Molecular and Cellular Endocrinology, 71 (1990) 253-259 Elsevier Scientific Publishers Ireland, Ltd.

MOLCEL

253

02312

Cloning and sequence analysis of the cDNA for the pituitary glycoprotein hormone a-subunit of the European eel B. Q&at

‘, M. Jutisz 2, Y.A. Fontaine

’

and R. Counis

2

’ Lnboratoire de Physiologic GhnPrale et Cornparke du MNHN et d’Endocrinologie Compare% a.wociP au CNRS, URA 90, 75231 Paris Cedex 05, France, and ’ Laboratoire des Hormones Polypeptidiques,

CNRS, 91190 Gif sur Yvette, France

(Received 12 March 1990; accepted 18 April 1990)

Key worak: Alpha-glycoprotein pituitary)

hormone;

Pituitary glycoprotein;

mRNA;

cDNA;

Molecular cloning;

Fish reproduction;

(Eel

Summary A cDNA library constructed using mRNAs isolated from pituitary glands of estradiol-treated eels was screened with a cDNA fragment for the rat glycoprotein hormone cr-subunit. Three out of 10,000 cDNA clones were revealed and subcloned in pUC13 for characterization and sequencing. All three had the same nucleotide sequence except for a single, silent change in the coding sequence for one of them, and for the location of the poly(A) tail. Analysis of the deduced amino acid sequence strongly suggests that these cDNA clones encode the precursor for the eel common glycoprotein hormone cY-subunit. This precursor would therefore consist of a 93 amino acid apoprotein preceded by a 24 amino acid long signal peptide. Alignment with glycoprotein hormone ol-subunits from fish and mammals reveals high homology, ranging from 60 to 90%. Particularly, the ten cysteines and the two putative N-linked glycosylation sites were at the same position. Comparison between fish and mammals shows also that two regions are highly conserved, comprising about half of the protein length. This high conservation rate through evolution argues for the importance of these regions in the conservation of biological properties of the a-subunits. In contrast, other regions are highly variable and could be responsible for the immunological specificity. Northern blot analysis of pituitary RNA from control and estradiol-treated eels showed that estradiol treatment strongly increases the pituitary content of mRNA encoding the glycoprotein hormone a-subunit.

Introduction In tetrapods, the glycoprotein hormone family consists of pituitary luteinizing hormone (LH), follicle-stimulating hormone (FSH), thyroidstimulating hormone (TSH), and in certain

Address for correspondence: Bnmo Q&at, Laboratoire de Physiologie GCnQale et Cornparke du MNHN, 7 rue Cuvier, 75231 Paris Cedex 05, France. 0303-7207/90/$03.50

mammals, of chorionic gonadotropin (CG). In teleosts, in addition to a TSH, a unique gonadotropin (GTH) has long been thought to be present but two types (GTH-I and GTH-II) were recently isolated and characterized from Chum salmon pituitary gland (Suzuki et al., 1988). These GTHs also consist of two distinct subunits, (Y and /I, but unlike their mammalian counterparts, two types of a-subunits are present in salmon (Suzuki et al., 1988; Kitahara et al., 1989) and also in carp (Chang et al., 1989). However, the question of

0 1990 Elsevier Scientific Publishers Ireland, Ltd.

254

duality of gonadotropin is still not resolved for all teleost species and only one gonadotropin, which is a GTH-II type (Q&rat et al., in press), was so far demonstrated and studied in the European eel. In eel at the silver stage, a deficiency in pituitary gonadotropic function is responsible for a lack of gonadal development (Fontaine et al., 1976). The synthesis of GTH-II can be stimulated in female silver eel by administration of 17fiestradiol (Olivereau and Olivereau, 1979; Dufour et al., 1983). We have demonstrated that the cellfree mRNA directed synthesis of the precursor for the a-subunit was 8 times higher in estradioltreated eels than in controls (Counis et al., 1987). Moreover, preliminary experiments indicated that estradiol treatment strongly increases mRNA encoding the P-subunit in the eel, as shown by Northern blot analysis of pituitary RNA using an eel cDNA probe (Q&rat et al., in press). In order to study further the molecular mechanism of this positive action of steroids on GTH-II synthesis in the European eel, we have cloned the cDNA encoding a putative common cY-subunit of eel pituitary glycoprotein hormones. The data presented in this paper strongly suggest that this subunit is encoded by a single gene. It also shows by specific hybridization that the mRNA encoding the a-subunit is strongly increased by the estradiol treatment.

