Transplant Immunology 30 (2014) 46–51
Contents lists available at ScienceDirect
Transplant Immunology journal homepage: www.elsevier.com/locate/trim
Combined analysis of cytokine gene polymorphism and the level of expression with allograft function in kidney transplant recipients Mohammad Hossein Karimi a, Sara Hejr a, Bita Geramizadeh a, Ramin Yaghobi a, Mohammad Mehdi Sagheb a, Eskandar Kamali-sarvestani b,c,⁎ a b c
Transplant Research Center, Shiraz University of Medical Sciences, Shiraz, Iran Autoimmune Diseases Research Center, Shiraz University of Medical Sciences, Shiraz, Iran Department of Immunology, Shiraz University of Medical Sciences, Shiraz, Iran
a r t i c l e
i n f o
Article history: Received 3 July 2013 Received in revised form 12 September 2013 Accepted 13 September 2013 Keywords: IL-17 IL-23R Kidney allograft Polymorphism
a b s t r a c t Cytokines are important factors determining the outcome of transplantation since host ability in cytokine production may be affected by cytokine gene polymorphisms. The aim of the present study was to investigate the effect of IL-17, IL-23R and IL-21 gene polymorphisms in the outcome of kidney transplantation. A total of 250 kidney transplant recipients were included in this study. Overall 70 recipients (28%) experienced an acute rejection. IL-17 197 A/G, IL-21 + 1472 G/T, IL-21 5250 C/T, and IL-23R C/T gene polymorphisms were evaluated by PCR-RFLP or ARMS-PCR methods. The serum levels of IL-17 and IL-21 were also checked by ELISA. IL-17 GG carriers and G allele were significantly more frequent in patients with acute rejection as compared to patients without any sign of rejection (P = 0.045 and P = 0.032, respectively). In addition after gender classification, IL-23R AA carriers and A allele were significantly more frequent in male patients who experienced an acute rejection as compared to non-rejected patients (P = 0.03, P = 0.011, respectively). The IL-17 serum levels have also shown significant differences between rejected and non-rejected groups (24.37 ± 32.94 for AR and 8.6 ± 9.9 for non-AR groups, respectively; P = 0.035). The mentioned results indicate that IL-17GG genotype, G allele and its serum level have predictive values for acute rejection. GG genotype and G allele of IL-17 is a genetic risk factor for development of acute rejection. Also, AA genotype and A allele of IL-23R is a sex dependent genetic risk factor for the development of acute rejection, but this subject needs to be studied in a different population. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Successful clinical transplantation depends, in part, upon the immune process that mediates rejection of the transplanted organ. Allograft rejection is a complex phenomenon involving interactions between multiple cell types and a complex variety of factors [1]. In this process, T cells play a major role in recognizing the alloantigen in the context of the MHC molecule associated with the donor organ. Naive T cells under different cytokine milieu differentiate to various subtypes. Th1 cells produce IFN-γ whereas Th2 cells produce IL-4, IL-5 and IL-13 [1,2]. In transplantation models, Th1 cytokine profile often associates with allograft rejection, while Th2 profile favors the acquisition of tolerance and stable graft survival [3,4]. More recently, Th17 cells are described as a novel subset of Th cells that are characterized by producing IL-17 [5–7]. In humans the majority of studies have found a central role for IL-21 and IL-23 in directing Th17 cell development [8,9]. In addition, strong genetic evidence has linked IL-23 requirement ⁎ Corresponding author at: Auto immune Diseases Research Center, Shiraz University of Medical Sciences, Iran. Fax: +98 7112304069. E-mail address: [email protected] (E. Kamali-sarvestani). 0966-3274/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.trim.2013.09.006
to the development of Th17-associated diseases [10]. Th17 cells have been linked to many immune/autoimmune related diseases [11–14] as well as allograft rejection [15]. In fact, recent studies have shown the prominent role of Th17 cells in the development of acute renal allograft rejection. It has been shown that IL-17 can be considered as an early diagnostic marker of acute renal allograft rejection in mice [16]. Interestingly, human endothelial cells that are the first target in graft rejection following kidney transplantation, selectively amplified proinflammatory Th17 cells [17]. In addition, a correlation between shorter graft survival and the presence of intragraft Th17 cells that produce IL17 and IL-21 was also observed in human renal grafts with terminal failure [18]. It is also worth to mention that both mycophenolic acid and tacrolimus decreased Th17-related transcripts after T-cell activation and therefore, treatment combining mycophenolic acid and tacrolimus might confer optimal allograft immunoprotection by inhibition of Th17 cell activation [19]. Given the importance of Th17 cells and their related cytokines in the rejection of kidney transplants, genetic variations in the genes of IL-17 and IL-21 and IL-23R may play a significant role in the outcome of renal transplantation. IL-17, IL-21 and IL-23R genes are located on chromosomes 6p12, 4q26, and 1p31.3, respectively. A functional G-to-A transition at position −197 in the promoter
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
region of IL-17 gene (rs2275913) has been studied extensively [20,21] and it has been shown that healthy individuals possessing the −197A allele produced significantly more IL-17 than those without the −197A allele [21]. The association of this polymorphism with susceptibility to ulcerative colitis [22] and acute graft-versus-host disease after unrelated bone marrow transplantation [21] have also been reported. Among different polymorphisms in the IL-21 gene, the IL-21 + 1472 G/T polymorphism (rs2055979) which is located in intronic region and a synonymous substitution at position + 5250 of IL-21 gene (rs4833837) which is located exon 3 are remarkable. The association of IL-21 + 1472 G/T polymorphism with systemic lupus erythematosus [23] and recurrent idiopathic spontaneous miscarriage have been reported [24]. The polymorphism within the IL-23R gene (rs10889677) by changing the 3′-UTR region of mRNA molecule induces loss of microRNA regulation and enhanced protein production [25]. The IL-23R polymorphism was found to be associated with different diseases [26,25], as well as kidney transplant outcomes [27]. Considering the importance of Th17 and its related cytokines in the renal transplant outcome, the aim of the present study is to investigate the association of single nucleotide polymorphisms in the genes of IL-17, IL-21 and IL-23R as well as the serum levels of the above mentioned cytokines with allograft function in kidney transplant recipients. 2. Material and methods 2.1. Patients A total of 250 kidney transplant recipient patients who underwent surgery at the Namazi Hospital, Shiraz, Iran, were consecutively recruited from 2007 to 2011. Their ages ranged from 7 to 79 years. Also, nonrejected transplant patients were considered as the control group. All of the patients were Iranian and had transplant operations at the Transplant Center of Namazi Hospital which is affiliated to the Shiraz University of Medical Sciences. The study was approved by the Ethics Committee of Shiraz University of Medical Sciences. In kidney transplant recipients, we investigated the graft outcome and acute rejection episode(s) for at least 3 months. Donors were selected on the basis of ABO blood group compatibility and all of them were negative for cross matches. In this study, the patients were divided into two groups according to the presence (AR group) or absence (non-AR group) of acute rejection episodes. Rejection episodes were identified by an expert nephrology team based on the approved clinical diagnostic criteria and were invariably confirmed by needle biopsy as well as elevated serum creatinine and blood urea nitrogen levels [28]. The standard immunosuppressive regimen for all 250 recipients included cyclosporine (5 mg/kg initially, then a maintenance dose of 2 to 2.5 mg/kg; cyclosporine level was 50 to 150 ng/mL), prednisolone (120 mg/day initially, tapering to 10 mg/day), and mycophenolate mofetil (1000 mg twice daily). HLA typing is routine in our center.
