ISSN 16076729, Doklady Biochemistry and Biophysics, 2013, Vol. 452, pp. 241–244. © Pleiades Publishing, Ltd., 2013. Original Russian Text © E.V. Il’nitskaya, V.V. Radchenko, A.S. Rodionova, A.M. Kosyreva, T.M. Shuvaeva, V.M. Lipkin, 2013, published in Doklady Akademii Nauk, 2013, Vol. 452, No. 2, pp. 217–220.
BIOCHEMISTRY, BIOPHYSICS AND MOLECULAR BIOLOGY
Cloning and Sequence Analysis of cDNA Encoding a New Short Form of Rat Acid Chitinase E. V. Il’nitskayaa, V. V. Radchenkoa, A. S. Rodionovaa, A .M. Kosyrevab, T. M. Shuvaevaa, and Corresponding Member of the RAS V. M. Lipkina Received April 18, 2013
DOI: 10.1134/S1607672913050050
It is known that the secretion of acid chitinase (AMCase, ChiA) in mammals sharply increases under pathophysiological conditions. This enzyme is representative of the family of chitinase proteins, the accumulation of which is a negative prognostic marker of many inflammatory diseases of different etiology [1]. However, the contribution of AMSase to the physiology of these pathologies is not yet understood completely. This is the first article to describe the detection of an increased synthesis of two forms of AMCase (long, 1564 bp in length, and truncated (short, sAMSase), 1362 bp in length) in an animal model with inflamma tion induced by a low dose of lipopolysaccharide (LPS). The long form was identified earlier in rodents and humans under conditions of allergic inflamma tion [2] (GenBank NM_207586). To determine the primary structure of the previously unknown short form of AMCase, it was necessary to determine the fulllength sequence of its cDNA. Here, the full length cDNA sequence of rat sAMSase (GenBank KC529649) is presented the first time. A stable total RNA fraction was isolated from the respiratory lining of model animals with acute endot oxemia (induced by intraperitoneally injected LPS at a dose of 1.5 mg/kg [3]) using the RNeasy Minikit (Qiagen, United States). The total doublestranded cDNA (dscDNA), which was synthesized using the MINTUniversal kit (Evrogen, Russia), served as a template for the synthesis of the fulllength sAMSase cDNA. On the basis of the cDNA nucleotide sequence of the long form of rat AMSase, which was taken from
the GenBank database (accession NM_207586), primers 1 and 2 (Table 1), restricting its coding region, were synthesized. With this primer pair, two product 1220 and 1422 bp long, corresponding to the cDNA of the short and long AMCase forms, were amplified (Fig. 1, lane 2). They were excised from the gel, eluted, and cloned into the pGEMT vector. The analysis of these clones for the presence of the insertion was per formed by PCR using the standard primers comple
a Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry,
Russian Academy of Sciences, ul. MiklukhoMaklaya 16/10, Moscow, 117997 Russia b Institute of Human Morphology, Russian Academy of Sciences, ul. Tsyurupy 3, Moscow, 117418 Russia 241
1
2
3
4
5
Fig. 1. Identification of the short form of AMCase (sAMCase). Electrophoregram of amplification products of cDNA fragments (25 cycles, 1% agarose gel) containing (1, 2) the coding regions (obtained using primers 1 and 2, see the table) and (4, 5) the untranslated regions (obtained using the inverted primers 3 and 4, see the table). The total cDNA from the respiratory linings of the control (lanes 1, 4) and model (lanes 2, 5) animals was used as a template. 3— Molecularweight marker SM # 1113 (Fermentas, Lithua nia).
242
IL’NITSKAYA et al.
Specific primers used in the study No.
Primer no.
