Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean.

GENE-39706; No. of pages: 10; 4C: Gene xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman–Birk type protease inhibitor from rice bean Rajan Katoch a,⁎, Sunil Kumar Singh b, Neelam Thakur c, Som Dutt b, Sudesh Kumar Yadav b, Rich Shukle d a

Biochemistry Laboratory, Department of Crop Improvement, CSKHPKV, Palampur, HP 176062, India Department of Biotechnology, Institute of Himalayan Bioresource Technology, Palampur 176062, India c Department of Zoology, PAU, Ludhiana 141004, India d Department of Entomology, Purdue University, West Lafayette, IN 47907, USA b

a r t i c l e

i n f o

Article history: Received 22 April 2014 Received in revised form 21 May 2014 Accepted 23 May 2014 Available online xxxx Keywords: Bowman–Birk protease inhibitor Gene expression Hessian fly Insect resistance Rice bean

a b s t r a c t This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman–Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327 bp encoding 109 amino acids was cloned from rice bean seeds using degenerate primer set. BlastP search revealed that the RbTI encoded amino acid of approx 13.0 kDa and shared 99% homology each with BBI from Phaseolus parvulus, Vigna trilobata and Vigna vexilata. Phylogenetic tree also showed close relationship of RbTI with BBI from other members of Leguminaceae family. RbTI gene was further confirmed as intronless (GenBank accession no. KJ159908). The secondary and 3D-structural models for the RbTI were predicted with homology modeling. qRT-PCR studies revealed the highest RbTI expression in the seeds nearing maturity, whereas the low expression of the gene was noticed in young leaves. The isolated RbTI was successfully expressed in Escherichia coli and the highest expression was recorded after 5.5 h of induction. Study on the inhibitory activity of expressed protein against the gut proteases of Hessian fly larvae revealed 87% inhibition. The novel RbTI gene will further broaden the pool of plant defense genes and could be an ideal choice for developing transgenic crops resistant to insect pests with high economic value. In addition, it has the potential to be used as a probe for selection of insect- and pathogen-resistant genotypes. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Insect pest menace is one of the major factors that destabilize crop productivity in agricultural ecosystems. They are responsible for severe reduction in crop yields, in spite of extensive use of chemical pesticides (Boulter, 1993). Many plants have evolved a certain degree of resistance against insect pests through the production of defense compounds (Katoch and Thakur, 2013a). Most of the protective substances produced are proteinaceous in nature. Production of inhibitors that interfere with the digestive biochemistry of insect pests is one of the naturally occurring defense mechanisms in plants (Katoch et al., 2013). This mechanism is manifested in the form of accumulation of one or several defense proteins such as protease inhibitors, α-amylase inhibitor, lectins and arcelins (Furstenberg-Hagg et al., 2013). The potential for using this natural host plant resistance in pest control across

Abbreviations: RbTI, rice bean trypsin inhibitor gene; RBTI, rice bean trypsin inhibitor; PCR, polymerase chain reaction; RT-PCR, real time PCR; PI, protease inhibitor. ⁎ Corresponding author at: Biochemistry Laboratory, Department of Crop Improvement, CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur, HP 176062, India. E-mail address: [email protected] (R. Katoch).

the plant genetic barriers has increased with the development of gene transfer techniques. Protease inhibitors (PIs) are the largest class of proteins that have undergone extensive investigations and consequently their structure, function and metabolism have been well documented (Koundal and Rajendran, 2003). They are one of the prime candidates with highly proven inhibitory activity against insect pests and also known to improve the nutritional quality of food (Bhattacharjee et al., 2012). These inhibitors inactivate proteases of insect pests, while rarely inhibiting endogenous enzymes is a compelling evidence for their involvement in plant protection against insect pests (Laskowski and Kato, 1980; Laskowski et al., 1988). PIs are usually present in plants' storage organs, such as seeds and accumulate about 1 to 10% of the total soluble proteins of storage tissues. In legumes, PIs accumulate in large amounts during seed maturation, and play an important role both in the deposition of storage protein and in plant defense (Zhu et al., 2014). These inhibitor families have been found specific for each of the four mechanistic classes of proteolytic enzymes and based on the active amino acids in their “reaction center”, are classified as Serine, Cysteine, Aspartic and Metallo proteases (Mourao and Schwartz, 2013). Inhibitors of serine proteases have been described in many plant species, and are

http://dx.doi.org/10.1016/j.gene.2014.05.055 0378-1119/© 2014 Elsevier B.V. All rights reserved.

Please cite this article as: Katoch, R., et al., Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman– Birk type protease inhibitor from rice bean, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.05.055

2

R. Katoch et al. / Gene xxx (2014) xxx–xxx

universal throughout the plant kingdom (Fan and Wu, 2005). The trypsin subclass of serine protease inhibitors from legume seeds exhibit insecticidal effects against several crop pests belonging to the orders of Lepidoptera, Coleoptera and Orthoptera. Leguminous plant seeds usually contain two major types of serine protease inhibitors, the Bowman–Birk type (about 8–16 kDa) with seven disulfide linkages and two reactive sites of trypsin and chymotrypsin and the Kunitz type (about 20–25 kDa) with two disulfide linkages and a single reactive site of trypsin (Laskowski and Qasim, 2000; Peyachoknagul et al., 1989). A large number of plant protease inhibitor genes have been isolated, cloned and sequenced (Ge et al., 2014; Kuhar et al., 2012; Valueva et al., 2008). The gene size and coding regions of these inhibitors are small, usually devoid of introns (Wang et al., 2008) and comprise readily identifiable core region covering the invariant cysteine residues. They are of particular interest because they are generally the product of single gene and inhibit proteolytic enzymes of animal and fungal origin, but rarely of plant origin and therefore are thought to act as protective agents (Baldwin and Schultz, 1983; Green and Ryan, 1972; Hilder et al., 1993). The potential of PIs has been demonstrated by the transfer of these genes from different sources to several plants of economic interest, resulting in transgenic plants more resistant to predation (Lingling et al., 2005; Pujol et al., 2005) and pathogens (Qu et al., 2003; Quilis et al., 2007). Numerous studies have recently demonstrated the efficacy of proteinase inhibitors as defense proteins and the most direct proof comes from proteinase inhibitor over-expression in transgenic plants which cause increase in resistance to insect pest (Heitz et al., 1999; Lepelley et al., 2012; Smigocki et al., 2013). Among different categories of protease inhibitors, serine protease inhibitors are the major players in a wide range of biological processes including cell signaling, cell cycle progression, digestion, immune responses, blood coagulation and wound healing (Turk, 2006). Their role in the physiology of many human diseases, ranging from cancer (Armstrong et al., 2013; Garcia-Gasca et al., 2012; Magee et al., 2012; Souza et al., 2014; William and Papadimitrakopoulou, 2013), and inflammatory disorders to degenerative diseases (Safavi and Rostami, 2012), inhibition of mutagenesis and cell proliferation (Kobayashi, 2013), as anti-proliferative activity (Chan et al., 2013), now represents an increasingly important feature of this family of enzymes. These proteases are tightly controlled through a number of different mechanisms, including regulation of gene expression, recognition of the substrate by the active site, activity regulation by small molecules, changes in cellular location, post-translational modifications, interaction with other proteins and/or through inhibition of proteolysis by protease inhibitors (PIs) (Drag and Salvesen, 2010; Shen, 2010). Majority of PIs studied in plant kingdom originate from three main families namely Leguminosae, Solanaceae and Gramineae (Richardson, 1991). They reduce the digestive capability of insects by inhibiting proteinases of the midgut, thereby arresting their growth and development (Broadway and Duffey, 1986; Delano-Frier et al., 2008). The PIs enter in the insect digestive tract along with the food and block the protein digestion, and hence, starving the insect for amino acids and energy, resulting in retardation of growth and development (Ryan, 1990). These protease inhibitor genes have practical advantages over genes encoding for complex pathways i.e. by transferring single defensive gene from one plant species to another and expressing them from their own wound inducible or constitutive promoters thereby imparting resistance against insect pests (Boulter, 1993). This has been demonstrated by the transfer of proteinase inhibitor genes from different sources to several plants of economic interest, resulting in transgenic plants more resistant to predation (Altpeter et al., 1999; Boulter, 1993). The natural role of these inhibitors in plants is related to the regulation of the activity of endogenous proteases, particularly during the stage of protein deposition in storage tissues (Baumgartner and Chrispeels, 1997). This was first demonstrated by Hilder et al. (1987) by transferring trypsin inhibitor gene from Vigna unguiculata to tobacco, which conferred resistance to wide range of insect pests