47
2.2. DNA extraction The Buffy coat of the whole blood from renal transplanted patients was available in the sample bank affiliated to Shiraz Transplant Research Center. Genomic DNA was extracted from Buffy coat, using a QIAamp DNA mini kit (Qiagen, Germany) according to the manufacturer's instructions. 2.3. Genotyping analysis Cytokine gene polymorphisms were evaluated by polymerase chain reaction using a thermal cycler (Techne, Genius, UK). PCR conditions, PCR cycles and primers are summarized in Tables 1 and 2. We optimized an in-house-ARMS-PCR method for IL-23R and IL-21C5250T in 10 μL reaction mixture. A beta globin gene primer was used as an internal control. An in-house PCR-RFLP was optimized for determining the IL-17 and IL-21 G1472T gene polymorphism. The PCR products were digested by Xag1 and NlaIII (Fermentas, Lithuania) restriction enzymes and the amplified products were monitored by agarose gel electrophoresis and ethidium bromide staining. 2.4. ELISA The case group consists of 22 patients with acute rejection. The control group consists of 22 patients without rejection. The normal population consists of 25 cases. All samples were taken in the first week after transplantation before corticoid treatments. Plasma samples were isolated immediately and then stored at −80 °C until use. ELISA was performed according to the manufacturer's instructions (eBioscience, USA). 2.5. Statistical analysis Allele and genotype frequencies were calculated in patient and control subjects by direct gene counting. Statistical evaluation was carried out using the Statistical Package for the Social Sciences (SPSS) version 16. The frequencies of the alleles/genotypes were compared in cases and controls by chi-square test, Fisher's exact test. Odds ratios and 95% confidence intervals (CIs) for relative risks were calculated. A probability value of P b 0.05 was considered as statistically significant and all the reported P-values were two-tailed. LD2SNPing program V 2.0 (http://www.bio.kuas.edu.tw/LD2SNPing) was used to estimate linkage disequilibrium (LD) and Hardy–Weinberg was evaluated using Arlequin V311. 3. Results 3.1. Profile of patients Among 250 consecutive recipients, 60% were male (aged from 7 to 65 years) and 40% were female (aged from 1 to 79 years). The mean age of the patients who had normal
Table 1 The primers, types of PCR and product sizes for the IL-17, IL-21, IL-23R, and internal control. Locus
Primers
Method
Product sizes
IL-17 (G-197A) (rs2275913)
Forward primer: 5′GCAGCTCTGCTCAGCTTCTAA3′ Reverse primer: 5′TTCAGGGGTGACACCATTTT3′
PCR-RFLP
IL-21 (G1472T) (rs2055979)
Forward primer: 5′GCTCTGAACCCAAACACTCTC3′ Reverse primer: 5′ACAGCCAGGAAACTCTGGAA3′
PCR-RFLP
IL-21(A5250G) (rs4833837)
Forward primer: 5′TTAGTTGGGCCTTCTGAAAG3′ Reverse primer: 5′TTAGTTGGGCCTTCTGAAAA3′ Common: 5′TGTAATGCACGACATTGCAG3′ Forward primer: 5′TTTTAGCCATTCTTCTGCCTC3′ Reverse primer: 5′TTTTAGCCATTCTTCTGCCTA3′ Common: 5′CGCCTGGCCTAATGATTCTA3′ Forward: 5′ACACAACTGTGTTCACTAGC3′ Reverse: 5′CAACTTCATCCACGTTCACC3′
ARMS-PCR
AG genotype (155, 87, 68 bp) AA genotype (155 bp), GG genotype (87, 68 bp) GT genotype (227, 176, 51 bp) TT genotype (227 bp) GG genotype (176, 51 bp) 190 bp
ARMS-PCR
163 bp
Internal control
110 bp
IL-23R (rs10889677) Beta globins
48
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
Table 2 The PCR master mix and thermo cycling condition for the IL-17, IL-23R and IL-21. Locus
PCR conditions
IL-17 (G-197A) (rs2275913)
94 °C, 5 min 57 °C, 30 s 72 °C, 30 s 30 cycles 2 μL genomic DNA, 1 μL of each primer, 1 μL buffer(baq), 0.15 μL of dNTP, and 0. 5 U Taq DNA polymerase 94 °C, 5 min 64 °C, 30 s 72 °C, 30 s 30 cycles 2 μL genomic DNA, 1 μL of each primer, 1 μL buffer (baq), 0.15 μL of dNTP, and 0. 5 U Taq DNA polymerase 94 °C, 5 min 64 °C, 30 s 72 °C, 30 s 30 cycles 0.15 μL dNTPs, 1 μL of external primers 1 μL of common primer,0.9 μL of inner primers, 1 μL of buffer (baq), 0. 5 U Taq DNA polymerase and 4 μL genomic DNA. 94 °C, 5 min 63 °C, 30 s 72 °C, 30 s 30 cycles 0.15 μL dNTPs, 1 μL of external primers 1 μL of common primer,0.7 μL of inner primers, 1 μL of buffer (baq), 0. 5 U Taq DNA polymerase and 4 μL genomic DNA
IL-21 (G1472T) (rs2055979) IL-21 (A5250G) (rs4833837)
IL-23R (rs10889677)
kidney function or experienced an acute rejection episode after 3 months of follow-up were 36.03 ± 14.96 and 32.41 ± 13.11, respectively. Male to female ratio (M/F) was 0.89 (33/37) in rejection group and 1.85 (117/63) in the non-rejection group. In the present study 47% of recipients received the graft from living donors while 53% of kidney recipients took their grafts from deceased donors. Thirty eight percent of patients received a graft from related donors while the remaining 62% obtained their grafts from unrelated donors. All patients have the first transplant. Allele and genotype frequencies for IL-17
Table 3 The demographics of kidney transplant patients (n = 250), MM, mismatch. Characteristic
Reject
Non-reject
P-value
Recipient age (years) Donor age (years) Recipient no (%) Male Female Donor no (%) Male Female –
36.03 ± 14.96 30.80 ± 9.76
32.41 ± 13.11 28.79 ± 7.74
33 (13.2) 37 (14.8)
117 (46.8) 63 (25.2)
0.31 0.2 0.009 χ2 = 6.7
15 (12.5) 13 (10.33)
1 (0.83) 91 (75.83)
0.0 χ2 = 51.1
(rs2275913), IL-21 (rs2055979 and rs4833837) and IL-23R (rs10889677) were determined in 70 acutely rejected (AR group) and 180 non-acutely rejected (non-AR group) kidney transplant recipients. Except for IL-23R (rs10889677) and IL-21 (rs4833837) genotypes (P = 0.005 and P = 0.01, respectively), all other genotypes were in agreement with Hardy–Weinberg equilibrium. Armitag's trend test was used to check the association of genotypes with acute rejection whenever the Hardy–Weinberg equilibrium did not meet. Also, the significance of this allele and genotype, however, did not survive the Bonferroni correction, which suggested the striking of the threshold of P-value from conventional 0.05 to 0.017. The demographic characteristics of kidney transplant patients are shown in Table 3.
3.2. Inheritance of cytokine genes in patients No differences in the distribution of the IL-21 (rs2055979 and rs4833837) and IL-23R (rs10889677) genotypes were observed in the AR group as compared to non-AR group. However, as shown in Table 3, the frequency of IL-17 −197 G allele was found to be significantly higher in AR group as compared to those of non-AR group (72.15% and 61.94%, respectively; P = 0.03, study power = 65%). Interestingly, after stratification of patients into IL-17 −197 GG and AA + AG carriers, it was found that the frequency of GG carriers has remained significantly higher in AR group as compared to those of non-AR group (52.86%, and 38.89%, respectively; P = 0.04) (Table 4). In addition, after categorization of kidney recipients according to their gender, IL-17 − 197 GG genotype showed a significant association with rejection in female patients (P = 0.02, OR = 2.53, 95% CI = 1.01–6.38, study power = 60%) (Table 4) while in male recipients the distribution of AA genotype of IL-23R gene polymorphism showed significant difference between AR and non-AR groups (54.54% in AR and 34.18% in non-AR, P = 0.03; Study power = 55%) (Table 4). Also there is a significant association between CC and TT genotypes and C/T alleles of IL-21C5250T and AR in living patients (P = 0.02, study power = 99%; P = 0.03, study power = 84%; and P = 0.006, study power = 86%, respectively) (Table 5). In addition after gender classification IL-23R AA genotype and A/C alleles have a significant association with rejection in male cadaver patients (P = 0.03, study power = 58%; P = 0.01, study power = 74%, respectively) (Table 6). Also, IL-21G1472T TG genotype has a significant association with rejection in female cadaver patients (Table 6). IL-17 AG, GG and IL-23R AA, AC and IL-211472 GG, TG and IL-21 5250 TT genotypes and C/T alleles of IL-21 5250 polymorphisms have a significant association with rejection in female living patients (Table 5). The frequency of IL-17/IL-21 combination genotypes is shown in Table 7. The frequency of the IL-17 AA/IL-21CT combination was significantly higher in rejection (P = 0.00003) and IL-17 AG/IL-21TT combination was significantly higher in non-rejection patients (P = 0.02). Also, the frequency of the IL-17AA/IL-21TG and AA/GG combination genotypes was significantly higher in rejection patients (P = 0.00003, P = 0.04, respectively). A linkage disequilibrium (D′ = 0.368, P b 0.0001) was found for two polymorphisms at the positions IL-21 G1472T and IL-21C5250T (Fig. 1).