method described by Benton and Davis (1977). The probe was a AluI/AluI restriction fragment of the rat (Y cDNA (Counis and Schmitt-Ney, unpublished; Godine et al., 1982) consisting of nucleotides (nt) 141-359 of the coding sequence, thus corresponding to the peptide region from amino acid (aa) 25 to the carboxyl terminus. The cDNA probe was electrophoretically purified on agarose gel after digestion and labelled by random priming to 5 X 10’ cpm/pg specific activity using the Multiprime DNA Labelling System (Amersham) and ( cu-32P)dCTP (400 Ci/mmol, Amersham). Filters were prehybridized for 5 h, and hybridized overnight in 4 X standard saline solution (SSC: 0.15 M, NaCl, 0.015 M sodium citrate), 5 x Denhardt’s solution (0.1% (w/v) each of Ficoll, polyvinylpyrrolidone and bovine serum albumin), 0.1% (w/v) sodium lauryl sarkosinate, 0.05% (w/v) sodium pyrophosphate and 1 mM EDTA in 50% deionized formamide, at 42” C. Filters were washed for 15 min in 1 X SSC, 0.1% sodium lauryl sarkosinate at room temperature and for a further 30 min in the same conditions; then more stringent washes were performed for 30 min in 0.1 x SSC, 0.1% sodium lauryl sarkosinate at room temperature, and a further 30 min at 50°C. Autoradiography was carried out at - 80” C using Kodak X-OMAT films in DuPont cassettes fitted with intensifying screens.

Materials and methods Preparation of the cDNA library Isolation of mRNA and construction of the eel (Anguilla anguilla) pituitary cDNA library were previously described (Q&rat et al., in press). Briefly, total cytoplasmic RNA was extracted from pituitary glands from estradiol-treated silver eels. Double-stranded cDNA was obtained from poly(A)+ RNA using the cDNA Synthesis System ‘ +’ (Amersham) and inserted in XGTlO phage (Huynh et al., 1985) after addition of EcoRI linkers. Concatemeric phage DNA was packaged using the in vitro Packaging System (Promega). Finally, recombinant phages were plated on C600 hfl selective strains (Promega). The unamplified library was kept at 4 o C. Plaque screening Plaque screening

was achieved

according

to the

DNA sequence determination Recombinant phages were purified by the ‘plate lysate’ method followed by polyethylene glycol precipitation (Maniatis et al., 1982) and were restricted by EcoRI. Size determination of the inserts was determined by 1.5% (w/v) agarose gel (Pharmacia) electrophoresis using HaeIII-digested +X174 DNA as a size standard. Afterwards, they were subcloned intact or following digestion with PstI restriction enzyme (Promega) into the polylinker region of pUC13 (Yanisch-Perron et al., 1985) (Pharmacia) using DH5 (Y cells (BRL) according to the manufacturer’s recommendations. DNA sequence determinations were carried out by the dideoxy chain-termination method (Sanger et al., 1977) on both strands using the Sequenase Sequencing System (USB) after alkali denaturation. Ml3 universal and reverse primers

255

(Pharmacia) and oligonucleotides (ODN) complementary to internal sequences were used as external and internal primers for sequencing. ODN were synthesized using a Pharmacia gene assemusing the bler. Sequence analysis was performed Bizance programs of the CIT12 (Centre InterUniBiomediversitaire d’Informatique a Orientation tale, Paris, France).