including Lepidopterans, such as Heliothis and Spodoptera; coleopterans such as Diabrotica, Anthonomnous and orthoptera such as Locusts. For further broadening the pool of plant defense genes and for identification of new and potential inhibitory proteins for pest control, insect-specific inhibitor protein and genes expressing them need to be isolated from different sources. Bowman–Birk inhibitor genes represent one of several seed protein gene families that are highly regulated during the plant life cycle (Goldberg et al., 1989). Rice bean (Vigna umbellata (Thunb) Ohwi and Ohashi) is one of the lesser known, unexploited legumes of tropical and subtropical regions with high nutritional value (Katoch, 2013). The seeds of this legume remain unaffected from insect pests for several years as compared to other legumes of genus Vigna (Katoch and Thakur, 2013b). As the crop is restricted to specific regions, it represents the potential source of genes of insect control. Rice bean seeds and storage organs have proven to be a very rich source of proteinase inhibitors, particularly the serine proteinases (Kowalska et al., 2007) but till date the genes expressing these inhibitory proteins have not been sequenced and characterized from this crop. This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman–Birk protease inhibitor (RbTI) from Rice bean. The isolated RbTI gene has been expressed in E. coli and the expressed and purified protein has further been tested for its inhibitory activity against the gut proteases of Hessian fly (Mayetiola destructor), which is a significant pest of cereal crops including wheat, barley and rye. The study presents the encouraging results for future use of the protease inhibitor gene from rice bean RbTI for the development of crops of high economic value resistant to insect pests. 2. Materials and methods 2.1. Materials Rice bean (V. umbellata L.) seeds (Acc. No: 173933) were procured from the Department of Agriculture, USA and were grown in plastic pots placed in the green house of Department of Entomology, Purdue University, USA under standard conditions. The leaves were sampled after 20, 35, 50 and 65 days after sowing, whereas the seeds were sampled after 5, 25, 45 and 65 days after seed setting and placed in −80 °C before use. PCR reagents and restriction enzymes were purchased from Promega Corp. (Madison, WI). A QIAquick PCR purification kit and QIAGEN Omniscript Reverse Transcriptase were obtained from QIAGEN, Hilden, Germany, whereas a pGEM-T Easy vector kit was from Promega. A Thermoscript RT-PCR kit was purchased from Invitrogen Life Technologies California, USA. Primers were commercially synthesized as highly purified salt-free products by Biolink, USA. All other reagents were of the finest commercial grade available. 2.2. Methods 2.2.1. Total RNA preparation Total RNA was prepared from leaves and immature seeds (collected from 20 day old pods) by LiCl method (Chang et al., 1993). RNA was treated with DNase1 (Amplification Grade; Invitrogen, USA). The integrity of isolated RNA was qualitatively checked by 1% formaldehyde agarose gel electrophoresis and stained with ethidium bromide (Sambrook and Russel, 2001). Isolated total RNA was further used for cloning and expression analysis of the BBI protease inhibitor I gene from rice bean. 2.2.2. Extraction of genomic DNA Total genomic DNA was isolated from 16-day-old rice bean seedlings using the CTAB method (Murray and Thompson, 1980) followed by RNase treatment. 2.2.3. Designing of primers To amplify the cDNA of rice bean protease inhibitor, a set of degenerate oligonucleotide primers (Forward and Reverse) conceived from



coding region of highly conserved domain of protease inhibitor gene from different genera of Leguminaceae family was targeted in database NCBI. Using ClustalW software (Thompson et al., 1994), we aligned protease inhibitor sequences of different plant species obtained from NCBI to find their conserved motif sequences (Fig. 1). Based on the homology between the aligned sequences, the most similar ones were retained and used the OligoCalc software (Molecular Biology Insights, Inc. CO, USA) to design degenerate primer pair to be used in our study (Table 1). Primer specificity was examined by Blastn. Different sets of gene-specific PCR primers for amplification of BBI type PI gene were designed using Primer 3.0 software (http://frodo.wi.mit.edu/primer3/). The primers were selected from highly conserved regions by using a simultaneous alignment tool through computer analysis with ClustalW tool. The primers were designed from the coding region of the genes determined through Softberry software following the standard rules and analyzed using Fast PCR software for self-dimers, melting temperature and priming efficiency. Primer alignment specificity was checked using NCBI blast. The amplified product size was expected to be 320 bp. 2.2.4. RT-PCR for amplification and cloning The SuperScript One-Step RT-PCR (Invitrogen) was used. The reaction mix contained 25 μl of 2× reaction mix (0.4 mM dNTP, 2.4 mM magnesium sulfate), 10 pg–1 μg of mRNA, 10 μM sense and antisense primers, and 1 μl of RT/Platinum Taq Mix in a final 50 μl volume. The amplification was programmed in a PTC-221 (BioRad, Hercules, CA, USA). The program was first-strand cDNA synthesis (45 °C for 30 min), predenaturation (94 °C for 2 min), PCR amplification of 35 cycles (denaturing at 94 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1–3 min), and final extension (72 °C for 10 min). A small product volume (2–5 μl) was withdrawn for 1% agarose gel electrophoresis analysis. 2.2.5. Isolation of RbTI gene PCR was carried out to amplify the coding gene of the rice bean BBI trypsin inhibitor (RbTI) from the synthesized cDNA using degenerate primers according to modified protocol of Sambrook et al. (1989). Each 50 μl reaction contained 5 μl of 10 × PCR buffer (Invitrogen, Grand Island, NY, USA), 1.5 mmol of MgCl2, 10 pmol of each primer, 0.2 mmol of each dNTP (Invitrogen), and 1.0 unit of Platinum Taq DNA polymerase (Invitrogen, Grand Island, NY, USA). Polymerase chain reaction (PCR) cycling was with a DNA Engine Dyad PTC-220 and PTC-221 (BioRad, Hercules, CA, USA) under the following conditions: denaturing

Phaseolus_parvulus P_microcarpus Vigna_radiata Glycine_max



3

Table 1 List of primers used in this study for amplification of partial cDNA, genomic DNA, 3′and 5′ RACE, directional cloning and RT-PCR analysis. Name

Sequence (5′–3′)

DFP1 DFP2 DFP3 DRP1 DRP2 TOPORbTIF TOPORbTIR 3′GSP Forward 3′GSP Nested 5′GSP Reverse 5′GSP Nested RbTIF RbTIR 18S RNAF 18 s RNAR BBI-RT-F BBI-RT-R BBI-RT-F1 BBI-RT-R1

ATGRTGGTGCTRAAGGTGTGT TCCTTGTRGGGGKTACTACTR TGARTCTTCARAACCATGCTGTGAT CAMATACASGWTTTRCAAGCYGA TGGCAYGAATTCARYCTMAYATCT CACCATGGTGGTGCTGAAGGTGTGT TTAGACATCATCTTTATCCCT ACTAAATCAATACCTCCTCAGTGC TCCTCAGTGCCAATGTGCAGATATG GCACTGAGGAGGTATTGATTTAGT GTATTGATTTAGTGCAGAGGCATA ATGGTGGTGCTGAAGGTGTGTGT TTAGACATCATCTTTATCCCTGG CGTGGTGAGAAGTCCACTGAAC TCACCTACGGAAACCTTGTTACG TGCTGGCATGGATCTGAAAC GGCTCATCGCTTGAGTCATGA GATCAATGCCAGGCCAGTGT GACTTGCAAGGTTTGTGACAGAA

at 95 °C for 2 min followed by 30 cycles of denaturing at 95 °C for 1 min, and annealing at 55 °C for 30 s, extension at 68 °C for 1 min. In order to obtain the longest sequence, the amplified fragments were cloned using the pCR4-TOPO® vector into electrocompetent TOP10 cells (Invitrogen, Grand Island, NY, USA). The recombinant plasmids were isolated (Promega wizard Plus SV miniprep DNA purification system) and sequenced through the Purdue Genomics High Throughput Center. A consensus sequence was made from the clones and all sequences were aligned using ClustalW2 (Chenna et al., 2003). BLAST analysis indicated the sequenced fragment similarity to BBI genes known from other species. Gene specific primers (GSP) and nested GSP (NGSP) (Table 1) were designed based on the partial sequences of RbTI for the cloning of 5′ and 3′ ends of the RbTI gene by rapid amplification of cDNA end (RACE) PCR. 2.2.6. Rapid amplification of cDNA ends 2.2.6.1. 3′-RACE. The total RNA was extracted from the seeds using CTAB method as previously described. The RNA was reverse transcribed into