Table 4 The frequencies of IL-17, IL-21 and IL-23R genotypes and alleles in kidney patients with acute rejection and non-acute rejection. SNP (rs)
rs2275913 IL-17(G-197A)
rs10889677 IL-23R (C/A)
rs2055979 IL-21G1472T
rs4833837 IL-21C5250T
Genotype
AA AG GG A allele G allele AA AC CC A allele C allele TT TG GG T allele G allele CC CT TT C allele T allele
Acute rejection
Non-acute rejection
Male N (%)
Female N (%)
Total N (%)
Male N (%)
Female N (%)
Total N (%)
2 (6.06) 14 (43.42) 17 (51.52) 18 (27.28) 48 (72.73) 18 (54.54) 11 (33.33) 4 (12.12) 47 (71.21) 19 (28.78) 8 (24.24) 15 (45.45) 10 (30.30) 31 (46.15) 35 (53.03) 2 (6.07) 12 (36.37) 19 (57.58) 16 (24.25) 50 (75.76)
4 (10.81) 13 (35.13) 20 (54.04) 21 (28.37) 53 (71.62) 9 (24.32) 20 (54.05) 8 (21.62) 38 (51.35) 36 (48.64) 4 (10.81) 18 (48.64) 15 (40.54) 26 (35.13) 48 (64.86) 3 (8.11) 12 (32.43) 22 (59.46) 18 (24.33) 56 (75.68)
6 (8.58) 27 (38.58) 37 (52.86) 39 (27.86) 101 (72.1) 27 (38.58) 31 (44.29) 12 (17.15) 85 (60.72) 55 (39.29) 12 (17.15) 33 (47.15) 25 (35.72) 57 (40.72) 83 (59.29) 6 (8.58) 23 (32.86) 41 (58.58) 35 (25) 105 (75)
19 (16.23) 48 (41.02) 50 (42.73) 86 (36.75) 148 (63.24) 40 (34.18) 46 (39.31) 31 (26.49) 126 (53.84) 108 (46.15) 24 (20.51) 60 (21.28) 33 (28.20) 108 (46.15) 126 (53.84) 15 (12.83) 44 (37.61) 58 (49.58) 74 (31.63) 160 (68.38)
8 (12.69) 35 (55.55) 20 (31.74) 51 (40.47) 75 (59.52) 27 (42.85) 23 (36.50) 13 (20.63) 77 (61.11) 49 (38.88) 13 (20.63) 28 (44.44) 22 (34.92) 54 (42.86) 72 (57.14) 9 (14.29) 21 (33.34) 33 (52.38) 39 (30.96) 87 (69.05)
27 (15) 83 (46.11) 70 (38.89) 137 (38.06) 223 (61.94) 67 (37.23) 69 (38.34) 44 (24.45) 203 (56.38) 157 (43.62) 37 (20.56) 88 (48.89) 55 (30.56) 162 (45) 198 (55) 24 (13.34) 65 (36.12) 91 (50.56) 113 (31.39) 247 (68.62)
P1 value
P2 value
P3 value
0.177 0.280 0.045⁎ 0.032⁎
0.13 0.88 0.37 0.15
0.77 0.048⁎ 0.027⁎
0.843 0.388 0.213 0. 379
0.03⁎ 0.53 0.084 0.011⁎⁎
0.062 0.087 0.90 0.177
0.541 0.804 0.432 0.385
0.64 0.55 0.81 0.90
0.206 0.68 0.57 0.28
0.29 0.62 0.25 0.15
0.27 0.89 0.41 0.24
0.35 0.92 0.49 0.31
0.085
P1 value = indicates the difference between reject and non-reject groups. P2 value = indicates the difference between reject and non-reject groups in male patients. P3 value = indicates the difference between reject and non-reject groups in female patients. ⁎ Considered significant with P value threshold of 0.05. ⁎⁎ Considered significant after the Bonferroni correction (P value threshold of 0.017).
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
49
Table 5 The frequencies of IL-17, IL-21 and IL-23R genotypes and alleles in kidney transplant patients received allograft from living patients. SNP (rs)
rs2275913 IL-17 (G-197A)
rs10889677 IL-23R (C/A)
rs2055979 IL-21G1472T
rs4833837 IL-21C5250T
Genotype
AA AG GG A allele G allele AA AC CC A allele C allele TT TG GG T allele G allele CC CT TT C allele T allele
(Living) acute rejection
(Living) non-acute rejection
Male n (%)
Female n (%)
Total n (%)
Male n (%)
Female n (%)
Total n (%)
1 (6.66) 6 (40) 8 (53.33) 8 (26.66) 22 (73.33) 7 (46.66) 5 (33.33) 3 (20) 19 (63.33) 11 (36.66) 4 (26.66) 5 (33.33) 6 (40) 13 (43.33) 17 (56.66) 0 7 (46.66) 8 (26.66) 7 (23.33) 23 (76.66)
1 (7.69) 3 (23.07) 9 (69.23) 5 (19.23) 21 (80.76) 4 (30.76) 4 (30.76) 5 (38.46) 12 (46.18) 14 (53.84) 1 (7.69) 6 (46.15) 6 (46.15) 8 (30.76) 18 (69.23) 0 2 (15.38) 11 (84.61) 2 (7.69) 24 (92.30)
2 (7.14) 9 (32.14) 17 (60.71) 13 (23.21) 43 (76.78) 11 (39.28) 9 (32.14) 8 (28.57) 31 (55.35) 25 (44.64) 5 (17.85) 11 (39.28) 12 (42.85) 21 (37.5) 35 (62.5) 0 9 (32.14) 19 (67.85) 9 (16.07) 47 (83.92)
11 (16.92) 24 (36.92) 30 (46.15) 46 (35.38) 84 (64.61) 23 (35.38) 22 (33.84) 20 (30.76) 68 (52.30) 62 (47.69) 13 (20) 32 (49.23) 20 (30.76) 58 (44.61) 72 (55.38) 10 (15.38) 23 (35.38) 32 (49.23) 43 (33.07) 87 (66.92)
0 19 (70.37) 8 (29.62) 19 (35.18) 35 (64.81) 19 (70.37) 0 8 (29.62) 38 (70.37) 16 (29.62) 3 (11.11) 21 (77.77) 3 (11.11) 27 (50) 27 (50) 5 (18.51) 12 (44.44) 10 (37.03) 22 (40.74) 32 (59.25)
11 (11.95) 43 (46.73) 38 (41.30) 65 (65.32) 119 (64.67) 42 (45.65) 22 (23.91) 28 (30.43) 106 (57.60) 78 (42.39) 16 (17.39) 53 (57.60) 23 (25) 85 (46.19) 99 (53.80) 15 (16.30) 35 (38.04) 42 (45.65) 65 (35.32) 119 (64.67)
P1 value
P2value
P3 value
0.47 0.17 0.07 0.09
0.31 0.82 0.61 0.36
0.14 0.004⁎⁎ 0.01⁎⁎ 0.14
0.55 0.58 0.58 0.76
0.41 0.96 0.40 0.27
0.01⁎⁎ 0.002⁎⁎ 0.57 0.56
0.95 0.08 0.06 0.25
0.56 0.26 0.49 0.89
0.73 0.04⁎ 0.01⁎⁎
0.02⁎ 0.57 0.03⁎
0.10 0.41 0.77 0.29
0.09 0.07 0.004⁎⁎ 0.002⁎⁎
0.006⁎⁎
0.10
P1 value = indicates the difference between reject and non-reject groups in living patients. P2value = indicates the difference between reject and non-reject groups in male living patients. P3 value = indicates the difference between reject and non-reject groups in female living patients. ⁎ Considered significant with P value threshold of 0.05. ⁎⁎ Considered significant after the Bonferroni correction (P value threshold of 0.017).
and genotype. But there is a significant difference between IL-21G1472T serum level and genotype in non-rejection patients (P = 0.011).
3.3. ELISA results The mean of IL-17 level in normal population is 12.37 ± 2.6. There is no significant difference among normal population, reject and non-reject patients. Results of IL-17 showed that there is a significant difference between rejected and non-rejected groups (24.37 ± 32.94 for AR and 8.6 ± 9.9 for non-AR groups, respectively; P = 0.035). After gender categorization, the mean of IL-17 levels has remained statistically higher in female patients with acute rejection as compared to females in non-AR group (5.89 ± 3.66 for AR and 10.94 ± 12.05 for non-AR groups, respectively; P b 0.007). Also, the mean of IL-17 levels has remained statistically higher in male normal population as compared to male patients with acute rejection. IL-21 levels did not show any significant difference between rejected and non-rejected groups. Therefore we compared serum levels IL-17 and IL-21 with their genotypes. There is not any significant difference between IL-17 serum level
4. Discussion Th17 cells and their related cytokines have been implied as the major players in autoimmunity [11–14]. These cells have been reported to produce proinflammatory cytokines like IL-22, IL-21 and IL-17 [18]. Also, IL-23 promotes IL-17 expression and the proliferation of IL-17 — producing cells from a pool of memory T cells, thus playing an important role in maintaining Th17 effector function [10]. Cytokines are important
Table 6 The frequencies of IL-17,IL-21 and IL-23R genotypes and alleles in kidney transplant patient received allograft from cadaver patients. SNP (rs)
rs2275913 IL-17 (G-197A)
rs10889677 IL-23R (C/A)
rs2055979 IL-21G1472T
rs4833837 IL-21C5250T
Genotype
AA AG GG A allele G allele AA AC CC A allele C allele TT TG GG T allele G allele CC CT TT C allele T allele
(Cadaver) acute rejection
(Cadaver) non-acute rejection
Male n (%)
Female n (%)
Total n (%)
Male n (%)
Female n (%)
Total n (%)
1 (5.55) 8 (44.44) 9 (50) 10 (27.77) 26 (72.22) 11 (61.11) 6 (33.33) 1 (5.55) 28 (77.77) 8 (9.30) 4 (22.22) 10 (55.55) 4 (22.22) 18 (50) 18 (50) 2 (11.11) 5 (27.77) 11 (61.11) 9 (25) 27 (75)
3 (12.5) 10 (41.66) 11 (45.83) 16 (33.33) 32 (66.66) 5 (20.83) 16 (66.66) 3 (12.5) 26 (54.16) 22 (45.83) 3 (12.5) 12 (50) 9 (37.5) 18 (37.5) 30 (62.5) 3 (12.5) 10 (41.66) 11 (45.83) 16 (33.33) 32 (66.66)
4 (9.52) 18 (42.85) 20 (47.61) 26 (30.95) 58 (69.04) 16 (38.09) 22 (52.38) 4 (9.52) 54 (64.28) 30 (35.71) 7 (16.66) 22 (52.38) 13 (30.95) 36 (42.85) 48 (57.14) 5 (11.90) 15 (35.71) 22 (52.38) 25 (29.76) 59 (70.23)
8 (15.38) 24 (46.15) 20 (38.46) 40 (38.46) 64 (61.53) 17 (32.69) 24 (46.15) 11 (21.15) 58 (55.76) 46 (44.23) 11 (21.15) 28 (53.84) 13 (25) 50 (48.07) 54 (51.92) 5 (9.61) 21 (40.38) 26 (50) 31 (29.80) 73 (70.19)
8 (22.22) 16 (44.44) 12 (33.33) 32 (44.44) 40 (55.55) 8 (22.22) 23 (63.88) 5 (13.88) 39 (54.16) 33 (45.83) 10 (27.77) 7 (19.44) 19 (52.77) 27 (37.5) 45 (62.5) 4 (11.11) 9 (25) 23 (63.88) 17 (23.61) 55 (76.38)
16 (18.18) 40 (45.45) 32 (36.36) 72 (40.90) 104 (59.09) 25 (28.40) 47 (53.40) 16 (18.18) 97 (55.11) 79 (44.88) 21 (23.86) 35 (39.77) 32 (36.36) 77 (43.75) 99 (56.25) 9 (10.22) 30 (34.09) 49 (55.68) 48 (27.27) 128 (72.72)
P1 value
P2value
P3 value
0.20 0.78 0.22 0.12
0.28 0.90 0.39 0.24
0.34 0.83 0.32 0.22
0.26 0.91 0.20 0.16
0.03⁎ 0.34 0.13 0.01⁎⁎
0.89 0.82 0.87 1.00
0.35 0.17 0.54 0.89
0.92 0.90 0.81 0.84
0.15 0.01⁎ 0.24 1.00
0.77 0.85 0.73 0.67
0.85 0.34 0.41 0.73
0.86 0.17 0.16 0.24
P1 value = indicates the difference between reject and non-reject groups in cadaver patients. P2 value = indicates the difference between reject and non-reject groups in male cadaver patients. P3 value = indicates the difference between reject and non-reject groups in female cadaver patients. ⁎ Considered significant with P value threshold of 0.05. ⁎⁎ Considered significant after the Bonferroni correction (P value threshold of 0.017).