VP1 Poly-T

-24 -20 ATG ATG GTG TGT CCA GGA AAG CCA GGA GCC Met Met Val Cys Pro Gly Lys Pro Gly Ala -1 1 -10 CTG TCG ATG CTG TTT CRC ATC ATA GAT TCT TAT Leu Ser Met Leu Phe His Ile Ile Asp Serm 10 ATG GCA CGA GGT GGC TGC GAT GAP, TGC CGA CTC Met Ala Arg Gly Gly Cys Asp Glu Cys Arg Leu p3 30 A+f TTC TCC AAG CCC AGC GCT CCA ATC TTC CAG Ile Phe Ser Lys Pro Ser Ala Pro Ile Phe Gin 40 TGT TTC TCC AGG GCG TAC CCA ACA CCA CTG CGG Cys Phe Ser Arg Ala Tyr Pro Thr Pro Leu Arg 60 (~4) ATG CTG GTG CCA AAG AAC ATC ACA TCT GAG GCA Met Leu Val Pro Lys Asn Ile Thr Ser Glu Ala 70 GCC AGG GAG GTG ACA AGG CTG GAT AAC ATG AAA Ala Arg Glu Val Thr Arg Leu Asp Asn Met Lys 90 ACA GAC TGC CAC TGC F&C ACC TGC TAC TAC CAC Thr Asp Cys His Cys Ser Thr Cys Tyr Tyr His

cggc

CTC ATG Leu Met AAC GAA Asn Glu 20 AAT AAG Asn Lys GGG TGC Gly Cys A AAG ACC Lys Thr TGC GTG Cys Val 80 AAC CAC Asn His

Northern and Southern blot experiments Two groups of 50 animals were used for Northem blot experiments. One of them received nine i.p. injections over 3 weeks of 0.5 mg of estradiol17/3 in suspension in 0.15 M NaCl (Counis et al., 1987). Pituitaries were collected and pooled 2 days after the last injection. RNA from both groups were prepared in parallel using guanidium thio-

TCT CTC Ser Leu

40

CCC AAC Pro Asn P4 C% GAG Gln Glu

85

130

TGC GTT Cys Val

175

TCC AAG Ser Lys

220

ACG TGC Thr Cys

265

CTG GAG Leu Glu 93 AAA TTT Lys Phe

310

355

415 475 535 ttatttccaatatttatcaatttttgtgctgtcaacaag~tgtagctgtata~gcattcg poly-A fp3) poly-A (P4) ttcaaatat&cttacattgttggt&gApoly-A (~1)

595 624

Fig. 1. Nucleotide sequence and deduced amino acid (aa) sequence of three cDNA clones (pl, p3 and p4) encoding the putative precursor of the glycoprotein hormone a-subunit of the European eel. Numbering in the right margin refers to the nucleotide sequence. Negative numbers indicate aa which comprise the presumed signal peptide sequence. The first aa of the putative precursor protein (boxed tyrosine) is numbered +l. Insert endings of each clone is indicated by a dark arrowhead. The open arrowhead indicates the PstI restriction site. The sequences corresponding to the oligonucleotides used for sequence determination are underlined. The nucleotide substitution of the p4 clone at position 226 is indicated.