Nucleotide sequence
1
AMC_forv
5'AAGCTCATTCTTGTCACAGGTC3'
2
AMC_rev
5'TTAGTTTCATGGCCAGTTGC3'
3
3' UTRAMC_forv
5'TTCTGGCACTGCATCAATGG3'
4
5' UTRAMC_rev
5'CAGGAGAGTTTTCAGTTTGC3'
mentary to pGEMT vector sequence. The insertions of the selected clones were sequenced using a 470A automatic gasphase sequencer (Applied Biosystems 470A, United States). On the basis of the obtained data, the nucleotide sequence of the cDNA fragments encoding the short form of rat AMSase (sAMSase) and the long form, which was identified earlier (Gen Bank accession NM_207586), were determined. The sequences of the 5' and 3'untranslated regions (UTR) of sAMCase were determined by inverted PCR [4]. For this purpose, the total dscDNA from rat respiratory lining was closed in a ring with T4 DNA ligase and used as template for PCR performed with specific primers 3 and 4 (table), which were com plementary to the terminal regions of the coding part of cDNA. The amplification products 577 and 375 bp long, containing the untranslated regions and the cod ing sequence regions of the long and short forms of AMCase, respectively (Fig. 1, lane 5), were cloned into the pGEMT vector, after which the structure of the short form was determined (Fig. 2). As a result of
1
3
2
4
analysis of the 577bp fragment sequence and the sAMCase coding region, the nucleotide sequence of the mature mRNA of the short form of AMSase was determined (Fig. 3). The obtained data were con firmed by rapid amplification of cDNA ends (RACE) using the Mint RACE primer set (Evrogen, Russia) according to manufacturer’s recommendations. It was found that the fulllength sAMCase cDNA sequence comprised 1362 bp. Rat sAMCase contains 365 amino acid residues. The determined sequence was deposited into the GenBank international data base (accession KC529649). The comparison of the structures of the long and short forms of AMCase showed that the latter (sAMCase) is formed as a result of alternative splicing of the ChiA gene (Fig. 4). Thus, this is the first study to determine the full length cDNA sequence of sAMCase, which is expressed in the rat respiratory lining in experimental endotoxemia.
5
Fig. 2. Nucleotide sequence of the sAMCase cDNA amplification product on a circular template comprising the 5' and 3' untranslated regions. Designations: 1—polylinker sequence of the pGEMT vector; 2—sequences of the primers 3'UTR AMC_forv and 5'UTRAMC_rev; 3—the region of the known sequence encoding the Cterminal fragment of the mature rat AMCase (large font indicates the stop codon TGA); 4—sequences of primers CDS1 adapter and PlugOligo1 adapter (Evro gen, Russian), which were used for the synthesis of total dscDNA; 5—5' and 3'untranslated sequences of the fulllength sAMCase cDNA. The boundaries of the 375bp fragment cloned into the pGEMT vector (\ … \) and the site of ligation of ds cDNA ends in the reaction of inverted ligation (../..) are shown. DOKLADY BIOCHEMISTRY AND BIOPHYSICS
Vol. 452
2013
CLONING AND SEQUENCE ANALYSIS OF cDNA ENCODING
243
Fig. 3.Fulllength cDNA sequence and the deduced amino acid sequence of the sAMCase protein. The 5'untranslated region (highlighted in gray), the start codon ATG (shown in bold italic), the coding region, the stop codon TGA (shown is bold italic), the 3'untranslated region (highlighted in gray), the polyadenylation site (underlined by the dotted line), and the Kozak sequence (in frame) are shown.
Fig. 4. Schematic representation of (I) long and (II) short forms of AMCase cDNA. The nucleotide sequence of the short form differs from that of the long form by the absence of the fragment comprising base pairs 73–274. Gray background shows the 5' and 3'untranslated regions. The consensus regions that ensure the splicing of the mRNA of the short form of rat AMCase are underlined. DOKLADY BIOCHEMISTRY AND BIOPHYSICS
Vol. 452
2013
244
IL’NITSKAYA et al.
ACKNOWLEDGMENTS This work was supported by the Program of the Presidium of the Russian Academy of Sciences “Molecular and Cellular Biology” (V.M. Lipkin), and the Russian Foundation for Basic Research (project nos. 110400761 and 120431102).
2. Boot, R.G., Blommaart, E.F., Swart, E., Ghauharali van der Vlugt, K., Bijl, N., Moe, C., Place, A., and Aerts, J.M., J. Biol. Chem., 2001, vol. 276, no. 9, pp. 6770–6778.
REFERENCES
4. Ilnitskaya, E.V., Radchenko, V.V., Kosyreva, A.M., Shuvaeva, T.M., and Lipkin, V.M., Dokl. Biochem. Bio phys., 2011, vol. 439, no. 6, pp. 199–201.
1. Huang, Q.S., Xie, X.L., Liang, G., Gong, F., Wang, Y., Wei, X.Q., Wang, Q., Ji, Z.L., and Chen, Q.X., Glyco biology, 2012, vol. 22, pp. 23–34.