50
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
Table 7 The frequency of IL-17/IL-21 genotype combinations in kidney transplant patients. Genotypes
Non-reject (n)
P value
OR
95% CI
IL-21C5250T & IL-17G-197A AA/CC 1 AA/CT 15 AA/TT 8 AG/CC 6 AG/CT 14 AG/TT 6 GG/CC 3 GG/CT 5 GG/TT 12
Reject (n)
2 8 15 12 37 37 11 21 37
0.83 0.00003⁎ 0.44 0.60 0.92 0.02⁎⁎
1.29 5.86 1.42 1.31 0.97 0.36 0.69 0.58 0.80
… 2.19–16.08 0.52–3.79 0.42–3.97 0.46–2.02 0.13–0.96 0.15–2.78 0.18–1.73 0.37–1.73
IL-21G1472T & IL-17G-197A AA/TT 0 AA/TG 18 AA/GG 6 AG/TT 7 AG/TG 12 AG/GG 7 GG/TT 5 GG/TG 5 GG/GG 10
8 12 5 30 40 16 14 25 30
0.07 0.00003⁎ 0.04⁎⁎
0 4.85 3.28 0.56 0.72 1.14 0.91 0.48 0.83
0–1.71 2.05–11.55 0.85–12.92 0.21–1.41 0.33–1.55 0.40–3.12 0.27–2.86 0.15–1.39 0.36–1.91
0.57 0.29 0.54
0.18 0.37 0.78 0.86 0.14 0.64
In genotypes, each P value results from comparisons of the values in the corresponding row with the sum of values in the other rows. N, absolute number; CI, confidence interval; OR, odds ratio. ⁎ Considered significant after the Bonferroni correction (P value threshold of 0.005). ⁎⁎ Considered significant with P value threshold of 0.05.
factors determining the outcome of transplantation [15]. Since host ability in cytokine production may be affected by cytokine gene polymorphisms, the aim of the present study was to investigate the effect of IL-21, IL-23R and IL-17 gene polymorphisms in the outcome of kidney transplantation. Our results showed that IL-17 GG carriers and G allele were significantly more frequent in patients with acute rejection as compared to patients without any sign of rejection. There are controversies about the association of genotypes of IL-17 in a different disease. Several studies have shown that in various kinds of cancers such as cervical cancer and gastric cancer, the frequency of rs2275913 AA genotype and A allele were significantly more than the control group [29–32]. Our results are consistent with the report of Nordang et al., who showed that the genotype distribution of IL17A gene (rs2275913) has an increased frequency for G allele among the rheumatoid arthritis (RA)
IL21(C5250T)
0/001
patients as compared with controls, and when analyzed in a recessive model, patients carrying the GG genotype showed an increased risk [33]. Also, in our study IL-17 serum levels have shown a significant difference between rejected and non-rejected groups. Studying acute renal rejection murine models displayed an elevation in IL-17 messenger RNA levels and IL-17 protein on the second day after transplantation [34]. IL-17 has been also detected in urine and tissue samples from patients with early acute renal rejection [18,24]. Similar observations have been made in heart transplant patients [35,36]. These results are consistent with the report of Crispim et al. who showed the higher level of IL-17 of rejecting patients in comparison to non-rejecting patients [37]. It is worth mentioning that exogenous factors such as infection, mental stress or different inflammations have an effect on serum level of IL-17. Therefore, the effect of these factors should also be taken into consideration. Also, in our study we evaluated the correlation of the serum level of IL-17 with its genotypes. There is not any significant difference between its serum level and genotype. Consistent to our study in 2012, it was shown that there is no significant difference between serum levels of IL-17 and genotypes in primary antiphospholipid syndrome (PAPS) patients [38]. After gender classification, IL-23R AA genotype and A allele were shown to have a significant association with kidney allograft rejection in male patients. Tsai et al. showed that polymorphisms of IL23R gene were associated with kidney transplant outcomes. Renal transplant recipients (RTRs) that carried the IL-23R AC/CC genotype and C allele had a higher risk of developing primary outcome as compared to those with IL-23R AA genotype and A allele, respectively [27]. Duan et al. could not find any significant differences in allele frequency of IL-23R (rs10889677) polymorphism between cases and controls in AS (ankylosing spondylitis) [39]. In our study a significant difference was not found between IL-21 gene polymorphisms in rejected and non-rejected kidney transplant patients. A significant association of the IL-21 gene polymorphism with atopic asthma was reported. The T allele of the C5250T SNP is a low producing allele, and this synonymous exonic variant is associated with atopic asthma and serum IgE levels (TsIgE levels) [40]. Up to now there is no study yet evaluating the relationship between IL-21 and transplantation, therefore we cannot compare our results. In conclusion, we suggest IL-17 promoter polymorphism in IL-17 as a regulatory cytokine could be a genetic risk factor for the development of acute rejection. Allograft rejection is a multifactor phenomenon, and cytokines have a major role in this aspect. Given that the 197A allele is significantly associated with the higher production of IL-17, G197A genotyping may be used to predict the susceptibility organ allograft rejection. Acknowledgment
IL21(G1472T)
0/368
This study was financially supported by the Transplant Research Center and Autoimmune Diseases Research Center, Shiraz University of Medical Sciences. Authors would like to thanks Mohammad-Reza Malekmakan for his help in performing PCR experiments. References
IL21(G1472T)
IL21(C5250T)
Fig. 1. Linkage disequilibrium plot of IL-21 polymorphisms in D′ value. Dark colored boxes are representative of high linkage disequilibrium (LD) and light colored boxes indicate low LD. The left upper boxes indicate the P values.
[1] Stepkowski SM. Immunobiology of allograft rejection. In: Kahan BD, Ponticielli C, editors. Principles and practice of renal transplantation. Malden, MA, USA: Blackwell Science Inc.; 2000. p. 41–87. [2] Romagnami S. The 1/Th2 paradigm. Immunol Today 1997;18:263–6. [3] Zhai Y, Ghobrial RM, Busuttil RW, Kupiec-Weglinski JW. Th1 and Th2 cytokines in organ transplantation: paradigm lost? Crit Rev Immunol 1999;19:155–72. [4] Amirzargar A, Lessanpezeshki M, Fathi A, Amirzargar M, Khosravi F, Ansaripour B, et al. Th1/Th2 cytokine analysis in Iranian renal transplant recipients. Transplant Proc 2005;37:2985–7. [5] Harrington LE, Mangan PR, Weaver CT. Expanding the effector CD4 T-cell repertoire: the Th17 lineage. Curr Opin Immunol 2006;18(3):349–56.