256

cyanate and centrifugation through a cesium chloride cushion as previously described (Counis et al., 1987). Aliquots (20 pg) of total cytoplasmic RNA were denatured in glyoxal and electrophoresed through a 1.5% (w/v) agarose gel in phosphate buffer (Maniatis et al., 1982). Cold HaeIII digested $X174 and HinfI digested pBR322 DNA (BRL) in addition to Hind111 digested DNA labelled with (Y-~*P) ATP using T4 DNA polynucleotide kinase (Promega) were used as size markers. Eel genomic DNA was prepared from erythrocytes using the method described by Andersen et al. (1988). Aliquots (10 pg) were digested with restriction endonucleases (Pharmacia, Promega) and run on 0.7% (w/v) agarose gels in Tris-borate buffer (Maniatis et al., 1982) using 5’ end labelled Hind111 digested XDNA as a size marker. Transfer was carried out on nylon membranes (Amersham) according to the manufacturer’s recommendations. Hybridization, washing and autoradiography were performed as for plaque screening experiments using p3 insert (cf. Results) labelled by random priming as a cDNA probe. Signals on the autoradiogram of Northern blot experiment were quantified by densitometry scanning.

clones. They were purified and the size of their insert was determined as 600&800 bp (data not shown). All three inserts were subcloned intact or following PstI digestion into the polylinker region of pUC13 prior to sequencing. The nucleotide and deduced aa sequences of the clone inserts are shown in Fig. 1. Analysis of the longest one, pl, revealed an open reading frame of 351 bp preceded by 4 bp. An approximately 50 bp poly(T) tract was found upstream of this sequence. The 3’ untranslated region was 268 bp long and was ended by a poly(A) tail of about 50 bp. No polyadenylation consensus signal AATAAA was seen. The two other clone inserts, p4 and p3 had a 5’ end corresponding to nt 127 and 139 respectively. Their poly(A) tail was located at 2 and 18 bp respectively in front of that of the pl clone. Nucleotide sequence was identical for all three clones except for a silent change (C to A) at position 226 in the p4 clone. Primary structure deduced from the open reading frame of the clone inserts comprised a 117 aa protein (Fig. 1). Position of the putative cleavage site of the signal peptide was deduced from comparison with fish glycoprotein hormone a-subunits. Alignment with the a-subunits of fish species and mammals showed high homology with wellconserved positions of ten cysteines as well as the two putative N-linked glycosylation sites (Fig. 2). Two regions are particularly conserved: a large one, between aa 34 and 67, consisting of the two pairs of contiguous cysteines and the first putative N-linked glycosylation site, and a smaller one at

Results Sequence determination and analysis Ten thousand clones were screened with the rat cDNA probe, which gave rise to three positive Z ANALOGY Ang

20

3ov

"

60

50

40

70

80

90

1OV . v YPh.NEMARGGCoECRLoENKIFSKPSAPIF~C”GCCFSRAYPTPLRSKKTNLYPKNITSEA L DNHKLE~HTDFHFST~~YYHKT 93

92

K"ra

-___-~~__--_____KD__F_--_--____________________---------~-_______-___-_~

_

77

CYPl -_~-~_~~~__~_-K_~__~_----G-_YY__M---__~_______--____--_-----_--_-_------~--~-"_"~_" --~---_______-___: Cyp2