ATGATGGTGCTGAAGGTGTGTTTGTTGCTAGTTTTCCTTGTAGGGGTTACTACTG---CTCGCATGGATCTGAA---------CCACCTCATCAGAAGTAATCATCATGACTCAGGCGAT ATGATGGTGCTGAAGGTGTGTCTGTTGCTAGTTTTCCTTGTAGGGGTTACTACTG---CTCGCATGGATCTGAA---------CCACCTCATCAGAA---ATCATCATGATTCAAGCGAT ATGATGGTGCTAAAGGTGTGTGTGTTGGTAGTACTCCTTGTAGGGGTTACTACTG---CTGGCATGGATCTGAA---------CCAGCTGAGAAGTAGTCATCATCATGACTCAAGCGAT ATGGTGGTGCTAAAGGTGTGTTTGGTGCTACTTTTCCTTGTGGGGGGTACTACTAGTGCCAACTTGAGGCTGAGTAAGCTTGGCCTCCTCATGAAAAGTGATCATCAACACTCAAATGAT *** ******* ********* ** ** ** * ******* **** ******* ** * ** **** ** ** * * * ******* * *** *** 5’-ATGRTGGTGCTRAAGGTGTGT-3’ 5’-TCCTTGTRGGGGKTACTACTR-3’ DFP1 (21bp) DFP2 (21bp) GAGCCTTCTGAGTCTTCAGAACCATGCTGTGATCTCTGCATGTGCACAGATTCAATACCTCCTATATGCCAATGCACAGATATTAGGTTGAATTCATGCCACTCGGCTTGCAAAACCTGT GAGCCTTCTGAATCTTCAGAACCATGCTGTGATCTCTGCATGTGCACACATTCAATACCTCCTATATGCCAATGCAAAGATATTAGGTTGAATTCATGCCACTCAGCTTGCAAAACCTGT GAGCCTTCTGAGTCTTCAGAACCATGCTGTGATTCATGCCGCTGCACTAAATCAATACCTCCTCAATGCCATTGTGCAGATGTTAGGTTGAATTCATGCCACTCAGCTTGCAAATCCTGT GA------TGAGTCTTCAAAACCATGCTGTGATCAATGCGCATGCACAAAGTCAAACCCTCCTCAATGCCGCTGTTCAGATATGAGACTGAATTCGTGCCATTCAGCTTGTAAATCGTGT ** *** ****** ************** *** ***** * **** ****** ***** ** **** * ** ******* ***** ** ***** *** * *** 5’-TGARTCTTCARAACCATGCTGTGAT-3’ AGATRTKAGRYTGAATTCRTGCCA TCRGCTTGYAAAWCSTGT DFP3 (25bp) 3’-TCTAYAMTCYRACTTAAGYACGGT-5’ DRP2 (24bp) 3’-AGYCGAACRTTTWGSACA DRP1 (23bp) ATGTGTACAAGATCACTGCCAGGCA-AGTGTCGTTGCCTTGACACCACTGATAATTGTTACAAATCTTGCAAGTCCAGTGGTGAAGATGATGA---CTGA 324 ATGTGTACACGATCAATGCCAGGCA-AGTGTCGTTGCCTTGACACCACTGATTTTTGTTACAAATCTTGCAAGTCCAGTGGTGAAGATGATGA---CTGA 321 ATGTGTACACGATCAATGCCAGGCA-AGTGTCGTTGCCTTGACATTGATGATTTCTGTTACAAACCTTGTGAGTCCATGGATAAAGATGATGA---CTAA 324 ATTTGCGCATTATCG-TATCCTGCACAGTGTTTTTGTGTTGACATAACCGATTTCTGCTATGAACCTTGCAAGCCCAGTGAGGATGACAAGGAAAACTAA 333 ** ** ** *** * * *** ***** *** ****** *** ** ** ** **** ** *** * * ** * ** ** * ATKTG TAMAC-5’

108 105 108 120

228 225 228 234

Fig. 1. Designing of degenerate primers from aligned nucleotides having conserved stretch for amplification of partial RbTI cDNA. Two sets of forward and reverse primers were designed. DFP1; degenerate forward primer 1, DFP2; degenerate forward primer 2, DRP1; degenerate reverse primer 1, DRP2; degenerate reverse primer 2. Accession numbers: Phaseolus_parvulus AM690318.1; Vigna radiata GU121097.1; Glycine max AY233800.1; P. microcarpus AM690320.1.


4


cDNAs with SuperScript™ III RT and GeneRacer Oligo dT primers (or random primers or GSP) according to instruction manual. To amplify the cDNA 3′ end two gene-specific primers (GSP ACTAAATCAATACCTC CTCAGTGC and NGSP TCCTCAGTGCCAATGTGCAGATATG) were designed by Primer 3.0 software and validated using NetPrimer software. These two primers were used for two rounds of PCR. Initial PCR reactions were done with the 3 μl of GeneRacer™ 3′ Primer, 1 μl of Forward GSP, 1 μl of RNA template, 5 μl of 10 × PCR buffer, 1 μl of dNTP solution (10 mM), 0.5 μl of Platinum® Taq DNA Polymerase and 2 μl of MgSO4 to make the final volume of 50 μl with sterile water. The nested PCR was performed with 1 μl of GeneRacer™ 3′ Nested Primers, 1 μl of Forward Nested GSP, 1 μl of initial PCR product, 5 μl of 10 × PCR buffer, 1 μl of dNTP solution (10 mM), 0.5 μl of Platinum® Taq DNA Polymerase and 2 μl of MgSO4 to make final volume of 50 μl with sterile water. The program for the first round of PCR was 94 °C for 2 min, 94 °C for 30 s, 72 °C for 1 min; followed by 5 cycles of touchdown PCR, starting with 94 °C for 30 s, and 70 °C for 1 min. This was followed by 25 cycles of 94 °C for 30 s, 58 °C for 30 s, 70 °C for 10 min; and a final elongation at 72 °C for 10 min. For the second round of PCR, the program was similar to the first round, except for the first 3 steps. The nested PCR products were analyzed on an agarose gel. Positive PCR products were cloned into pCR4-TOPO vector (Invitrogen, CA, USA) and sequenced.

2.2.6.2. 5′-RACE for cDNA ends. RNA ligase-mediated 5′-rapid amplification of cDNA ends (RLM 5′-RACE) was performed using the GeneRacer RLM-RACE kit (Invitrogen, USA). The total RNA was extracted from the seeds using cTAB method as previously described. The total RNA or mRNA was treated with calf intestinal phosphatase (CIP) to remove free 5′ phosphate in the uncapped mRNA to prevent ligation of these mRNAs with the RNA Oligo. The total RNA was then treated with Tobacco Acid Pyrophosphatase to remove the cap of the capped mRNA followed by a ligation of RNA Oligo with the treated RNA population. The RNA was reverse transcribed into cDNAs with SuperScript™ III RT and GeneRacer OligodT primers according to instruction manual. To amplify cDNA 5′ end two gene-specific primers (GSP 5′-GCACTGAGGAGGTATT GATTTAGT-3′ and NGSP 5′-GTATTGATTTAGTGCAGAGGCATA-3′) were designed by Primer Premier 3.0 software. These two primers were used for two rounds of PCR. Initial PCR reactions were done with the 3 μl of GeneRacer™ 5′ Primer, 1 μl of Reverse GSP, 1 μl of RNA template, 5 μl of 10 × PCR buffer, 1 μl of dNTP solution (10 mM), 0.5 μl of Platinum® Taq DNA Polymerase and 2 μl of MgSO4 to make final volume of 50 μl with sterile water. The nested PCR was performed with 1 μl of GeneRacer™ 5′ Nested Primers, 1 μl of Reverse Nested GSP, 1 μl of initial PCR product, 5 μl of 10× PCR buffer, 1 μl of dNTP solution (10 mM), 0.5 μl of Platinum® Taq DNA Polymerase and 2 μl of MgSO4 to make final volume of 50 μl with sterile water. The program for the first round PCR was 94 °C for 2 min followed by 5 cycles of 94 °C for 30 s, 72 °C for 1 min; followed by 5 cycles of 94 °C for 30 s, and 70 °C for 1 min. This was followed by 25 cycles of 94 °C for 30 s, 62 °C for 30 s, 70 °C for 1 min; and a final elongation at 72 °C for 10 min. For the second round of PCR, the program was similar to the first round, except for the first 3 steps. The nested PCR products were analyzed on an agarose gel. Positive PCR products were cloned into pCR4-TOPO vector (Invitrogen, CA, USA) and sequenced. 2.2.7. Phylogenetic analysis and 3-dimensional modeling of RbTI protein The amino acid sequences for different PI proteins were downloaded from NCBI (http://www.ncbi.nlm.nih.gov/protein/) and aligned by using ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/) the aligned sequences were used to build phylogenetic tree with 1000 bootstraps in Mega 6.0 software (Tamura et al., 2013). The amino acid sequence of RbTI was deduced by using expasy translate nucleotide software (http://web.expasy.org/translate/) and subjected for automated modeling in SWISSMODEL (http://swissmodel.expasy.org/interactive). The PDB file generated from SWISS MODEL was used to build 3-dimensional

