J Pediatr Endocrinol Metab 2015; 28(9-10): 1187–1190
Patient report Eli Hershkovitz*, Maram Arafat, Neta Loewenthal, Alon Haim and Ruti Parvari
Combined adrenal failure and testicular adrenal rest tumor in a patient with nicotinamide nucleotide transhydrogenase deficiency Abstract Objective: The nicotinamide nucleotide transhydrogenase (NNT) enzyme is the main generator of nicotinamide adenine dinucleotide phosphate-oxidase in the mitochondrion. Mutations of the NNT gene have been recently implicated in familial glucocorticoid deficiency. We describe the long-term clinical course of a NNT-deficient 20-year-old patient with combined adrenal failure who had developed a testicular adrenal rest tumor and precocious puberty. Methods: The patient’s medical records were reviewed. Whole-exome sequencing was performed on DNA obtained from the patient and family members. Results: The patient experienced Addisonian crisis at 10 months of age. Enlarged testicular volume and precocious puberty, accompanied by increased testosterone levels, were noted at 6 years. Testicular biopsy revealed a adrenal rest tumor, which regressed after intensification of glucocorticoid treatment. Genetic studies disclosed a c.1163A > C, p.Tyr388Ser substitution on the NNT gene. This mutation is predicted to be damaging to NNT function. Conclusion: We demonstrated for the first time that the clinical spectrum of NNT deficiency may consist of mineralocorticoid deficiency and testicular involvement as well.
*Corresponding author: Eli Hershkovitz, MD, Pediatric Endocrinology Unit, Soroka Medical Center and Faculty of Health Sciences, Ben-Gurion University of the Negev, P.O.B. 151, 84101, Beer Sheva, Israel, Phone: +972 86403517, Fax: +972 732049362, E-mail: [email protected] Maram Arafat and Ruti Parvari: Shraga Segal Department of Microbiology, Immunology and Genetics, Faculty of Health Sciences, and National Institute for Biotechnology in the Negev, Ben-Gurion University of the Negev, Beer Sheva, Israel Neta Loewenthal and Alon Haim: Pediatric Endocrinology Unit, Soroka Medical Center and Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer Sheva, Israel
Keywords: ACTH resistance; adrenal disease; adrenal gland insufficiency; adrenal rest tissue; NNT deficiency. DOI 10.1515/jpem-2015-0075 Received February 9, 2015; accepted February 26, 2015; previously published online April 16, 2015
Introduction The nicotinamide nucleotide transhydrogenase (NNT) enzyme resides in the inner membrane of the mitochondrion. NNT uses energy from the mitochondrial proton gradient to regenerate nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) from NADPC, using NADH produced in the tricarboxylic acid cycle, and it is most probably the major source of NADPH in the mitochondrion and of reduced glutathione. As the main generator of NADPH in the mitochondrion, NNT plays an important role in reactive oxygen species (ROS) detoxification as it couples the production of NADPH to the rate of mitochondrial metabolism and the production of ROS generated by the electron transport chain. (1). Mutations of the NNT gene have been recently implicated in familial glucocorticoid deficiency (2, 3). In the present study, we describe the long-term clinical course of a NNT-deficient 20-year-old patient with combined adrenal failure who had developed testicular adrenal rest tumor and precocious puberty.
Subjects and methods The patient has been followed since early childhood at the pediatric endocrinology unit at Soroka Medical Center. His subsequent clinical course, obtained after careful reviewing of his medical records, will be described in the Results section. The patient and his family members gave their informed c onsent for the genetic analysis.
Brought to you by | Florida International University Libraries Authenticated Download Date | 9/29/15 3:43 PM
1188 Hershkovitz et al.: NNT deficiency and combined adrenal failure Endocrine studies Serum was analyzed for cortisol, 17OHP, testosterone, dehydroepiandrosterone sulfate (DHEAS), luteinizing hormone (LH) and folliclestimulating hormone (FSH) by specific radioimmunoassays.