__~_Y_~~~__~__T_~__~_-_--~__~~__~____________---------_______-___-~-~~~~_~~_~

One,

~~~~~_~~"~~~__~_~~__~~_~_~__~~__~~~~_~_______Q_~~~~_____~~~_~_~_~~~~~~~~

0nc2

__-::K::"-_:__:-:P-T__P:

67.5

Rat Hur

~_~~:~~~~_-~_-~-~_--Y--_LG_--Y-_M__--_--~----_-___--*______________---___-:~~_~~~",,~-~~~---_______-__-_~ :-:: ~~~~:--~__~-~-__~___~~-__~-_:__________--~___-_--__-_-_________~A~_~~~~~~_~~~____E__________~

69

Par

70

75 67.5 64.5 69

63.5 64.5

-____--_-__---------s

93

__:______________:

:"-_~--~---~-"_~---"--:

95 95 95

-~--~--____---_____-Q------_-_--_-_----~-~~-~TTK_~~P"~---~__________~

92 Yb y6

~-~~-~~~~-_~--~_~---~---~~-__~__~_____---___~__------_--_-_-------~~~_~~~~~~_~~~____~_____-__-_~

9b

BO"

:-_::-_:::

96

Equ ""0l

A-

:_::_::~:~-:__:-~--_:-~-~~Y-_:__K--_-_------_-__-~_-~-___-_-__--_~-_---::~~-"~~~~-~------~_Y__--_~-_I

and analogy

of the amino acid (aa) sequence

of the putative

92

glycoprotein

hormone

a-subunit

of the eel Anguilln

with those of the pike eel Muraenessox

Chang

et al., 1988),

1989).

the rat (Godine

the equine (Stewart eel sequence.

96

y,:_:__~-___~~_-~-:__-L-_M----_----__-__---__-_____~--“-_-:-____:~~~-~::::~~-“_--_A-_---_----~

:

Fig. 2. Alignment

anguillu (An@,

~_-~-_~-~___~--__D___~__~___________~_-_---__-____________~~~_~~~~~~_V~~___-~_________-~

the salmon

Oncorhynchur

et al., 1982),

cinereus (Mura; Liu et al., 1989), the carp Cy~nnus cnrpro (Cypl and Cyp2; kera (Oncl; Kitahara et al.. 1989, and Onc2; Kitahara et al., 1989 and Sekine et al.,

the murine (Chin et al., 1981),

et al., 1987) and the human (Fiddes

Dots indicate

residues are indicated

aa different

the porcine

et al., 1979).

(Hirai et al., 1989),

Dashes indicate

from those of eel but which are identical

by a dark arrowhead.

The putative N-linked

the bovine (Goodwin

aa residues which are identical

to those situated just above

glycosylation

site is indicated

et al., 1983). to those of the

them. The cysteine

by an open arrowhead.

251

the carboxyl terminus, just after the second putative N-linked glycosylation site. The percentage of analogy is indicated in Fig. 2. The best analogy is with the pike eel a-subunit. Genomic analysis The p3 insert was used as a probe to analyze eel genomic restriction pattern. A single band was revealed after either EcoRI, EcoRV, BglII, HindHI, and BamHI treatment ranging from 4 kb up to 8 kb. PstI which has a single cleavage site in the cDNA, gave rise to two fragments, a major one at 1.5 kb, the other one of 2.2 kb (Fig. 3). Using the same probe, only one band of 750 nt was revealed on Northern blot analysis of pituitary RNA in control as in estradiol-treated eels (Fig. 4). Densitometry scanning of the autoradio-

1

2

3

4

5

6

Fig. 4. Northern blot analysis of eel pituitary gland RNA. Aliquot (20 ).ig) of total cytoplasmic RNA from control eels (lane l), or estradiol-treated eels (lane 2) was denatured in glyoxal and electrophoresed through 1.5% agarose gel in phosphate buffer then transferred to nylon membrane. Filter was probed with the p3 insert as described in the legend of Fig. 3. Autoradiography was carried out overnight. Band size (in kb) was determined using DNA size standard (lane 3).

gram showed that the signal was 9.5 times higher in estradiol-treated eels than in controls. Discussion

0.56Fig. 3. Southern blot of eel genomic restriction fragments. DNAs were electrophoresed through a 0.7% agarose gel and transferred to a nylon membrane. The filter was probed with 5.107 cpm of 32P-labelled p3 insert at a specific activity of 10s cpm/gg. Autoradiography was carried out for 48 h. Fragment size was calculated using DNA size standards (lane 1). Aliquots (10 pg) were restricted with BarnHI (lane 2), BglII (lane 3) EcoRl (lane 4), EcoRV (lane 5), Hind111 (lane 6) and PstI (lane 7).