Fig. 2. Partial cDNA amplification of different degenerate primer sets. 1; amplification with DFP2 and DRP1, 2; amplification with DFP1 and DRP1. As DFP1 and DRP1 were from the 5′ and 3′ ends of aligned Leguminaceae family BBI nucleotide sequence hence this primer combination was used for further amplification and elution of partial cDNA which was sequenced and used for designing of gene specific and nested gene specific 5′ and 3′ RACE primers.

protein model and the disulfide bridges, N-terminus, C-terminus as well as reactive loop of BBI domain for its activity (Voss et al., 1996). 2.2.8. Expression of RbTI in E. coli The RbTI gene was cloned into pET200 directional-Topo expression vector (Invitrogen, USA) and sequence was confirmed. The resulting pET–RbTI construct was transformed into BL21 Star™ (DE3) E. coli cells. A single colony of E. coli harboring pET–RbTI was inoculated into Luria–Bertani (LB) medium supplemented with kanamycin and grown in a shaking incubator at 37 °C overnight. Overnight grown culture was used to inoculate a fresh culture at 37 °C with vigorous shaking until the optical density (OD600) reached about 0.5–0.6. For induction of recombinant protein expression, IPTG (final concentration of 1 mM) was added to the culture and was further incubated at 20 °C for 14 h. The cells were harvested by centrifugation for 5 min at 5000 rpm and 4 °C. The pellet was resuspended in binding buffer (250 mM NaH2PO4, pH 8.0; 2.5 M NaCl; 3 M Imidazole) and sonicated for 1 min. The suspension was centrifuged at 300 ×g for 15 min to clarify the enzyme solution. The supernatant (lysate) was analyzed by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) assay. After electrophoresis, the gel was stained with Coomassie Brilliant Blue R250 to visualize the protein bands. 2.2.9. Purification of recombinant RBTI Recombinant protein was purified by affinity chromatography on Ni-NTA resin (Invitrogen, USA). In brief, the column was equilibrated with binding buffer (250 mM NaH2PO4, pH 8.0; 2.5 M NaCl; 3 M

Fig. 3. Nucleotide and deduced corresponding amino acid sequence of RbTI cDNA as obtained after alignment of 3′ and 5′ RACE product of partial cDNA. The GenBank accession number is KJ159908.



5

Fig. 4. Alignment of BBI protein with deduced amino acids from full length cDNA of RbTI (Vigma umbellata). The conserved BBI domain shows high level of similarity with the BBI domain from other species of Leguminaceae family. Accession numbers: Vigna angularis—P01058.1; Phaseolus parvulus—CAM84155.1; Phaseolus filiformis—CAL69282.1; Vigna radiata var. sublobata—ABD91575.1; Vigna trilobata—ABD91574.1; Phaseolus grayanus—CAQ52359.1; Vigna vexillata—ABD97866.1; Vigna mungo—ABD97865.1; Phaseolus microcarpus—CAM84156; Glycine max—XP_003544720.1.

Imidazole). 8 ml of supernatant (lysate) was loaded on equilibrated column and incubated for 30–60 min at 4–7 °C using gentle agitation. The resin were allowed to settle down and washed five times with 8 ml washing buffer to remove the contaminant protein. The bound protein was eluted with 8–12 ml of the elution buffer (200 mM imidazole in the binding buffer). The protein content of collected fractions was measured according to Bradford method (Bradford, 1976) using bovine serum albumin as the standard. Fractions containing protein were combined and analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) on 16% separating gel with subsequent Coomassie brilliant blue staining.

2.2.10. Midgut preparations of Hessian fly (M. destructor) Midgut proteases of Hessian fly (Biotype L) were used in the current study. Hessian flies were reared on wheat (cv. Newton) in growth chambers at 20 °C with a 12-h photoperiod. First instars of Hessian fly larvae and pupae were collected by dissecting the crown portions of infested wheat seedlings in water to remove them from the plants. Two hundred midguts were dissected from four day post-hatch 1stinstar larvae as described earlier (Grover et al., 1988; Mittapalli et al., 2005). Briefly, midguts were dissected in ice-cold Schneider's insect medium (Sigma-Aldrich, St. Louis, MO) by first pinching off the posterior tip of the larvae and then gently compressing the body, commencing

Fig. 5. A; the predicted three dimensional structure of RbTI protein by using SWISSMODEL online software, the mungbean BBI (3myw) was taken as a template in automated mode the reactive loop is highlighted along with its residue positions and the protein model was built in PyMol (DSB = disulfide bridges) and B; alignment of RbTI with 3myw which has been used for three dimensional modeling showing conserved disulfide bonds among the two.


6


from the anterior end. Midguts were collected and ground in 10 ml of PBS and centrifuged at 10,000 rpm for 10 min. The supernatant containing gut proteases was used for the assaying inhibitory activity of RbTI. 2.2.11. Assay for the trypsin and chymotrypsin inhibitory activity of RBTI Trypsin and chymotrypsin inhibitory assays were carried out by estimating the remaining esterolytic activity of trypsin and chymotrypsin towards the substrate tosyl arginyl methyl ester hydrochloride (TAME) and N-benzoyl-L-tyrosine ethyl ester (BTEE), respectively, following Birk (1976). Stock solutions of TAME (10 mM in Milli Q water) and BTEE (1.07 mM in 50% aqueous methanol) were used. Bovine trypsin and chymotrypsin (25 μl and 30 μl from stock 1 mg/ml) prepared in 1 mM HCl were used as reference standards. Reactions were carried out in a UV–VIS spectrophotometer, set at 247 nm for trypsin and 256 nm for chymotrypsin. One trypsin/chymotrypsin unit is defined as 1 μmol of substrate hydrolyzed per minute of reaction. One inhibition unit is defined as unit of enzyme inhibited. 2.2.12. Analysis of RbTI expression RT-PCR for the analysis of RbTI expression was carried out using total RNA from foliage and immature seeds. Rice bean foliage was sampled after 20, 35, 50 and 65 days after sowing, whereas, immature seeds were sampled after 5, 25, 45 and 65 days after seed setting. Frozen tissues were ground in liquid nitrogen, and the total RNA was extracted using cTAB method as described above. The quality of RNA was analyzed by 1.2% formaldehyde agarose gel electrophoresis. From each RNA sample, first-strand cDNA was synthesized using SuperScript OneStep RT-PCR (Invitrogen, USA) as described above. The real-time qRT-PCR reaction was performed on Roche LightCycler 480 System (Roche, Switzerland). Each PCR reaction was carried out in triplicate

using 100 ng of cDNA, 10 μl of SYBR Green PCR master mix (Biorad, USA) and 300 nM of gene specific forward (and reverse primer each to the final concentration of 20 μl in distilled water). The following amplification program was used: 95 °C for 3 min, 40 cycles of 95 °C for 15 s, 55 °C for 30 s and 72 °C for 30 s. The specificity of the individual PCR amplification was confirmed by a melt curve protocol from 60 to 95 °C following the final cycle of the real-time qRTPCR. PCR products were first resolved on 1% (w/v) agarose gels stained with ethidium bromide and then photo-documented. RTqPCR assays were performed in triplicate, and standard curves were generated using six two-fold serial dilutions from a pool of all cDNAs (in DNase/RNase-free distillated water) to determine primer pair efficiencies (E) according to the equation: E = 10[− 1/slope]. Only primer pairs with efficiencies of 2 ± 0.2 were selected for RT-qPCR relative quantification using the 2− ΔΔCt method (Livak and Schmittgen, 2001) with V. unguiculata 18S ribosomal RNA gene as reference gene. Data were analyzed using the LightCycler 480 software version 1.5.0.39 and the 2nd derivative max algorithm.