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51 [6] Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, et al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 2005;6(11):1123–32. [7] Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 2005;6(11):1133–41. [8] Chen Z, Tato CM, Muul L, Laurence A, O'Shea JJ. Distinct regulation of interleukin-17 in human T helper lymphocytes. Arthritis Rheum 2007;56(9):2936–46. [9] Yang L, Anderson DE, Baecher-Allan C, Hastings WD, Bettelli E, Oukka M, et al. IL-21 and TGF-beta are required for differentiation of human T(H)17 cells. Nature 2008;454:350–2. [10] Tesmer LA, Lundy SK, Sarkar S, Fox DA. Th17 cells in human disease. Immunol Rev 2008;223:87–113. [11] Kotake S, Yago T, Kawamoto M, Nanke Y. Role of osteoclasts and interleukin-17 in the pathogenesis of rheumatoid arthritis: crucial ‘human osteoclastology’. J Bone Miner Metab 2012;30(2):125–35. [12] Wang YH, Wills-Karp M. The potential role of interleukin-17 in severe asthma. Curr Allergy Asthma Rep 2011;11(5):388–94. [13] Oh SH, Roh HJ, Kwon JE, Lee SH, Kim JY, Choi HJ, et al. Expression of interleukin-17 is correlated with interferon-α expression in cutaneous lesions of lupus erythematosus. Clin Exp Dermatol 2011;36(5):512–20. [14] Wang HH, Dai YQ, Qiu W, Lu ZQ, Peng FH, Wang YG, et al. Interleukin-17-secreting T cells in neuromyelitis optica and multiple sclerosis during relapse. J Clin Neurosci 2011;18(10):1313–7. [15] Loverre A, Divella C, Castellano G, Tataranni T, Zaza G, Rossini M, et al. T helper 1, 2 and 17 cell subsets in renal transplant patients with delayed graft function. Transpl Int 2011;24(3):233–42. [16] Li T, Si Z, Qi H, He Z, Li Y. IL-17 in the early diagnosis of acute renal allograft rejection in mice. Zhong Nan Da Xue Xue Bao Yi Xue Ban 2011;36(12):1147–52. [17] Taflin C, Favier B, Baudhuin J, Savenay A, Hemon P, Bensussan A, et al. Human endothelial cells generate Th17 and regulatory T cells under inflammatory conditions. Proc Natl Acad Sci U S A 2011;108(7):2891–6. [18] Deteix C, Attuil-Audenis V, Duthey A, Patey N, McGregor B, Dubois V, et al. Intragraft Th17 infiltrate promotes lymphoid neogenesis and hastens clinical chronic rejection. J Immunol 2010;184(9):5344–51. [19] Abadja F, Atemkeng S, Alamartine E, Berthoux F, Mariat C. Impact of mycophenolic acid and tacrolimus on Th17-related immune response. Transplantation 2011;92(4):396–403. [20] Wang H, Zhong X, Wang K, Qiu W, Li J, Dai Y, et al. Interleukin 17 gene polymorphism is associated with anti-aquaporin 4 antibody-positive neuromyelitis optica in the Southern Han Chinese — a case control study. J Neurol Sci 2012;314(1–2):26–8. [21] Espinoza JL, Takami A, Nakata K, Onizuka M, Kawase T, Akiyama H, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS One 2011;6(10):e26229. [22] Kim SW, Kim ES, Moon CM, Park JJ, Kim TI, Kim WH, et al. Genetic polymorphisms of IL-23R and IL-17A and novel insights into their associations with inflammatory bowel disease. Gut 2011;60(11):1527–36. [23] Sawalha AH, Kaufman KM, Kelly JA, Adler AJ, Aberle T, Kilpatrick J, et al. Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus. Ann Rheum Dis 2008;67(4):458–61.
51
[24] Messaoudi S, Al-Khateeb GM, Dendana M, Sater MS, Jazia KB, Nouira M, et al. Genetic variations in the interleukin-21 gene and the risk of recurrent idiopathic spontaneous miscarriage. Eur Cytokine Netw 2011;22(2):123–6. [25] Zwiers A, Kraal L, van de Pouw Kraan TC, Wurdinger T, Bouma G, Kraal G. A variant of the IL-23R gene associated with inflammatory bowel disease induces loss of MicroRNA regulation and enhanced protein production. J Immunol 2012;188(4):1573–7. [26] Chien MH, Hsin CH, Shih-Shen Chou L, Chung TT, Lin CH, Weng MS, et al. Interleukin-23 receptor polymorphism as a risk factor for oral cancer susceptibility. Head Neck 2012;34(4):551–6. [27] Tsai JP, Yang SF, Wu SW, Hung TW, Tsai HC, Lian JD, et al. Association between interleukin 23 receptor polymorphism and kidney transplant outcomes: a 10-year Taiwan cohort study. Clin Chim Acta 2011;412(11–12):958–62. [28] Solez K, Colvin RB, Racusen LC, Haas M, Sis B, Mengel M, et al. Banff 07 classification of renal allograft pathology: updates and future directions. Am J Transplant 2008;8(4):753–60. [29] Arisawa T, Tahara T, Shiroeda H, Matsue Y, Minato T, Nomura T, et al. Genetic polymorphisms of IL17A and pri-microRNA-938, targeting IL17A 3′-UTR, influence susceptibility to gastric cancer. Hum Immunol 2012;73(7):747–52. [30] Hayashi R, Tahara T, Shiroeda H, Matsue Y, Minato T, Nomura T, et al. Association of genetic polymorphisms in IL17A and IL17F with gastro-duodenal diseases. J Gastrointestin Liver Dis 2012;21(3):243–9. [31] Quan Y, Zhou B, Wang Y, Duan R, Wang K, Gao Q, et al. Association between IL17 polymorphisms and risk of cervical cancer in Chinese women. Clin Dev Immunol 2012;2012:258293. [32] Zhou B, Zhang P, Wang Y, Shi S, Zhang K, Liao H, et al. Interleukin-17 gene polymorphisms are associated with bladder cancer in a Chinese Han population. Mol Carcinog 2013;52(1):871–8. [33] Nordang GB, Viken MK, Hollis-Moffatt JE, Merriman TR, Førre ØT, Helgetveit K, et al. Association analysis of the interleukin 17A gene in Caucasian rheumatoid arthritis patients from Norway and New Zealand. Rheumatology 2009;48:367–70. [34] Loong CC, Hsieh HG, Lui WY, Chen A, Lin CY. Evidence for the early involvement of interleukin 17 in human and experimental renal allograft rejection. J Pathol 2002;197(3):322–32. [35] Antonysamy MA, Fanslow WC, Fu F, Li W, Qian S, Troutt AB, et al. Evidence for a role of IL-17 in alloimmunity: a novel IL-17 antagonist promotes heart graft survival. Transplant Proc 1999;31(1–2):93. [36] Tang JL, Subbotin VM, Antonysamy MA, Troutt AB, Rao AS, Thomson AW. Interleukin-17 antagonism inhibits acute but not chronic vascular rejection. Transplantation 2001;72(2):27348–50. [37] Crispim JC, Grespan R, Martelli-Palomino G, Rassi DM, Costa RS, Saber LT, et al. Interleukin-17 and kidney allograft outcome. Transplant Proc 2009;41(5):1562–4. [38] Popovic-Kuzmanovic D, Novakovic I, Stojanovich L, Aksentijevich I, Zogovic N, Tovilovic G, et al. Increased activity of interleukin-23/interleukin-17 cytokine axis in primary antiphospholipid syndrome. Immunobiology 2013;218(2):186–91. [39] Duan Z, Pan F, Zeng Z, Zhang T, Wang S, Li G, et al. Interleukin-23 receptor genetic polymorphisms and ankylosing spondylitis susceptibility: a meta-analysis. Rheumatol Int 2012;32(5):1209–14. [40] Chatterjee R, Batra J, Ghosh B. A common exonic variant of Interleukin21 confers susceptibility to atopic asthma. Int Arch Allergy Immunol 2009;148(2):137–46.