In the present study, we have isolated three cDNA clones using a rat a-glycoprotein hormone cDNA probe. All three cDNA clones encode a protein that shares high homology with known glycoprotein hormone a-subunits. Moreover, all ten cysteines and the two putative N-linked glycosylation sites are at the same position. Therefore, these data strongly suggest that these clones encode the eel glycoprotein hormone a-subunit. A surprisingly long poly(T) tract was found at the 5’ end of the pl clone. We think that it probably results from an artefact during cDNA synthesis. Indeed, the presence of fragments of

258

poly(A) tails among purified poly(A) RNA is to be expected. One can imagine that a poly(T)/ poly(A) double-stranded fragment resulting from the first strand synthesis step, which was initiated by oligo(dT) priming, could have been ligated to the blunt-ended cDNA at the EcoRI linkers ligation step. All three cDNA clones had the same sequence except for a single, silent substitution in the p4 clone that may be due to a reading error of the reverse transcriptase during the first strand synthesis. The differences in the attachment position of the poly(A) tail between the three clones could be due to the absence of a consensus sequence for polyadenylation location. These data suggest that all three cDNA results from an mRNA which is encoded by a single gene. In salmon and in carp, cr-cDNA sequences indicate that two genes encode two different CXsubunit mRNA (Chang et al., 1989; Kitahara et al., 1989). In each species, the two mRNA are structurally closely related even in the 3’ untranslated region. For the eel genomic analysis, we have used a truncated eel cDNA as a probe, comprising the two very conserved regions of the coding sequence of the a-subunit. This probe should therefore hybridize to related genes. Although we had not formally quantified the genomic pattern signals of the Southern blot, our experiment strongly suggests that there is only one glycoprotein hormone a-subunit gene in the eel. If more than one gene with closely related structures were present, they would have to be on the same chromosome and to be arranged in cluster, the total length of which being about 4 kb. In this case, only one of them should have the PstI restriction site. Another possibility is that the related genes would have some sequences different enough, so that our probe recognizes only one of them, as hybridization and washing conditions that we have used were not of high stringency. As two distinct gonadotropins occur at least for certain fish species, it will be interesting to examine whether this situation is related to the presence of two types of a-subunits. When comparing known (teleost and mammal) glycoprotein hormone a-subunits it appears that two regions are highly conserved, the cumulative length of which representing about half of the

protein. As several fish sequences are now available, comparative studies would be of interest in the understanding of structure function relationships, as it is relevant to assume that conserved regions are involved in the biological properties which are also conserved. In mammals, experiments using chemical modifications of specific residues in the cr-subunit show that these conserved regions are partly or totally involved in subunit interactions and/or receptor binding (see for review Gordon and Ward, 1985; Pierce, 1988). Moreover, the use of synthetic peptides leads to the same conclusion (see for review Gordon and Ward, 1985; Ryan et al., 1988). By contrast, the rest of the cy-molecule shows a high frequency of replacements; deletions appear between aa 3 and 8 in human, between aa 24 and 29 in salmon 2, at different places between aa 71 and 79 in eel, carp 1 and 2, and salmon 1. These replacements and deletions should lead to conformational specificities. They could correspond to antigenic epitopes as the immunological specificity of the native cr-subunit