3. Results and discussion 3.1. Isolation of RbTI The degenerate primers designed from the conserved regions for BBI of closely related leguminous species (Fig. 1) were used to amplify partial cDNA of approx 250 bp from rice bean mRNA (Fig. 2). The amplified fragment were eluted and cloned in pCR4 TOPO vector and sequenced. The rice bean cDNA sequence was further used for designing the 5′ and 3′ RACE specific primers (Table 1). The 3′ and 5′ RACE resulted in amplification of approx 325 and 300 bp fragments, respectively. The

Fig. 6. Pylogenetic analysis of RbTI protein from rice bean and other Leguminaceae family BBI proteins along with its homologs from cereals and other plant species. The numeric value at the branches depicts the bootstrapping for the grouping of species, shows robustness of grouping. Accession numbers: Vigna angularis—P01058.1; Phaseolus parvulus—CAM84155.1; Phaseolus filiformis—CAL69282.1; Vigna radiata var. sublobata—ABD91575.1; Vigna trilobata—ABD91574.1; Phaseolus grayanus—CAQ52359.1; Vigna vexillata—ABD97866.1; Cicer arietinum—AEW50186.1; Vigna mungo—ABD97865.1; Phaseolus microcarpus—CAM84156.1; Glycine max—XP_003544720.1; Oryza sativa—ADM86865.1; Hordeum vulgare—BAJ94350.1; Triticum aestivum—ABX84380.1; Zea mays—ACG40110.1; Setaria italica—XP_004968056.1; Phaseolus maculatus—CAM88857.1; Ananas comosus—P01068.2.



sequence alignment of 3′ and 5′ RACE products resulted in the sequence of 593 bp in which 327 bp was cDNA (Fig. 3) with 40 bp 5′-UTR and 226 bp 3′-UTR. The full length RbTI sequence was deposited in GenBank under accession number KJ159908. Sequence analysis confirmed the clone to be a BBI gene of Leguminaceae family. The RbTI cDNA with A + T =54.13% and C + G = 45.87%, coded for 108 amino acid predicted peptide composed of 11 Strongly Basic(+) Amino Acids (K, R), 13 Strongly Acidic(−) Amino Acids (D, E), 26 Hydrophobic Amino Acids (A, I, L, F, W, V), and 35 Polar Amino Acids (N, C, Q, S, T, Y). By using the Computer pI/Mw Tool (http://www.expasy.org), the calculated isoelectric point (pI) and molecular weight of the deduced BBI were inferred to be 6.705 and 11,926.02 Da, respectively having a net −1.213 charge at pH 7.0. The sequence of the deduced peptide was compared at a data bank with known proteins which showed similarity of 99% each with BBI from Phaseolus parvulus, Vigna trilobata and Vigna vexilata, respectively (Fig. 4). The conserved BBI domain was clearly observed in sequence. By selecting related structures after Blast analysis, we found that the structure of the RbTI was very similar to that of mung bean, which has a PDB ID of 3myw, with a similarity level reaching 80%. The amino acid sequence of RbTI was imported into the online tool SWISS-MODEL (http://swissmodel.expasy.org/) to further analyze the tertiary structure of rice bean BBI peptide (Fig. 5A). The reactive loop was found to be conserved in RbTI BBI as reported by Voss et al. (1996). The final model included residues 45–99 (E = 1.14248e−10). The disulfide bonds which are important part of proteinase inhibitor activity was also found to be conserved in RbTI (Fig. 5B).

7

Fig. 7. The amplification of RbTI gene by using genomic DNA and cDNA as template. A; Ladder, B, amplification of RbTI on genomic DNA and C; amplification of RbTI gene on cDNA.

aspartic proteinase inhibitor from potato (Barli-Maganja et al., 1992). D'Onofrio et al. (1991) suggested that the presence of intronless gene may be a structural feature that is maintained because it provides a selective advantage, by rapidly encoding turning over transcripts in order to be able to respond without significant delay to various exogenous signals. Since splicing is not required, very little time would elapse between transcription and accumulation of the mature mRNA in the cell.

3.2. Phylogenetic analysis of rice bean protease inhibitor

3.4. Overexpression of recombinant HIS6: RbTI in E. coli

The BBI protein sequences obtained from NCBI were used for multiple alignments in MEGA 6.0, and phylogenetic tree was constructed for further identifying the relationships between the BBI protein sequence and that of other species of Legumes (Fig. 6). Cereals were taken into account to analyze the evolutionary origin based on conserved sequence and structural characteristics such as amino acid homology and conserved motifs with protease inhibitors from Leguminaceae species. As shown in Fig. 4A, the BBI from Vigna umbellate and Vigna vexillata grouped together and revealed to have similar structures and features with the highest degree of similarity between them. The phylogenetic tree analysis revealed that the BBI domains from Leguminaceae family grouped together as the cereals and pseudocereals, while BBI of Bromiliaceae family was outgrouped with Setaria italica following the botanical systematic (Fig. 6). This reveals that during the course of evolution plant species conserved their BBI domain and the separation of species were compensated by incorporation of different sets of amino acids for adapting to particular physiological and environmental conditions during their evolution. Botanical systematic grouping of proteins and conservation of the structural features with a common evolutionary origin has been reported in several studies for example, Vigna radiata L. starch branching enzyme II (Ko et al., 2009), cowpea seed lipid transfer protein (Carvalhoa et al., 2006) showed the same trend.

The primers designed from 327 bp RbTI were used to amplify full length cDNA with overhang of CACC for directional cloning in pET 200 TOPO. The amplified fragment was eluted, cloned in vector and was used for transformation in E. coli BL21 star strain for overexpression of His6-RBTI protein. IPTG induction recombinant protein, His6-RbTI, in

3.3. Rice bean protease inhibitor is intronless To isolate the full length genomic counterpart of RbTI gene, the primer sets designed for full length cDNA amplification was used to amplify the corresponding fragment from genomic DNA. The amplified fragment of approx. 270 bp (Fig. 7) was further cloned and sequenced. The sequencing results from genomic DNA matched with the earlier results of cDNA amplification revealing that RbTI is intronless. Wang et al. (2008) have reported that the gene size and coding regions of BBI type inhibitors are small and generally devoid of introns. Gruden et al. (1997) have reported that the potato cysteine proteinase inhibitors (PCPIs) form a multigene family and their genes do not possess any introns. Similarly, potato genes that encode Kunitz-type proteinase inhibitors are also intronless (Ishikawa et al., 1994) as was also found for an

Fig. 8. A; SDS–PAGE gel showing induction of approx 13.0 kDa protein. B; the purification of His6–RbTI fusion protein. The maximum elution of protein was seen in 7th fraction of elute.


8


Fig. 9. Relative expression of RbTI inhibitor in rice bean. Leaves 1–4 were sampled after 20, 35, 50 and 65 days after sowing. Seeds 1–4 were sampled after 5, 25, 45 and 65 days after seed setting. With the maturity of seed the level of RbTI increases significantly.