Genetic studies DNA was extracted from peripheral blood. Genotyping was performed using the CytoScan 750K array (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s protocol and analyzed with the respective Affymetrix dedicated software [Chromosome Analysis Suite (ChAS) 2.0]. The DNA was submitted to Otogenetics Corporation (Norcross, GA, USA) for exome capture and sequencing. Illumina libraries were made from qualified fragmented DNA using NEBNext reagents (New England Biolabs, Ipswich, MA, USA; catalog no. E6040), and the resulting libraries were subjected to exome enrichment using the NimbleGen SeqCap EZ Human Exome Library v. 2.0 (Roche NimbleGen, Inc., Madison, WI, USA; catalog no. 05860482001). The samples were then sequenced on an Illumina HiSeq2000 instrument (San Diego, CA, USA), which generated paired-end reads of 90 or 100 nucleotides (nt). Data were analyzed for data quality, exome coverage, and exome-wide SNP/InDel using the platform provided by DNAnexus (DNAnexus, Inc., Mountain View, CA, USA). The analysis of the NNT mutation was done by polymerase chain reaction (PCR) amplification using the following primers: F: TGAAACCACTAAGCCAGGAG and R: TCCGTTTTTCAAAAGGAGTG; annealing temperature 55°C. The PCR product was incubated at 37°C for half an hour with 0.8 μL of ExoSap (5 U of exonuclease and 0.5 U of shrimp alkaline phosphatase; both from Fermentas, a division of Thermo Fisher Scientific, Pittsburgh, PA, USA) and sequenced on an ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
Results
hyponatremia (117 mEq/L; normal range: 135–145 mEq/L) and hyperkalemia (7.8 mEq/L; normal range: 3.5–5.5 mEq/L) with significant urinary sodium excretion (UNa; 92.6 mEq/L; expected value during dehydration 97th centile) with significant bone age advancement (9 years), as was testicular volume enlargement (6 mL), which was bilaterally accompanied by penile growth and the appearance of pubic hair. Serum testosterone levels were in the pubertal range (6.25 nmol/L). Basal gonadotropin level was 0.1 and 0.6 mIU/mL for LH and FSH, respectively. GnRH test revealed partial gonadotropin response (peak LH 2.7 mIU/mL). Testicular biopsy revealed Leydig cell tumor/adrenal rest tumor (Figure 1). Abdominal computed tomography scan showed normal-sized adrenal glands. During an inhospital stay, a strictly supervised steroid withdrawal under intravenous fluid administration for several hours in order to reevaluate the patient-specific
Patient description The patient, a male infant, was born at term after an uneventful pregnancy to first-degree Caucasian Jewish parents, who had previously, while living abroad, lost two of their children at 3 and 4 months of age due to a short illness defined as “gastroenteritis.” The patient’s birth weight was 2600 g. Physical examination result was normal, except for penile hypospadias. G6PD deficiency was diagnosed at the nursery room, but it had no neonatal or later effect on the patient. The patient was diagnosed by a pediatrician. At 10 months of age, he was hospitalized in another hospital because of apathy, vomiting and dehydration. Clinical evaluation revealed low blood pressure (73/20) and bilateral pneumonia with pleural effusion. Severe
Figure 1: Leydig cell tumor in testicular biopsy (hematoxylin and eosin staining, original magnification × 200). Testicular biopsy of the patient’s left testis performed at 6 years of age revealed abundant cells with eosinophilic cytoplasm and round nuclei containing clear nucleoli, which are typical for Leydig cells.