3. Kosyreva, A.M., Simonova, E.Yu., and Makarova, O.V., Byull. Eksp. Biol. Med., 2012, vol. 153, no. 3, pp. 318– 320.
Translated by M. Batrukova
DOKLADY BIOCHEMISTRY AND BIOPHYSICS
Vol. 452
2013
BIOCHEMISTRY, BIOPHYSICS AND MOLECULAR BIOLOGY
Cloning and Sequence Analysis of cDNA Encoding a New Short Form of Rat Acid Chitinase E. V. Il’nitskayaa, V. V. Radchenkoa, A. S. Rodionovaa, A .M. Kosyrevab, T. M. Shuvaevaa, and Corresponding Member of the RAS V. M. Lipkina Received April 18, 2013
DOI: 10.1134/S1607672913050050
It is known that the secretion of acid chitinase (AMCase, ChiA) in mammals sharply increases under pathophysiological conditions. This enzyme is representative of the family of chitinase proteins, the accumulation of which is a negative prognostic marker of many inflammatory diseases of different etiology [1]. However, the contribution of AMSase to the physiology of these pathologies is not yet understood completely. This is the first article to describe the detection of an increased synthesis of two forms of AMCase (long, 1564 bp in length, and truncated (short, sAMSase), 1362 bp in length) in an animal model with inflamma tion induced by a low dose of lipopolysaccharide (LPS). The long form was identified earlier in rodents and humans under conditions of allergic inflamma tion [2] (GenBank NM_207586). To determine the primary structure of the previously unknown short form of AMCase, it was necessary to determine the fulllength sequence of its cDNA. Here, the full length cDNA sequence of rat sAMSase (GenBank KC529649) is presented the first time. A stable total RNA fraction was isolated from the respiratory lining of model animals with acute endot oxemia (induced by intraperitoneally injected LPS at a dose of 1.5 mg/kg [3]) using the RNeasy Minikit (Qiagen, United States). The total doublestranded cDNA (dscDNA), which was synthesized using the MINTUniversal kit (Evrogen, Russia), served as a template for the synthesis of the fulllength sAMSase cDNA. On the basis of the cDNA nucleotide sequence of the long form of rat AMSase, which was taken from
the GenBank database (accession NM_207586), primers 1 and 2 (Table 1), restricting its coding region, were synthesized. With this primer pair, two product 1220 and 1422 bp long, corresponding to the cDNA of the short and long AMCase forms, were amplified (Fig. 1, lane 2). They were excised from the gel, eluted, and cloned into the pGEMT vector. The analysis of these clones for the presence of the insertion was per formed by PCR using the standard primers comple
a Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry,
Russian Academy of Sciences, ul. MiklukhoMaklaya 16/10, Moscow, 117997 Russia b Institute of Human Morphology, Russian Academy of Sciences, ul. Tsyurupy 3, Moscow, 117418 Russia 241
1
2
3
4
5
Fig. 1. Identification of the short form of AMCase (sAMCase). Electrophoregram of amplification products of cDNA fragments (25 cycles, 1% agarose gel) containing (1, 2) the coding regions (obtained using primers 1 and 2, see the table) and (4, 5) the untranslated regions (obtained using the inverted primers 3 and 4, see the table). The total cDNA from the respiratory linings of the control (lanes 1, 4) and model (lanes 2, 5) animals was used as a template. 3— Molecularweight marker SM # 1113 (Fermentas, Lithua nia).
242
IL’NITSKAYA et al.
Specific primers used in the study No.
Primer no.