E. coli containing pET200:His6-RBTI revealed approx. 13.0 kDa peptide fragment when analyzed on 12% SDS–PAGE (Fig. 8A). The fusion protein was purified from soluble fraction of bacterial lysate by single step chromatography on Ni-NTA resin (Invitrogen, USA). This expressed protein was purified to 89 fold with specific activity of 62.3. The SDS–PAGE further confirmed that with the MW of approx 13.0 kDa RBTI was the major species (Fig. 8B). The molecular weight of trypsin inhibitors and BBI of Vigna species has been reported to be from 10.0 to 16.0 kDa (Kuhar et al., 2013; Sammour, 2006). In the present study we noticed dimeric form of the RBTI in the purified fraction. The self-association to form dimer and anomalous behavior on SDS–PAGE resulting in a large overestimation of molecular weight has been reported for Bowman–Birk inhibitor from several legumes (Bergeron and Nielsen, 1993; Fields et al., 2012; Leite Nobrega de Moura et al., 2011; Muzard et al., 2012; Sessa and Wolf, 2001; Terada et al., 1994; Wu and Sessa, 1994). 3.5. Spatial and temporal expression of RbTI For studying the expression levels of rice bean BBI gene at different developmental stages of seed and foliage, the RT-PCR analysis was carried out using total RNA from foliage and immature seeds and 18s RNA gene as the reference gene. The highly variable expression of rice bean BBI gene was observed in leaves and seeds, as shown in Fig. 9. In the leaves at 20, 35, 50 and 65 DAS the expression level was very low with minimum difference in expression between these samples. A slight increase in RbTI expression in foliage at 35 DAS may be due to wounding, and pathological and environmental conditions at the time of collection of sample. Rakwal et al. (2001) studied similar pattern of proteinase inhibitor induction in plant leaves and reported active induction of PI to high levels when plants are attacked by insects, suffer mechanical damage or are exposed to exogenous phytohormones. Hilder et al. (1987) also reported that artificial wounding by heat or even

crushing with a file could mimic the action of an insect bite and stimulate the production of the inhibitor. The induction of PI upon wounding has also been reported from other plants. A rapid increase in proteinase inhibitor concentration in sweet potato leaves within 4 h of wounding and a constant level up to 16 h after wounding has also been reported by Sasikiran et al. (2002). The level of RbTI expression was significantly high in the seeds of rice bean and increases gradually with the maturity of the seeds and reached to a highest level at 65 DAS (Fig. 9). The increase in level of BBI could be coupled to the resistance or protection of seeds during the storage from various insect pests as these proteins have been reported to be inhibitory for insect–pest attack. Candido et al. (2011) reported the accumulation of PIs in seeds and tubers of plants in the form of storage proteins, carrying out important functions in the development of seeds and sprouts. It is known that by virtue of their capacity to inhibit enzymes, they can act as defense mechanisms against predators and pathogens. Expression analysis of this gene will provide fundamental information to facilitate their manipulation as a source of insect resistance in the development of transgenic plants. 3.6. Purification of the recombinant RbTI Recombinant RbTI was purified to apparent homogeneity with 89 fold purification 62.3 TIU inhibition activities (Table 2), using His-Trap column. 3.7. Inhibitory activity of rice bean protease inhibitor The expressed protein were isolated at 0, 1.5, 2.5, 3.5, 4.5 and 5.5 h after induction and quantified to be 0.122, 0.258, 0.278, 0.289, 0.328 and 0.342 mg/ml of extract, respectively. The equal volume of each extract of expressed protein (RBTI) was further tested for inhibitory activity against the larval gut proteases. RBTI strongly inhibited Hessian fly larval gut trypsin and chymotrypsin activities with variable levels of

Table 2 Purification of recombinant RBTI. Procedure

Total proteina (mg)

% inhibition

Specific activity TIU/A280

Yield (%)

Purification fold

Crude enzyme HisTrap column

35.77 2.40

77.70 92.4

0.7 62.3

100 607

1 89.0

One trypsin unit is defined as 1 μmol of substrate hydrolyzed per minute of reaction. One inhibition unit is defined as unit of enzyme inhibited. Specific activity is defined as inhibition units per absorbance unit, at 280 nm, of the inhibitor. TIU—trypsin inhibitory units; A280 — absorbance at 280 nm. a Total protein content was from the crude extract of a 200 ml batch of E. coli BL21 Star™(DE3) culture.



100 Trypsin

90

Chymotrypsin

Percent Inhibition

80 70 60 50 40 30 20 10 0

0.12

0.26 0.28 0.29 0.33 Protein concentration (mg/ml)

0.34

Fig. 10. Effect of RbTI on midgut trypsin and chymotrypsin activity of Hessian fly. Three replicates were maintained for each measurement.

inhibition. The highest trypsin-like (87.0%) and chymotrypsin-like (56.0%) inhibitory activities were observed when the assay was carried out with purified RBTI obtained after 5.5 h of induction in E. coli with protein concentration of 0.342 mg/ml (Fig 10). RBTI showed inhibitory activity against both trypsin and chymotrypsin, a characteristic feature of BBI type PIs. This inhibitory activity of RBTI was more pronounced against trypsin, when compared with chymotrypsin. Most of the BBIs were known to inhibit both trypsin and chymotrypsin due to the presence of two different reactive sites (Singh and Appu Rao, 2002). Our results provided a strong evidence for the effectiveness of RbTIs from rice bean against gut proteases of insects. 4. Conclusions In conclusion, for the first time we have successfully cloned, characterized and further expressed the full-length RbTI in the E. coli system. The highest expression of RbTI was observed in rice bean seeds nearing maturity, unraveling its role in resistance from storage insect pests. The expressed and purified RBTI strongly inhibited gut proteases of Hessian fly. The phylogenetic relationship of RbTI was established with deduced primary sequences. The predicted 3D structures of RBTI were obtained from features in N-terminal, central and C-terminal regions of protein. The novel RbTI gene has the potential for further molecular manipulation for the development of crops resistant to the insect pests. Conflict of interest statement The authors have declared no conflict of interest. Acknowledgments The authors are thankful to the Department of Biotechnology, Government of India for the financial assistance for the present study. References Altpeter, F., Diaz, I., McAuslan, H., Gaddour, K., Carbonero, P., Vasil, I.K., 1999. Increased insect resistance in transgenic wheat stably expressing trypsin inhibitor CMe. Mol. Breed. 5, 53–63. Armstrong, W.B., Taylor, T.H., Kennedy, A.R., Melrose, R.J., Messadi, D.V., Gu, M., Le, A.D., Perloff, M., Civantos, F., Goodwin, W.J., Wirth, L.J., Kerr, A.R., Meyskens Jr., F.L., 2013. Bowman–Birk inhibitor concentrate and oral leukoplakia: a randomized phase IIb trial. Cancer Prev. Res. 6, 410–418. Baldwin, I., Schultz, J., 1983. Rapid changes in tree leaf chemistry induced by damage: evidence for communication between plants. Science 22, 277–279.