Brought to you by | Florida International University Libraries Authenticated Download Date | 9/29/15 3:43 PM
Hershkovitz et al.: NNT deficiency and combined adrenal failure 1189 Table 1: Basal and post-ACTH stimulation levels of plasma steroids. Time, min
Cortisol, nmol/L
17-OH pregnenolone, nmol/L
17-OH progesterone, nmol/L
DHEA, nmol/L
DHEAS, μmol/L
11-Deoxycortisol, nmol/L
Androstenedione, nmol/L
0 30 60 Reference basal values
Patient report Eli Hershkovitz*, Maram Arafat, Neta Loewenthal, Alon Haim and Ruti Parvari
Combined adrenal failure and testicular adrenal rest tumor in a patient with nicotinamide nucleotide transhydrogenase deficiency Abstract Objective: The nicotinamide nucleotide transhydrogenase (NNT) enzyme is the main generator of nicotinamide adenine dinucleotide phosphate-oxidase in the mitochondrion. Mutations of the NNT gene have been recently implicated in familial glucocorticoid deficiency. We describe the long-term clinical course of a NNT-deficient 20-year-old patient with combined adrenal failure who had developed a testicular adrenal rest tumor and precocious puberty. Methods: The patient’s medical records were reviewed. Whole-exome sequencing was performed on DNA obtained from the patient and family members. Results: The patient experienced Addisonian crisis at 10 months of age. Enlarged testicular volume and precocious puberty, accompanied by increased testosterone levels, were noted at 6 years. Testicular biopsy revealed a adrenal rest tumor, which regressed after intensification of glucocorticoid treatment. Genetic studies disclosed a c.1163A > C, p.Tyr388Ser substitution on the NNT gene. This mutation is predicted to be damaging to NNT function. Conclusion: We demonstrated for the first time that the clinical spectrum of NNT deficiency may consist of mineralocorticoid deficiency and testicular involvement as well.
*Corresponding author: Eli Hershkovitz, MD, Pediatric Endocrinology Unit, Soroka Medical Center and Faculty of Health Sciences, Ben-Gurion University of the Negev, P.O.B. 151, 84101, Beer Sheva, Israel, Phone: +972 86403517, Fax: +972 732049362, E-mail: [email protected] Maram Arafat and Ruti Parvari: Shraga Segal Department of Microbiology, Immunology and Genetics, Faculty of Health Sciences, and National Institute for Biotechnology in the Negev, Ben-Gurion University of the Negev, Beer Sheva, Israel Neta Loewenthal and Alon Haim: Pediatric Endocrinology Unit, Soroka Medical Center and Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer Sheva, Israel
Keywords: ACTH resistance; adrenal disease; adrenal gland insufficiency; adrenal rest tissue; NNT deficiency. DOI 10.1515/jpem-2015-0075 Received February 9, 2015; accepted February 26, 2015; previously published online April 16, 2015
Introduction The nicotinamide nucleotide transhydrogenase (NNT) enzyme resides in the inner membrane of the mitochondrion. NNT uses energy from the mitochondrial proton gradient to regenerate nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) from NADPC, using NADH produced in the tricarboxylic acid cycle, and it is most probably the major source of NADPH in the mitochondrion and of reduced glutathione. As the main generator of NADPH in the mitochondrion, NNT plays an important role in reactive oxygen species (ROS) detoxification as it couples the production of NADPH to the rate of mitochondrial metabolism and the production of ROS generated by the electron transport chain. (1). Mutations of the NNT gene have been recently implicated in familial glucocorticoid deficiency (2, 3). In the present study, we describe the long-term clinical course of a NNT-deficient 20-year-old patient with combined adrenal failure who had developed testicular adrenal rest tumor and precocious puberty.
Subjects and methods The patient has been followed since early childhood at the pediatric endocrinology unit at Soroka Medical Center. His subsequent clinical course, obtained after careful reviewing of his medical records, will be described in the Results section. The patient and his family members gave their informed c onsent for the genetic analysis.
Brought to you by | Florida International University Libraries Authenticated Download Date | 9/29/15 3:43 PM
1188 Hershkovitz et al.: NNT deficiency and combined adrenal failure Endocrine studies Serum was analyzed for cortisol, 17OHP, testosterone, dehydroepiandrosterone sulfate (DHEAS), luteinizing hormone (LH) and folliclestimulating hormone (FSH) by specific radioimmunoassays.