is high (Licht et al., 1977; Burzawa et al., 1980). We have previously demonstrated that the cellfree mRNA directed synthesis of the precursor for the cu-subunit was about 8 times higher in estradiol-treated eels than in controls (Counis et al., 1987). Using the same RNA preparation, we now show that mRNA levels as measured by Northern blot analysis are in the same ratio. A similar stimulatory effect of estradiol was recently observed on the /3-subunit of GTH-II (Q&rat et al., in press). These results contrast with data demonstrating that in mammals, the administration of gonadal steroids decreases levels of mRNA encoding gonadotropin subunits (see for review Counis et al., 1984). It would be of interest to study whether these discrepancies result from differences, between vertebrates, in the gene structure of regulatory elements, or from changes (depending on sexual status or on evolutionary events) in the molecular environment of the cells. References Andersen, L.R., Hagan, S., Heinke, C. and Guise, K.S. (1988) Focus 10, 35-36. Benton, W.D. and Davis, R.W. (1977) Science 196, 180-182.

259 Burzawa-Gerard, E., Dufour, S. and Fontaine, Y.A. (1980) Gen. Comp. Endocrinol. 41, 199-211. Chang, Y.S., Huang, C.J., Huang, F.L. and Lo, T.B. (1988) Int. J. Peptide Protein Res. 32, 556-564. Chin, W.W., Kronenherg, H.M., Dee, P.C., Maloof, F. and Habener, J.F. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 5329-5333. Counis, R., Corbani, M. and Jutisz, M. (1984) in Hormonal Control of the Hypothalamo-Pituitary-Gonadal axis (McKerns, K.W. and Naor, Z., eds.), pp. 397-410, Plenum Press, New York - London. Counis, R., Dufour, S., Ribot, G., Q&at, B., Fontaine, Y.A. and Jutisz, M. (1987) Endocrinology 121, 1178-1184. Dufour, S., Delerue-Le Belle, N. and Fontaine, Y.A. (1983) Gen. Comp. Endocrinol. 52, 190-197. Fiddes, J.C. and Goodman, H.M. (1979) Nature 281, 351-355. Fontaine, Y.A., Lopez, E., Delerue-Le Belle, N., FontaineBertrand, E., Lallier, F. and Salmon, C. (1976) J. Physiol. (Paris) 72, 871-892. Godine, J.E., Chin, W.W. and Habener, J.F. (1982) J. Biol. Chem. 257, 8368-8371. Goodwin, R.G., Moncman, C.L., Rottman, F.M. and Nilson, J.H. (1983) Nucleic Acids Res. 11, 6873-6882. Gordon, W.L. and Ward, D.C. (1985) in Luteinizing Hormone Action and Receptor (Ascoll, M., ed.), pp. 173-197, CRC Press, Boca Raton, FL. Hirai. T., Takikawa, H. and Kato, Y. (1989) Mol. Cell. Endocrinol. 63, 209-217. Huynh, T.V., Young, R.A. and Davis, R.W. (1985) in DNA Cloning. 1. A Practical Approach (Clover, D., ed.), pp. 49-79, IRL Press, Oxford.

Kitahara, N., Nishizawa, T., Gatanaga, T., Okazaki, H., Andoh, T. and Soma, G.I. (1988) Comp. Biochem. Physiol. 91B, 551-556. Licht, P., Papkoff, H., Farmer, S.W., Muller, L.H., Tsui, H.W. and Crews, D. (1977) Recent Prog. Horm. Res. 33,169-218. Liu, C.S., Huang, F.L., Chang, Y.S. and Lo, T.B. (1989) Eur. J. B&hem. 186, 105-114. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) in Molecular Cloning: A Laboratory Manual, p. 545, Cold Spring Harbor, Cold Spring, Harbor, NY. Olivereau, M. and Olivereau, J. (1979) Cell Tissue Res. 199, 431-454. Pierce, J.G. (1988) in The Physiology of Reproduction (Knobil, E. and Neil, J., eds.), pp. 1335-1348, Raven Press, New York. Querat, B., Moumni, M., Jutisz, M., Fontaine, Y.A. and Counis. R. (1990) J. Mol. Endocrinol. (in press). Ryan, R.J., Charlesworth, M.C., McCormick, D.J., Milius, R.P. and Keutmann, H.T. (1988) FASEB J. 2, 2661-2669. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467. Sekine, S., Saito, A., Itoh, H., Kawauchi, H. and Itoh, S. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 8645-8649. Stewart, F., Thomson, J.A., Leigh, S.E.A. and Warwick, J.M. (1987) J. Endocrinol. 115, 341-346. Suzuki, K., Kawauchi, H. and Nagahama. Y. (1988) Gen. Comp. Endocrinol. 71, 292-301. Yanisch-Perron, C., Vierra, J. and Messing, J. (1985) Gene 33, 103-119.