Nucleotide sequence
1
AMC_forv
5'AAGCTCATTCTTGTCACAGGTC3'
2
AMC_rev
5'TTAGTTTCATGGCCAGTTGC3'
3
3' UTRAMC_forv
5'TTCTGGCACTGCATCAATGG3'
4
5' UTRAMC_rev
5'CAGGAGAGTTTTCAGTTTGC3'
mentary to pGEMT vector sequence. The insertions of the selected clones were sequenced using a 470A automatic gasphase sequencer (Applied Biosystems 470A, United States). On the basis of the obtained data, the nucleotide sequence of the cDNA fragments encoding the short form of rat AMSase (sAMSase) and the long form, which was identified earlier (Gen Bank accession NM_207586), were determined. The sequences of the 5' and 3'untranslated regions (UTR) of sAMCase were determined by inverted PCR [4]. For this purpose, the total dscDNA from rat respiratory lining was closed in a ring with T4 DNA ligase and used as template for PCR performed with specific primers 3 and 4 (table), which were com plementary to the terminal regions of the coding part of cDNA. The amplification products 577 and 375 bp long, containing the untranslated regions and the cod ing sequence regions of the long and short forms of AMCase, respectively (Fig. 1, lane 5), were cloned into the pGEMT vector, after which the structure of the short form was determined (Fig. 2). As a result of
1
3
2
4
analysis of the 577bp fragment sequence and the sAMCase coding region, the nucleotide sequence of the mature mRNA of the short form of AMSase was determined (Fig. 3). The obtained data were con firmed by rapid amplification of cDNA ends (RACE) using the Mint RACE primer set (Evrogen, Russia) according to manufacturer’s recommendations. It was found that the fulllength sAMCase cDNA sequence comprised 1362 bp. Rat sAMCase contains 365 amino acid residues. The determined sequence was deposited into the GenBank international data base (accession KC529649). The comparison of the structures of the long and short forms of AMCase showed that the latter (sAMCase) is formed as a result of alternative splicing of the ChiA gene (Fig. 4). Thus, this is the first study to determine the full length cDNA sequence of sAMCase, which is expressed in the rat respiratory lining in experimental endotoxemia.
5
Fig. 2. Nucleotide sequence of the sAMCase cDNA amplification product on a circular template comprising the 5' and 3' untranslated regions. Designations: 1—polylinker sequence of the pGEMT vector; 2—sequences of the primers 3'UTR AMC_forv and 5'UTRAMC_rev; 3—the region of the known sequence encoding the Cterminal fragment of the mature rat AMCase (large font indicates the stop codon TGA); 4—sequences of primers CDS1 adapter and PlugOligo1 adapter (Evro gen, Russian), which were used for the synthesis of total dscDNA; 5—5' and 3'untranslated sequences of the fulllength sAMCase cDNA. The boundaries of the 375bp fragment cloned into the pGEMT vector (\ … \) and the site of ligation of ds cDNA ends in the reaction of inverted ligation (../..) are shown. DOKLADY BIOCHEMISTRY AND BIOPHYSICS
Vol. 452
2013
CLONING AND SEQUENCE ANALYSIS OF cDNA ENCODING
243
Fig. 3.Fulllength cDNA sequence and the deduced amino acid sequence of the sAMCase protein. The 5'untranslated region (highlighted in gray), the start codon ATG (shown in bold italic), the coding region, the stop codon TGA (shown is bold italic), the 3'untranslated region (highlighted in gray), the polyadenylation site (underlined by the dotted line), and the Kozak sequence (in frame) are shown.
Fig. 4. Schematic representation of (I) long and (II) short forms of AMCase cDNA. The nucleotide sequence of the short form differs from that of the long form by the absence of the fragment comprising base pairs 73–274. Gray background shows the 5' and 3'untranslated regions. The consensus regions that ensure the splicing of the mRNA of the short form of rat AMCase are underlined. DOKLADY BIOCHEMISTRY AND BIOPHYSICS
Vol. 452
2013
244
IL’NITSKAYA et al.
ACKNOWLEDGMENTS This work was supported by the Program of the Presidium of the Russian Academy of Sciences “Molecular and Cellular Biology” (V.M. Lipkin), and the Russian Foundation for Basic Research (project nos. 110400761 and 120431102).
2. Boot, R.G., Blommaart, E.F., Swart, E., Ghauharali van der Vlugt, K., Bijl, N., Moe, C., Place, A., and Aerts, J.M., J. Biol. Chem., 2001, vol. 276, no. 9, pp. 6770–6778.
REFERENCES
4. Ilnitskaya, E.V., Radchenko, V.V., Kosyreva, A.M., Shuvaeva, T.M., and Lipkin, V.M., Dokl. Biochem. Bio phys., 2011, vol. 439, no. 6, pp. 199–201.
1. Huang, Q.S., Xie, X.L., Liang, G., Gong, F., Wang, Y., Wei, X.Q., Wang, Q., Ji, Z.L., and Chen, Q.X., Glyco biology, 2012, vol. 22, pp. 23–34.
3. Kosyreva, A.M., Simonova, E.Yu., and Makarova, O.V., Byull. Eksp. Biol. Med., 2012, vol. 153, no. 3, pp. 318– 320.
Translated by M. Batrukova
DOKLADY BIOCHEMISTRY AND BIOPHYSICS
Vol. 452
2013