9

Barli-Maganja, D., Strukelj, B., Pungercar, J., Gubensek, F., Turk, V., Kregar, I., 1992. Isolation and sequence analysis of the genomic DNA fragment encoding an aspartic proteinase inhibitor from potato (Solanum tuberosum L.). Plant Mol. Biol. 20, 311–313. Baumgartner, B., Chrispeels, M.J., 1997. Purification and characterization of vicilin peptidohydrolase, the major endopeptidase in the cotyledons of mung-bean seedlings. Eur. J. Biochem. 77, 223–233. Bergeron, D., Nielsen, S.S., 1993. Partial characterization of trypsin inhibitors and Nterminal sequences of five trypsin isoinhibitors of Great Northern beans (Phaseolus vulgaris). J. Agric. Food Chem. 41, 1544–1549. Bhattacharjee, C., Prasad, D.T., Manjunath, N.H., Sanyal, D., Zarga, S.M., 2012. Exploring plant proteinase inhibitors. Genomics Appl. Biol. 3, 8–21. Birk, Y., 1976. Proteinase inhibitors from plant sources. Methods Enzymol. 45, 695–739. Boulter, D., 1993. Insect pest control by copying nature using genetically engineered crops. Biochemistry 34, 1452–1466. Bradford, M.M., 1976. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Broadway, R.M., Duffey, S.S., 1986. The effect of dietary protein on the growth and digestive physiology of larval Heliothis zea and Spodoptera exigua. J. Insect Physiol. 32, 673–680. Candido, E.S., Pinto, M.F.S., Pelegrini, P.B., Lima, T.B., Silva, O.N., Pogue, R., Grossi-de-Sa, M.F., Franco, O.L., 2011. Plant storage proteins with antimicrobial activity: novel insights into plant defense mechanisms. 25. http://dx.doi.org/10.1096/fj.11-184291 (000–000). Carvalhoa, A.O., Souza-Filhob, G.A., Ferreirab, B.S., Brancob, A.T., Araujoc, I.S., Fernandesd, K.V.S., Retamale, C.A., Gomes, V.M., 2006. Cloning and characterization of a cowpea seed lipid transfer protein cDNA: expression analysis during seed development and under fungal and cold stresses in seedlings' tissues. Plant Physiol. Biochem. 44, 732–742. Chan, Y.S., Zhang, Y., Ng, T.B., 2013. Brown kidney bean bowman-birk trypsin inhibitor is heat and ph stable and exhibits anti-proliferative activity. Appl. Biochem. Biotechnol. 169, 1306–1314. Chang, S., Puryear, J., Cairney, J., 1993. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11, 113–116. Chenna, R.S., Hideaki, K.T., Lopez, R., Gibson, T.J., Higgins, D.G., Thompson, J.D., 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31, 3497–3500. Delano-Frier, J.P., Castro-Guillen, J.L., Blanco-Labra, A., 2008. Recent findings on the multifaceted functionality of enzyme inhibition by natural compounds: a review. Curr. Enzyme Inhib. 4, 121–152. D'Onofrio, M., Lee, M.D., Starr, C.M., Miller, M., Hanover, J.A., 1991. The gene encoding rat nuclear pore glycoprotein p62 is intronless. J. Biol. Chem. 266, 11980–11985. Drag, M., Salvesen, G.S., 2010. Emerging principles in protease-based drug discovery. Nat. Rev. 9, 690–701. Fan, S.G., Wu, G.J., 2005. Characteristics of plant proteinase inhibitors and their applications in combating phytophagous insects. Bot. Bull. Acad. Sin. 46, 273–292. Fields, C., Mallee, P., Muzard, J., Lee, G.U., 2012. Isolation of Bowman–Birk—inhibitor from soybean extracts using novel peptide probes and high gradient magnetic separation. Food Chem. 134, 1831–1838. Furstenberg-Hagg, J., Zagrobelny, M., Bak, Soren, 2013. Plant defense against insect herbivores. Int. J. Mol. Sci. 14, 10242–10297. Garcia-Gasca, T., Garcıa-Cruz, M., Hernandez-Rivera, E., Lopez-Matınez, J., CastanedaCuevas, A.L., Yllescas-Gasca, L., Rodrıguez-Mendez, A.J., Mendiola-Olaya, E., CastroGuillen, J.L., Blanco-Labra, A., 2012. Effects of tepary bean (Phaseolus acutifolius) protease inhibitor and semipure lectin fractions on cancer cells. Nutr. Cancer 64, 1269–1278. Ge, Z.Y., Wan, P.J., Li, G.Q., Xia, Y.G., Han, Z.J., 2014. Characterization of cysteine proteaselike genes in the striped rice stem borer, Chilo suppressalis. Genome 57, 79–88. Goldberg, R.B., Barker, S.J., Perez-Grau, L., 1989. Regulation of gene expression during plant embryogenesis. Cell 56, 149–160. Green, T.R., Ryan, C.A., 1972. Wound-induced proteinase inhibitor in plant leaves: a possible defense mechanism against insects. Science 175, 776–777. Grover Jr., P.B., Ross, D.R., Shukle, R.H., 1988. Identification of digestive carbohydrases in larvae of the Hessian fly, Mayetiola destructor (Say) (Diptera: Cecidomyiidae). Arch. Insect Biochem. Physiol. 8, 59–72. Gruden, K., Strukelj, B., Ravnikar, M., Poljsak-Prijatelj, M., Mavric, I., Brzin, J., Pungercar, J., Kregar, I., 1997. Potato cysteine proteinase inhibitor gene family: molecular cloning, characterisation and immunocytochemical localisation studies. Plant Mol. Biol. 34, 317–323. Heitz, T., Geoffroy, P., Fritig, B., Legrand, M., 1999. The PR-6 family: proteinase inhibitors in plant microbe and plant insect interactions. In: Datta, S.K., Muthukrishan, S. (Eds.), Pathogenesis — Related Proteins in Plants. CRC Press, Boca Raton, pp. 131–155. Hilder, V.A., Gatehouse, A.M.R., Sheerman, S.E., Barker, R.F., Boulter, D.A., 1987. Novel mechanism of insect resistance engineered into tobacco. Nature 300, 160–163. Hilder, V.A., Gatehouse, M.R., Boulter, D., 1993. Transgene plants conferring insect tolerance: protease inhibitor approach. Transgenic Plants 1, 317–338. Ishikawa, A., Ohta, S., Matsuoka, K., Hattori, T., Nakamura, K., 1994. A family of potato genes that encode Kunitz-type proteinase inhibitors: structural comparison and differential expression. Plant Cell Physiol. 35, 303–312. Katoch, R., 2013. Nutritional potential of rice bean (Vigna umbellata): an underutilized legume. J. Food Sci. 78 (1), C8–C16. Katoch, R., Thakur, N., 2013a. RNA interference: a promising technique for improvement of neglected crops. Int. J. Food Sci. Nutr. 64 (2), 248–259. Katoch, R., Thakur, N., 2013b. Advances in RNA interference technology and its impact on nutritional improvement, disease and insect control in plants. Appl. Biochem. Biotechnol. 169, 1589–1605. http://dx.doi.org/10.1007/s12010-012-0046-5.


10


Katoch, R., Sethi, A., Thakur, N., Murdock, L.L., 2013. RNAi for insect control: current perspective and future challenges. Appl. Biochem. Biotechnol. 169, 1579–1605. http://dx.doi.org/10.1007/s12010-012-0046-5. Ko, Y., Chung, C., Shih, Y., Chang, J., 2009. Cloning, characterization, and expression of mungbean (Vigna radiata L.) starch branching enzyme II cDNA in Escherichia coli. J. Agric. Food Chem. 57, 871–879. Kobayashi, H., 2013. Prevention of cancer and inflammation by soybean protease inhibitors. Front. Biosci. 5, 966–973. Koundal, K.R., Rajendran, P., 2003. Plant insecticidal proteins and their potential for developing transgenics resistant to insect pests. Indian J. Biotechnol. 2, 110–120. Kowalska, J., Pszczola, K., Wilimowska-Pelc, A., Lorenc-Kubis, I., Zuziak, E., Lugowski, M., Legowska, A., Kwiatkowska, A., Sleszynska, M., Lesner, A., Walewska, A., Zablotna, E., Rolka, K., Wilusz, T., 2007. Trypsin inhibitors from the garden four o'clock (Mirabilis jalapa) and spinach (Spinacia oleracea) seeds: isolation, characterization and chemical synthesis. Phytochemistry 68, 1487–1496. Kuhar, K., Kansal, R., Mishra, A., Koundal, K.R., Gupta, V.K., 2012. Cloning, characterization and expression analysis of a novel gene encoding Kunitz-type protease inhibitor from Dolichos biflorus. Biotech 3 (2), 199–209. Kuhar, K., Kansal, R., Subrahmanyam, B., Koundal, K.R., Miglani, K., Gupta, V.K., 2013. A Bowman–Birk protease inhibitor with antifeedant and antifungal activity from Dolichos biflorus. Acta Physiol. Plant. 35, 1887–1903. Laskowski, M., Kato, I., 1980. Protein inhibitors of proteinases. Annu. Rev. Biochem. 49, 593–626. Laskowski, M., Qasim, M.A., 2000. What can the structures of enzyme–inhibitor complexes tell us about the structures of the enzyme substrate complexes? Biochim. Biophys. Acta 1477, 324–337. Laskowski, M., Kato, I., Kohr, W.J., Park, S.J., Tashino, M., Whatley, H.S., 1988. Positive Darwinian selection in evolution of protein inhibitors of serine proteinases. Cold Spring Harb. Symp. Quant. Biol. 52, 545–553. Lepelley, M., Amor, M.B., Martineau, N., Cheminade, G., Caillet, V., McCarthy, J., 2012. Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination. BMC Plant Biol. 12, 31. Lingling, L., Lei, J., Song, M., Li, L., Cao, B., 2005. Study on transformation of cowpea trypsin inhibitor gene into cauliflower (Brassica oleracea L. var. botrytis). Afr. J. Biotechnol. 4, 45–49. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−delta delta C(T)) method. Methods 25, 402–408. Magee, P.J., Owusu-Apenten, R., McCann, M.J., Gill, C.I., Rowland, I.R., 2012. Chickpea (Cicer arietinum) and other plant-derived protease inhibitor concentrates inhibit breast and prostate cancer cell proliferation in vitro. Nutr. Cancer 64, 741–748. Mittapalli, O., Neal, J.J., Shukle, R.H., 2005. Differential expression of two cytochrome P450 genes in compatible and incompatible Hessian fly/wheat interactions. Insect Biochem. Mol. Biol. 35, 981–989. Mourao, C.B.F., Schwartz, E.F., 2013. Protease inhibitors from marine venomous animals and their counterparts in terrestrial venomous animals. Mar. Drugs 11, 2069–2112. Murray, M.G., Thompson, W.F., 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, 4321–4325. Muzard, J., Fields, C., O'Mahony, J.J., Lee, G.U., 2012. Probing the soybean Bowman–Birk inhibitor using recombinant antibody fragments. J. Agric. Food Chem. 60, 6164–6172. Leite Nobrega de Moura, J.M., Hernandez-Ledesma, B., de Almeida, N.M., Hsieh, C.C., de Lumen, B.O., Johnson, L.A., 2011. Lunasin and Bowman–Birk protease inhibitor concentrations of protein extracts from enzyme-assisted aqueous extraction of soybeans. J. Agric. Food Chem. 59, 6940–6946. Peyachoknagul, S., Matsui, T., Shibata, H., Hara, S., Ikenaka, T., Okada, Y., Ohno, T., 1989. Sequence and expression of the mRNA encoding the chymotrypsin inhibitor in winged bean (Psophocarpus tetragonolobus (L.) DC.). Plant Mol. Biol. 12, 51–58. Pujol, M., Hernandez, C.A., Armas, R., Coll, Y., Alfonso-Rubi, J., Perez, M., et al., 2005. Inhibition of Heliothis virescens larvae growth in transgenic tobacco plants expressing cowpea trypsin inhibitor. Biotechnol. Appl. Biochem. 22, 127–130. Qu, L.J., Chen, J., Liu, M.H., Pan, N.S., Okamoto, H., Lin, Z.Z., et al., 2003. Molecular cloning and functional analysis of a novel type of Bowman–Birk inhibitor gene family in rice. Plant Physiol. 133, 560–570.