Genetic studies DNA was extracted from peripheral blood. Genotyping was performed using the CytoScan 750K array (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s protocol and analyzed with the respective Affymetrix dedicated software [Chromosome Analysis Suite (ChAS) 2.0]. The DNA was submitted to Otogenetics Corporation (Norcross, GA, USA) for exome capture and sequencing. Illumina libraries were made from qualified fragmented DNA using NEBNext reagents (New England Biolabs, Ipswich, MA, USA; catalog no. E6040), and the resulting libraries were subjected to exome enrichment using the NimbleGen SeqCap EZ Human Exome Library v. 2.0 (Roche NimbleGen, Inc., Madison, WI, USA; catalog no. 05860482001). The samples were then sequenced on an Illumina HiSeq2000 instrument (San Diego, CA, USA), which generated paired-end reads of 90 or 100 nucleotides (nt). Data were analyzed for data quality, exome coverage, and exome-wide SNP/InDel using the platform provided by DNAnexus (DNAnexus, Inc., Mountain View, CA, USA). The analysis of the NNT mutation was done by polymerase chain reaction (PCR) amplification using the following primers: F: TGAAACCACTAAGCCAGGAG and R: TCCGTTTTTCAAAAGGAGTG; annealing temperature 55°C. The PCR product was incubated at 37°C for half an hour with 0.8 μL of ExoSap (5 U of exonuclease and 0.5 U of shrimp alkaline phosphatase; both from Fermentas, a division of Thermo Fisher Scientific, Pittsburgh, PA, USA) and sequenced on an ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
Results
hyponatremia (117 mEq/L; normal range: 135–145 mEq/L) and hyperkalemia (7.8 mEq/L; normal range: 3.5–5.5 mEq/L) with significant urinary sodium excretion (UNa; 92.6 mEq/L; expected value during dehydration 97th centile) with significant bone age advancement (9 years), as was testicular volume enlargement (6 mL), which was bilaterally accompanied by penile growth and the appearance of pubic hair. Serum testosterone levels were in the pubertal range (6.25 nmol/L). Basal gonadotropin level was 0.1 and 0.6 mIU/mL for LH and FSH, respectively. GnRH test revealed partial gonadotropin response (peak LH 2.7 mIU/mL). Testicular biopsy revealed Leydig cell tumor/adrenal rest tumor (Figure 1). Abdominal computed tomography scan showed normal-sized adrenal glands. During an inhospital stay, a strictly supervised steroid withdrawal under intravenous fluid administration for several hours in order to reevaluate the patient-specific
Patient description The patient, a male infant, was born at term after an uneventful pregnancy to first-degree Caucasian Jewish parents, who had previously, while living abroad, lost two of their children at 3 and 4 months of age due to a short illness defined as “gastroenteritis.” The patient’s birth weight was 2600 g. Physical examination result was normal, except for penile hypospadias. G6PD deficiency was diagnosed at the nursery room, but it had no neonatal or later effect on the patient. The patient was diagnosed by a pediatrician. At 10 months of age, he was hospitalized in another hospital because of apathy, vomiting and dehydration. Clinical evaluation revealed low blood pressure (73/20) and bilateral pneumonia with pleural effusion. Severe
Figure 1: Leydig cell tumor in testicular biopsy (hematoxylin and eosin staining, original magnification × 200). Testicular biopsy of the patient’s left testis performed at 6 years of age revealed abundant cells with eosinophilic cytoplasm and round nuclei containing clear nucleoli, which are typical for Leydig cells.
Brought to you by | Florida International University Libraries Authenticated Download Date | 9/29/15 3:43 PM
Hershkovitz et al.: NNT deficiency and combined adrenal failure 1189 Table 1: Basal and post-ACTH stimulation levels of plasma steroids. Time, min
Cortisol, nmol/L
17-OH pregnenolone, nmol/L
17-OH progesterone, nmol/L
DHEA, nmol/L
DHEAS, μmol/L
11-Deoxycortisol, nmol/L
Androstenedione, nmol/L
0 30 60 Reference basal values