Contents lists available at ScienceDirect
Transplant Immunology journal homepage: www.elsevier.com/locate/trim
Combined analysis of cytokine gene polymorphism and the level of expression with allograft function in kidney transplant recipients Mohammad Hossein Karimi a, Sara Hejr a, Bita Geramizadeh a, Ramin Yaghobi a, Mohammad Mehdi Sagheb a, Eskandar Kamali-sarvestani b,c,⁎ a b c
Transplant Research Center, Shiraz University of Medical Sciences, Shiraz, Iran Autoimmune Diseases Research Center, Shiraz University of Medical Sciences, Shiraz, Iran Department of Immunology, Shiraz University of Medical Sciences, Shiraz, Iran
a r t i c l e
i n f o
Article history: Received 3 July 2013 Received in revised form 12 September 2013 Accepted 13 September 2013 Keywords: IL-17 IL-23R Kidney allograft Polymorphism
a b s t r a c t Cytokines are important factors determining the outcome of transplantation since host ability in cytokine production may be affected by cytokine gene polymorphisms. The aim of the present study was to investigate the effect of IL-17, IL-23R and IL-21 gene polymorphisms in the outcome of kidney transplantation. A total of 250 kidney transplant recipients were included in this study. Overall 70 recipients (28%) experienced an acute rejection. IL-17 197 A/G, IL-21 + 1472 G/T, IL-21 5250 C/T, and IL-23R C/T gene polymorphisms were evaluated by PCR-RFLP or ARMS-PCR methods. The serum levels of IL-17 and IL-21 were also checked by ELISA. IL-17 GG carriers and G allele were significantly more frequent in patients with acute rejection as compared to patients without any sign of rejection (P = 0.045 and P = 0.032, respectively). In addition after gender classification, IL-23R AA carriers and A allele were significantly more frequent in male patients who experienced an acute rejection as compared to non-rejected patients (P = 0.03, P = 0.011, respectively). The IL-17 serum levels have also shown significant differences between rejected and non-rejected groups (24.37 ± 32.94 for AR and 8.6 ± 9.9 for non-AR groups, respectively; P = 0.035). The mentioned results indicate that IL-17GG genotype, G allele and its serum level have predictive values for acute rejection. GG genotype and G allele of IL-17 is a genetic risk factor for development of acute rejection. Also, AA genotype and A allele of IL-23R is a sex dependent genetic risk factor for the development of acute rejection, but this subject needs to be studied in a different population. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Successful clinical transplantation depends, in part, upon the immune process that mediates rejection of the transplanted organ. Allograft rejection is a complex phenomenon involving interactions between multiple cell types and a complex variety of factors [1]. In this process, T cells play a major role in recognizing the alloantigen in the context of the MHC molecule associated with the donor organ. Naive T cells under different cytokine milieu differentiate to various subtypes. Th1 cells produce IFN-γ whereas Th2 cells produce IL-4, IL-5 and IL-13 [1,2]. In transplantation models, Th1 cytokine profile often associates with allograft rejection, while Th2 profile favors the acquisition of tolerance and stable graft survival [3,4]. More recently, Th17 cells are described as a novel subset of Th cells that are characterized by producing IL-17 [5–7]. In humans the majority of studies have found a central role for IL-21 and IL-23 in directing Th17 cell development [8,9]. In addition, strong genetic evidence has linked IL-23 requirement ⁎ Corresponding author at: Auto immune Diseases Research Center, Shiraz University of Medical Sciences, Iran. Fax: +98 7112304069. E-mail address: [email protected] (E. Kamali-sarvestani). 0966-3274/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.trim.2013.09.006
to the development of Th17-associated diseases [10]. Th17 cells have been linked to many immune/autoimmune related diseases [11–14] as well as allograft rejection [15]. In fact, recent studies have shown the prominent role of Th17 cells in the development of acute renal allograft rejection. It has been shown that IL-17 can be considered as an early diagnostic marker of acute renal allograft rejection in mice [16]. Interestingly, human endothelial cells that are the first target in graft rejection following kidney transplantation, selectively amplified proinflammatory Th17 cells [17]. In addition, a correlation between shorter graft survival and the presence of intragraft Th17 cells that produce IL17 and IL-21 was also observed in human renal grafts with terminal failure [18]. It is also worth to mention that both mycophenolic acid and tacrolimus decreased Th17-related transcripts after T-cell activation and therefore, treatment combining mycophenolic acid and tacrolimus might confer optimal allograft immunoprotection by inhibition of Th17 cell activation [19]. Given the importance of Th17 cells and their related cytokines in the rejection of kidney transplants, genetic variations in the genes of IL-17 and IL-21 and IL-23R may play a significant role in the outcome of renal transplantation. IL-17, IL-21 and IL-23R genes are located on chromosomes 6p12, 4q26, and 1p31.3, respectively. A functional G-to-A transition at position −197 in the promoter
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
region of IL-17 gene (rs2275913) has been studied extensively [20,21] and it has been shown that healthy individuals possessing the −197A allele produced significantly more IL-17 than those without the −197A allele [21]. The association of this polymorphism with susceptibility to ulcerative colitis [22] and acute graft-versus-host disease after unrelated bone marrow transplantation [21] have also been reported. Among different polymorphisms in the IL-21 gene, the IL-21 + 1472 G/T polymorphism (rs2055979) which is located in intronic region and a synonymous substitution at position + 5250 of IL-21 gene (rs4833837) which is located exon 3 are remarkable. The association of IL-21 + 1472 G/T polymorphism with systemic lupus erythematosus [23] and recurrent idiopathic spontaneous miscarriage have been reported [24]. The polymorphism within the IL-23R gene (rs10889677) by changing the 3′-UTR region of mRNA molecule induces loss of microRNA regulation and enhanced protein production [25]. The IL-23R polymorphism was found to be associated with different diseases [26,25], as well as kidney transplant outcomes [27]. Considering the importance of Th17 and its related cytokines in the renal transplant outcome, the aim of the present study is to investigate the association of single nucleotide polymorphisms in the genes of IL-17, IL-21 and IL-23R as well as the serum levels of the above mentioned cytokines with allograft function in kidney transplant recipients. 2. Material and methods 2.1. Patients A total of 250 kidney transplant recipient patients who underwent surgery at the Namazi Hospital, Shiraz, Iran, were consecutively recruited from 2007 to 2011. Their ages ranged from 7 to 79 years. Also, nonrejected transplant patients were considered as the control group. All of the patients were Iranian and had transplant operations at the Transplant Center of Namazi Hospital which is affiliated to the Shiraz University of Medical Sciences. The study was approved by the Ethics Committee of Shiraz University of Medical Sciences. In kidney transplant recipients, we investigated the graft outcome and acute rejection episode(s) for at least 3 months. Donors were selected on the basis of ABO blood group compatibility and all of them were negative for cross matches. In this study, the patients were divided into two groups according to the presence (AR group) or absence (non-AR group) of acute rejection episodes. Rejection episodes were identified by an expert nephrology team based on the approved clinical diagnostic criteria and were invariably confirmed by needle biopsy as well as elevated serum creatinine and blood urea nitrogen levels [28]. The standard immunosuppressive regimen for all 250 recipients included cyclosporine (5 mg/kg initially, then a maintenance dose of 2 to 2.5 mg/kg; cyclosporine level was 50 to 150 ng/mL), prednisolone (120 mg/day initially, tapering to 10 mg/day), and mycophenolate mofetil (1000 mg twice daily). HLA typing is routine in our center.
47
2.2. DNA extraction The Buffy coat of the whole blood from renal transplanted patients was available in the sample bank affiliated to Shiraz Transplant Research Center. Genomic DNA was extracted from Buffy coat, using a QIAamp DNA mini kit (Qiagen, Germany) according to the manufacturer's instructions. 2.3. Genotyping analysis Cytokine gene polymorphisms were evaluated by polymerase chain reaction using a thermal cycler (Techne, Genius, UK). PCR conditions, PCR cycles and primers are summarized in Tables 1 and 2. We optimized an in-house-ARMS-PCR method for IL-23R and IL-21C5250T in 10 μL reaction mixture. A beta globin gene primer was used as an internal control. An in-house PCR-RFLP was optimized for determining the IL-17 and IL-21 G1472T gene polymorphism. The PCR products were digested by Xag1 and NlaIII (Fermentas, Lithuania) restriction enzymes and the amplified products were monitored by agarose gel electrophoresis and ethidium bromide staining. 2.4. ELISA The case group consists of 22 patients with acute rejection. The control group consists of 22 patients without rejection. The normal population consists of 25 cases. All samples were taken in the first week after transplantation before corticoid treatments. Plasma samples were isolated immediately and then stored at −80 °C until use. ELISA was performed according to the manufacturer's instructions (eBioscience, USA). 2.5. Statistical analysis Allele and genotype frequencies were calculated in patient and control subjects by direct gene counting. Statistical evaluation was carried out using the Statistical Package for the Social Sciences (SPSS) version 16. The frequencies of the alleles/genotypes were compared in cases and controls by chi-square test, Fisher's exact test. Odds ratios and 95% confidence intervals (CIs) for relative risks were calculated. A probability value of P b 0.05 was considered as statistically significant and all the reported P-values were two-tailed. LD2SNPing program V 2.0 (http://www.bio.kuas.edu.tw/LD2SNPing) was used to estimate linkage disequilibrium (LD) and Hardy–Weinberg was evaluated using Arlequin V311. 3. Results 3.1. Profile of patients Among 250 consecutive recipients, 60% were male (aged from 7 to 65 years) and 40% were female (aged from 1 to 79 years). The mean age of the patients who had normal
Table 1 The primers, types of PCR and product sizes for the IL-17, IL-21, IL-23R, and internal control. Locus
Primers
Method
Product sizes
IL-17 (G-197A) (rs2275913)
Forward primer: 5′GCAGCTCTGCTCAGCTTCTAA3′ Reverse primer: 5′TTCAGGGGTGACACCATTTT3′
PCR-RFLP
IL-21 (G1472T) (rs2055979)
Forward primer: 5′GCTCTGAACCCAAACACTCTC3′ Reverse primer: 5′ACAGCCAGGAAACTCTGGAA3′
PCR-RFLP
IL-21(A5250G) (rs4833837)
Forward primer: 5′TTAGTTGGGCCTTCTGAAAG3′ Reverse primer: 5′TTAGTTGGGCCTTCTGAAAA3′ Common: 5′TGTAATGCACGACATTGCAG3′ Forward primer: 5′TTTTAGCCATTCTTCTGCCTC3′ Reverse primer: 5′TTTTAGCCATTCTTCTGCCTA3′ Common: 5′CGCCTGGCCTAATGATTCTA3′ Forward: 5′ACACAACTGTGTTCACTAGC3′ Reverse: 5′CAACTTCATCCACGTTCACC3′
ARMS-PCR
AG genotype (155, 87, 68 bp) AA genotype (155 bp), GG genotype (87, 68 bp) GT genotype (227, 176, 51 bp) TT genotype (227 bp) GG genotype (176, 51 bp) 190 bp
ARMS-PCR
163 bp
Internal control
110 bp
IL-23R (rs10889677) Beta globins
48
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
Table 2 The PCR master mix and thermo cycling condition for the IL-17, IL-23R and IL-21. Locus
PCR conditions
IL-17 (G-197A) (rs2275913)
94 °C, 5 min 57 °C, 30 s 72 °C, 30 s 30 cycles 2 μL genomic DNA, 1 μL of each primer, 1 μL buffer(baq), 0.15 μL of dNTP, and 0. 5 U Taq DNA polymerase 94 °C, 5 min 64 °C, 30 s 72 °C, 30 s 30 cycles 2 μL genomic DNA, 1 μL of each primer, 1 μL buffer (baq), 0.15 μL of dNTP, and 0. 5 U Taq DNA polymerase 94 °C, 5 min 64 °C, 30 s 72 °C, 30 s 30 cycles 0.15 μL dNTPs, 1 μL of external primers 1 μL of common primer,0.9 μL of inner primers, 1 μL of buffer (baq), 0. 5 U Taq DNA polymerase and 4 μL genomic DNA. 94 °C, 5 min 63 °C, 30 s 72 °C, 30 s 30 cycles 0.15 μL dNTPs, 1 μL of external primers 1 μL of common primer,0.7 μL of inner primers, 1 μL of buffer (baq), 0. 5 U Taq DNA polymerase and 4 μL genomic DNA
IL-21 (G1472T) (rs2055979) IL-21 (A5250G) (rs4833837)
IL-23R (rs10889677)
kidney function or experienced an acute rejection episode after 3 months of follow-up were 36.03 ± 14.96 and 32.41 ± 13.11, respectively. Male to female ratio (M/F) was 0.89 (33/37) in rejection group and 1.85 (117/63) in the non-rejection group. In the present study 47% of recipients received the graft from living donors while 53% of kidney recipients took their grafts from deceased donors. Thirty eight percent of patients received a graft from related donors while the remaining 62% obtained their grafts from unrelated donors. All patients have the first transplant. Allele and genotype frequencies for IL-17
Table 3 The demographics of kidney transplant patients (n = 250), MM, mismatch. Characteristic
Reject
Non-reject
P-value
Recipient age (years) Donor age (years) Recipient no (%) Male Female Donor no (%) Male Female –
36.03 ± 14.96 30.80 ± 9.76
32.41 ± 13.11 28.79 ± 7.74
33 (13.2) 37 (14.8)
117 (46.8) 63 (25.2)
0.31 0.2 0.009 χ2 = 6.7
15 (12.5) 13 (10.33)
1 (0.83) 91 (75.83)
0.0 χ2 = 51.1
(rs2275913), IL-21 (rs2055979 and rs4833837) and IL-23R (rs10889677) were determined in 70 acutely rejected (AR group) and 180 non-acutely rejected (non-AR group) kidney transplant recipients. Except for IL-23R (rs10889677) and IL-21 (rs4833837) genotypes (P = 0.005 and P = 0.01, respectively), all other genotypes were in agreement with Hardy–Weinberg equilibrium. Armitag's trend test was used to check the association of genotypes with acute rejection whenever the Hardy–Weinberg equilibrium did not meet. Also, the significance of this allele and genotype, however, did not survive the Bonferroni correction, which suggested the striking of the threshold of P-value from conventional 0.05 to 0.017. The demographic characteristics of kidney transplant patients are shown in Table 3.
