J, Reinhardt DP. Immobilized metal affinity chromatography co-purifies TGF-b1 with histidine-tagged recombinant extracellular proteins. PLoS One. 2012;7: e48629. 30. Chong S, Mersha FB, Comb DG, et al, Single-column purification of free recombinant proteins using a selfcleavable affinity tag derived from a protein splicing element. Gene. 1997;192:277–281. 31. Sharma SS, Chong S, Harcum SW. Intein mediated protein purification of fusion proteins expressed under high
www.americantherapeutics.com
469
cell density conditions in E. coli. J Biotechnol. 2006;125: 48–56. 32. Krivenko AA, Kazantsev AV, Adamidi C, et al. Expression, purification, crystallization and preliminary diffraction analysis of RNase P protein from thermotoga maritima. Acta Crystallogr D Biol Crystallogr. 2002;58: 1234–1236. 33. Laloraya M, Davoodi-Semiromi A, Kumar GP, et al. Impaired Crkl expression contributes to the defective DNA binding of Stat5b in nonobese diabetic mice. Diabetes. 2006;55:734–741. 34. Cowgill C, Ozturk AG, John R, et al. Process Scale Bioseparations for the Biopharmaceutical Industry. In: Shukla AA, Etzel MR, Gadam S. Protein Refolding and Scale up. New York, NY: Taylor & Francis; 2007:124–158.
American Journal of Therapeutics (2014) 21(6)