Quilis, J., Meynard, D., Vila, L., Aviles, F.X., Guiderdoni, E., Segundo, B.S., 2007. A potato carboxypeptidase inhibitor gene provides pathogen resistance in transgenic rice. Plant Biotechnol. J. 5, 537–553. Rakwal, R., Agrawal, G.K., Jwa, N.S., 2001. Characterization of a rice (Oryza sativa L.) Bowman–Birk proteinase inhibitor: tightly light regulated induction in response to cut, jasmonic acid, ethylene and protein phosphatase 2A inhibitors. Gene 63, 189–198. Richardson, M., 1991. Seed storage proteins: the enzyme inhibitors. In: Dey, P.M., Harborne, J.B. (Eds.), Methods in Plant Biochemistry. Academic Press, New York, pp. 259–305. Ryan, C.A., 1990. Protease inhibitors in plants: genes for improving defenses against insects and pathogens. Annu. Rev. Phytopathol. 28, 425–449. Safavi, F., Rostami, A., 2012. Role of serine proteases in inflammation: Bowman–Birk protease inhibitor (BBI) as a potential therapy for autoimmune diseases. Exp. Mol. Pathol. 93, 428–433. Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual. 3. Cold Spring Harbor Laboratory Press, New York. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sammour, R.H.A., 2006. Isolation and characterization of four isoinhibitors from cowpea (Vigna unguiculata (L.) Walp.) seeds. Turk. J. Biol. 30, 207–215. Sasikiran, K., Rekha, M.R., Padmaja, G., 2002. Proteinase and alphaamylase inhibitors of sweet potato: changes during growth phase, sprouting, and wound induced alterations. Bot. Bull. Acad Sin. 43, 291–298. Sessa, D.J., Wolf, W.J., 2001. Bowman–Birk inhibitors in soybean seed coats. Ind. Crops Prod. 14, 73–83. Shen, A., 2010. Allosteric regulation of protease activity by small molecules. Mol. Biosyst. 6, 1431–1443. Singh, R.R., Appu Rao, A.G., 2002. Reductive unfolding and oxidative refolding of a Bowman–Birk inhibitor from horsegram seeds (Dolichos biflorus): evidence for ‘hyperreactive’ disulfide bonds and rate-limiting nature of disulfide isomerization in folding. Biochim. Biophys. Acta 1597, 280–291. Smigocki, A.C., Ivic-Haymes, S., Li, H., Savic, J., 2013. Pest protection conferred by a Beta vulgaris serine proteinase inhibitor gene. PLoS One 8, e57303. Souza, L.daC., Camargo, R., Demasi, M., Santana, J.M., de Sa, C.M., de Freitas, S.M., 2014. Effects of an anticarcinogenic Bowman–Birk protease inhibitor on purified 20s proteasome and mcf-7 breast cancer cells. PLoS One 9, e86600. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 30, 2725–2729. Terada, S., Fujimura, S., Kino, S., Kimoto, E., 1994. Purification and characterization of three proteinase inhibitors from Canavalia lineata seeds. Biosci. Biotechnol. Biochem. 58, 371–375. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Turk, B., 2006. Targeting proteases: successes, failures and future prospects. Nat. Rev. Drug Discov. 5, 785–799. Valueva, T.A., Speranskaya, A.S., Revina, T.A., Shevelev, A.B., 2008. Molecular cloning and expression of genes of Kunitz-type C protease inhibitors from potato. Russ. J. Bioorg. Chem. 34, 310–317. Voss, R., Ermler, U., Essen, L., Wenzl, G., Kim, Y., Flecker, P., 1996. Crystal structure of the bifunctional soybean Bowman–Birk inhibitor at 0.28-nm resolution. Eur. J. Biochem. 242, 122–131. Wang, Y.P., Chen, X.T., Qiu, L.J., 2008. Novel alleles among soybean Bowman–Birk proteinase inhibitor gene families. Sci. China C Life Sci. 51, 687–692. William Jr., W.N., Papadimitrakopoulou, V.A., 2013. Optimizing biomarkers and endpoints in oral cancer chemoprevention trials. Cancer Prev. Res. 6, 375–378. Wu, Y.V., Sessa, D.J., 1994. Conformation of Bowman–Birk inhibitor. J. Agric. Food Chem. 42, 2136–2138. Zhu, C., Luo, N., He, M., Chen, G., Zhu, J., Yin, G., Li, X., Hu, Y., Li, J., Yan, Y., 2014. Molecular characterization and expression profiling of the protein disulfide isomerise gene family in Brachypodium distachyon L. PLoS One 9, e94704.


Structural characterization and expression analysis of a novel cysteine protease inhibitor from Haliotis discus hannai Ino.

Cloning, expression, and characterization of a gene encoding the human angiotensin II type 1A receptor.

Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

Molecular cloning, characterization and expression of a gene encoding phosphoketolase from Termitomyces clypeatus.

Characterization of a novel aspartyl protease inhibitor from Haemonchus contortus.

Cloning and expression analysis of the gene encoding fibrinogen-like protein A, a novel regeneration-related protein from Apostichopus japonicus.

Cloning and characteristic analysis of a novel aspartic protease gene Asp55 from Trichoderma asperellum ACCC30536.

Cloning, sequencing and expression of the gene encoding the extracellular neutral protease, vibriolysin, of Vibrio proteolyticus.

Molecular cloning and characterization of a novel SK3-type dehydrin gene from Stipa purpurea.

Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici.

Cloning, characterization, and heterologous expression of a novel glucosyltransferase gene from sophorolipid-producing Candida bombicola.

Cloning, sequence analysis, and expression of the structural gene encoding glucose-fructose oxidoreductase from Zymomonas mobilis.

Cloning, expression analysis and recombinant expression of a gene encoding a polygalacturonase-inhibiting protein from tobacco, Nicotiana tabacum.

Cloning and selective overexpression of an alkaline protease-encoding gene from Aspergillus oryzae.

Molecular cloning, characterization and expression analysis of a novel PDRG1 gene from black tiger shrimp (Penaeus monodon).

Cloning, sequencing, expression, and characterization of thermostability of oligopeptidase B from Serratia proteamaculans, a novel psychrophilic protease.

Cloning and characterization of a gene from Bacillus stearothermophilus var. non-diastaticus encoding a glycerol dehydrogenase.

Cloning, expression and characterization of a cDNA encoding a lipase from Rhizopus delemar.

Cloning and characterization of the gene encoding rabbit cardiac calsequestrin.

Cloning, expression, and characterization of a minor alkaline protease from Bacillus sp. no. AH-101.

Molecular cloning, expression, and anti-tumor activity of a novel serine protease from Arenicola cristata.

Cloning and characterization of a gene encoding extracellular metalloprotease from Streptomyces lividans.

RAmy2A; a novel alpha-amylase-encoding gene in rice.

Cloning, expression, and sequencing of a protease gene (tpr) from Porphyromonas gingivalis W83 in Escherichia coli.