3.2. Inheritance of cytokine genes in patients No differences in the distribution of the IL-21 (rs2055979 and rs4833837) and IL-23R (rs10889677) genotypes were observed in the AR group as compared to non-AR group. However, as shown in Table 3, the frequency of IL-17 −197 G allele was found to be significantly higher in AR group as compared to those of non-AR group (72.15% and 61.94%, respectively; P = 0.03, study power = 65%). Interestingly, after stratification of patients into IL-17 −197 GG and AA + AG carriers, it was found that the frequency of GG carriers has remained significantly higher in AR group as compared to those of non-AR group (52.86%, and 38.89%, respectively; P = 0.04) (Table 4). In addition, after categorization of kidney recipients according to their gender, IL-17 − 197 GG genotype showed a significant association with rejection in female patients (P = 0.02, OR = 2.53, 95% CI = 1.01–6.38, study power = 60%) (Table 4) while in male recipients the distribution of AA genotype of IL-23R gene polymorphism showed significant difference between AR and non-AR groups (54.54% in AR and 34.18% in non-AR, P = 0.03; Study power = 55%) (Table 4). Also there is a significant association between CC and TT genotypes and C/T alleles of IL-21C5250T and AR in living patients (P = 0.02, study power = 99%; P = 0.03, study power = 84%; and P = 0.006, study power = 86%, respectively) (Table 5). In addition after gender classification IL-23R AA genotype and A/C alleles have a significant association with rejection in male cadaver patients (P = 0.03, study power = 58%; P = 0.01, study power = 74%, respectively) (Table 6). Also, IL-21G1472T TG genotype has a significant association with rejection in female cadaver patients (Table 6). IL-17 AG, GG and IL-23R AA, AC and IL-211472 GG, TG and IL-21 5250 TT genotypes and C/T alleles of IL-21 5250 polymorphisms have a significant association with rejection in female living patients (Table 5). The frequency of IL-17/IL-21 combination genotypes is shown in Table 7. The frequency of the IL-17 AA/IL-21CT combination was significantly higher in rejection (P = 0.00003) and IL-17 AG/IL-21TT combination was significantly higher in non-rejection patients (P = 0.02). Also, the frequency of the IL-17AA/IL-21TG and AA/GG combination genotypes was significantly higher in rejection patients (P = 0.00003, P = 0.04, respectively). A linkage disequilibrium (D′ = 0.368, P b 0.0001) was found for two polymorphisms at the positions IL-21 G1472T and IL-21C5250T (Fig. 1).
Table 4 The frequencies of IL-17, IL-21 and IL-23R genotypes and alleles in kidney patients with acute rejection and non-acute rejection. SNP (rs)
rs2275913 IL-17(G-197A)
rs10889677 IL-23R (C/A)
rs2055979 IL-21G1472T
rs4833837 IL-21C5250T
Genotype
AA AG GG A allele G allele AA AC CC A allele C allele TT TG GG T allele G allele CC CT TT C allele T allele
Acute rejection
Non-acute rejection
Male N (%)
Female N (%)
Total N (%)
Male N (%)
Female N (%)
Total N (%)
2 (6.06) 14 (43.42) 17 (51.52) 18 (27.28) 48 (72.73) 18 (54.54) 11 (33.33) 4 (12.12) 47 (71.21) 19 (28.78) 8 (24.24) 15 (45.45) 10 (30.30) 31 (46.15) 35 (53.03) 2 (6.07) 12 (36.37) 19 (57.58) 16 (24.25) 50 (75.76)
4 (10.81) 13 (35.13) 20 (54.04) 21 (28.37) 53 (71.62) 9 (24.32) 20 (54.05) 8 (21.62) 38 (51.35) 36 (48.64) 4 (10.81) 18 (48.64) 15 (40.54) 26 (35.13) 48 (64.86) 3 (8.11) 12 (32.43) 22 (59.46) 18 (24.33) 56 (75.68)
6 (8.58) 27 (38.58) 37 (52.86) 39 (27.86) 101 (72.1) 27 (38.58) 31 (44.29) 12 (17.15) 85 (60.72) 55 (39.29) 12 (17.15) 33 (47.15) 25 (35.72) 57 (40.72) 83 (59.29) 6 (8.58) 23 (32.86) 41 (58.58) 35 (25) 105 (75)
19 (16.23) 48 (41.02) 50 (42.73) 86 (36.75) 148 (63.24) 40 (34.18) 46 (39.31) 31 (26.49) 126 (53.84) 108 (46.15) 24 (20.51) 60 (21.28) 33 (28.20) 108 (46.15) 126 (53.84) 15 (12.83) 44 (37.61) 58 (49.58) 74 (31.63) 160 (68.38)
8 (12.69) 35 (55.55) 20 (31.74) 51 (40.47) 75 (59.52) 27 (42.85) 23 (36.50) 13 (20.63) 77 (61.11) 49 (38.88) 13 (20.63) 28 (44.44) 22 (34.92) 54 (42.86) 72 (57.14) 9 (14.29) 21 (33.34) 33 (52.38) 39 (30.96) 87 (69.05)
27 (15) 83 (46.11) 70 (38.89) 137 (38.06) 223 (61.94) 67 (37.23) 69 (38.34) 44 (24.45) 203 (56.38) 157 (43.62) 37 (20.56) 88 (48.89) 55 (30.56) 162 (45) 198 (55) 24 (13.34) 65 (36.12) 91 (50.56) 113 (31.39) 247 (68.62)
P1 value
P2 value
P3 value
0.177 0.280 0.045⁎ 0.032⁎
0.13 0.88 0.37 0.15
0.77 0.048⁎ 0.027⁎
0.843 0.388 0.213 0. 379
0.03⁎ 0.53 0.084 0.011⁎⁎
0.062 0.087 0.90 0.177
0.541 0.804 0.432 0.385
0.64 0.55 0.81 0.90
0.206 0.68 0.57 0.28
0.29 0.62 0.25 0.15
0.27 0.89 0.41 0.24
0.35 0.92 0.49 0.31
0.085
P1 value = indicates the difference between reject and non-reject groups. P2 value = indicates the difference between reject and non-reject groups in male patients. P3 value = indicates the difference between reject and non-reject groups in female patients. ⁎ Considered significant with P value threshold of 0.05. ⁎⁎ Considered significant after the Bonferroni correction (P value threshold of 0.017).
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
49
Table 5 The frequencies of IL-17, IL-21 and IL-23R genotypes and alleles in kidney transplant patients received allograft from living patients. SNP (rs)
rs2275913 IL-17 (G-197A)
rs10889677 IL-23R (C/A)
rs2055979 IL-21G1472T
rs4833837 IL-21C5250T
Genotype
AA AG GG A allele G allele AA AC CC A allele C allele TT TG GG T allele G allele CC CT TT C allele T allele
(Living) acute rejection
(Living) non-acute rejection
Male n (%)
Female n (%)
Total n (%)
Male n (%)
Female n (%)
Total n (%)
1 (6.66) 6 (40) 8 (53.33) 8 (26.66) 22 (73.33) 7 (46.66) 5 (33.33) 3 (20) 19 (63.33) 11 (36.66) 4 (26.66) 5 (33.33) 6 (40) 13 (43.33) 17 (56.66) 0 7 (46.66) 8 (26.66) 7 (23.33) 23 (76.66)
1 (7.69) 3 (23.07) 9 (69.23) 5 (19.23) 21 (80.76) 4 (30.76) 4 (30.76) 5 (38.46) 12 (46.18) 14 (53.84) 1 (7.69) 6 (46.15) 6 (46.15) 8 (30.76) 18 (69.23) 0 2 (15.38) 11 (84.61) 2 (7.69) 24 (92.30)
2 (7.14) 9 (32.14) 17 (60.71) 13 (23.21) 43 (76.78) 11 (39.28) 9 (32.14) 8 (28.57) 31 (55.35) 25 (44.64) 5 (17.85) 11 (39.28) 12 (42.85) 21 (37.5) 35 (62.5) 0 9 (32.14) 19 (67.85) 9 (16.07) 47 (83.92)
11 (16.92) 24 (36.92) 30 (46.15) 46 (35.38) 84 (64.61) 23 (35.38) 22 (33.84) 20 (30.76) 68 (52.30) 62 (47.69) 13 (20) 32 (49.23) 20 (30.76) 58 (44.61) 72 (55.38) 10 (15.38) 23 (35.38) 32 (49.23) 43 (33.07) 87 (66.92)
0 19 (70.37) 8 (29.62) 19 (35.18) 35 (64.81) 19 (70.37) 0 8 (29.62) 38 (70.37) 16 (29.62) 3 (11.11) 21 (77.77) 3 (11.11) 27 (50) 27 (50) 5 (18.51) 12 (44.44) 10 (37.03) 22 (40.74) 32 (59.25)
11 (11.95) 43 (46.73) 38 (41.30) 65 (65.32) 119 (64.67) 42 (45.65) 22 (23.91) 28 (30.43) 106 (57.60) 78 (42.39) 16 (17.39) 53 (57.60) 23 (25) 85 (46.19) 99 (53.80) 15 (16.30) 35 (38.04) 42 (45.65) 65 (35.32) 119 (64.67)
P1 value
P2value
P3 value
0.47 0.17 0.07 0.09
0.31 0.82 0.61 0.36
0.14 0.004⁎⁎ 0.01⁎⁎ 0.14
0.55 0.58 0.58 0.76
0.41 0.96 0.40 0.27
0.01⁎⁎ 0.002⁎⁎ 0.57 0.56
0.95 0.08 0.06 0.25
0.56 0.26 0.49 0.89
0.73 0.04⁎ 0.01⁎⁎
0.02⁎ 0.57 0.03⁎
0.10 0.41 0.77 0.29
0.09 0.07 0.004⁎⁎ 0.002⁎⁎
0.006⁎⁎
0.10
P1 value = indicates the difference between reject and non-reject groups in living patients. P2value = indicates the difference between reject and non-reject groups in male living patients. P3 value = indicates the difference between reject and non-reject groups in female living patients. ⁎ Considered significant with P value threshold of 0.05. ⁎⁎ Considered significant after the Bonferroni correction (P value threshold of 0.017).
and genotype. But there is a significant difference between IL-21G1472T serum level and genotype in non-rejection patients (P = 0.011).
3.3. ELISA results The mean of IL-17 level in normal population is 12.37 ± 2.6. There is no significant difference among normal population, reject and non-reject patients. Results of IL-17 showed that there is a significant difference between rejected and non-rejected groups (24.37 ± 32.94 for AR and 8.6 ± 9.9 for non-AR groups, respectively; P = 0.035). After gender categorization, the mean of IL-17 levels has remained statistically higher in female patients with acute rejection as compared to females in non-AR group (5.89 ± 3.66 for AR and 10.94 ± 12.05 for non-AR groups, respectively; P b 0.007). Also, the mean of IL-17 levels has remained statistically higher in male normal population as compared to male patients with acute rejection. IL-21 levels did not show any significant difference between rejected and non-rejected groups. Therefore we compared serum levels IL-17 and IL-21 with their genotypes. There is not any significant difference between IL-17 serum level
4. Discussion Th17 cells and their related cytokines have been implied as the major players in autoimmunity [11–14]. These cells have been reported to produce proinflammatory cytokines like IL-22, IL-21 and IL-17 [18]. Also, IL-23 promotes IL-17 expression and the proliferation of IL-17 — producing cells from a pool of memory T cells, thus playing an important role in maintaining Th17 effector function [10]. Cytokines are important
Table 6 The frequencies of IL-17,IL-21 and IL-23R genotypes and alleles in kidney transplant patient received allograft from cadaver patients. SNP (rs)
rs2275913 IL-17 (G-197A)
rs10889677 IL-23R (C/A)
rs2055979 IL-21G1472T
rs4833837 IL-21C5250T
Genotype
AA AG GG A allele G allele AA AC CC A allele C allele TT TG GG T allele G allele CC CT TT C allele T allele
(Cadaver) acute rejection
(Cadaver) non-acute rejection
Male n (%)
Female n (%)
Total n (%)
Male n (%)
Female n (%)
Total n (%)
1 (5.55) 8 (44.44) 9 (50) 10 (27.77) 26 (72.22) 11 (61.11) 6 (33.33) 1 (5.55) 28 (77.77) 8 (9.30) 4 (22.22) 10 (55.55) 4 (22.22) 18 (50) 18 (50) 2 (11.11) 5 (27.77) 11 (61.11) 9 (25) 27 (75)
3 (12.5) 10 (41.66) 11 (45.83) 16 (33.33) 32 (66.66) 5 (20.83) 16 (66.66) 3 (12.5) 26 (54.16) 22 (45.83) 3 (12.5) 12 (50) 9 (37.5) 18 (37.5) 30 (62.5) 3 (12.5) 10 (41.66) 11 (45.83) 16 (33.33) 32 (66.66)
4 (9.52) 18 (42.85) 20 (47.61) 26 (30.95) 58 (69.04) 16 (38.09) 22 (52.38) 4 (9.52) 54 (64.28) 30 (35.71) 7 (16.66) 22 (52.38) 13 (30.95) 36 (42.85) 48 (57.14) 5 (11.90) 15 (35.71) 22 (52.38) 25 (29.76) 59 (70.23)
8 (15.38) 24 (46.15) 20 (38.46) 40 (38.46) 64 (61.53) 17 (32.69) 24 (46.15) 11 (21.15) 58 (55.76) 46 (44.23) 11 (21.15) 28 (53.84) 13 (25) 50 (48.07) 54 (51.92) 5 (9.61) 21 (40.38) 26 (50) 31 (29.80) 73 (70.19)
8 (22.22) 16 (44.44) 12 (33.33) 32 (44.44) 40 (55.55) 8 (22.22) 23 (63.88) 5 (13.88) 39 (54.16) 33 (45.83) 10 (27.77) 7 (19.44) 19 (52.77) 27 (37.5) 45 (62.5) 4 (11.11) 9 (25) 23 (63.88) 17 (23.61) 55 (76.38)
16 (18.18) 40 (45.45) 32 (36.36) 72 (40.90) 104 (59.09) 25 (28.40) 47 (53.40) 16 (18.18) 97 (55.11) 79 (44.88) 21 (23.86) 35 (39.77) 32 (36.36) 77 (43.75) 99 (56.25) 9 (10.22) 30 (34.09) 49 (55.68) 48 (27.27) 128 (72.72)
P1 value
P2value
P3 value
0.20 0.78 0.22 0.12
0.28 0.90 0.39 0.24
0.34 0.83 0.32 0.22
0.26 0.91 0.20 0.16
0.03⁎ 0.34 0.13 0.01⁎⁎
0.89 0.82 0.87 1.00
0.35 0.17 0.54 0.89
0.92 0.90 0.81 0.84
0.15 0.01⁎ 0.24 1.00
0.77 0.85 0.73 0.67
0.85 0.34 0.41 0.73
0.86 0.17 0.16 0.24
P1 value = indicates the difference between reject and non-reject groups in cadaver patients. P2 value = indicates the difference between reject and non-reject groups in male cadaver patients. P3 value = indicates the difference between reject and non-reject groups in female cadaver patients. ⁎ Considered significant with P value threshold of 0.05. ⁎⁎ Considered significant after the Bonferroni correction (P value threshold of 0.017).
50
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51
Table 7 The frequency of IL-17/IL-21 genotype combinations in kidney transplant patients. Genotypes
Non-reject (n)
P value
OR
95% CI
IL-21C5250T & IL-17G-197A AA/CC 1 AA/CT 15 AA/TT 8 AG/CC 6 AG/CT 14 AG/TT 6 GG/CC 3 GG/CT 5 GG/TT 12
Reject (n)
2 8 15 12 37 37 11 21 37
0.83 0.00003⁎ 0.44 0.60 0.92 0.02⁎⁎
1.29 5.86 1.42 1.31 0.97 0.36 0.69 0.58 0.80
… 2.19–16.08 0.52–3.79 0.42–3.97 0.46–2.02 0.13–0.96 0.15–2.78 0.18–1.73 0.37–1.73
IL-21G1472T & IL-17G-197A AA/TT 0 AA/TG 18 AA/GG 6 AG/TT 7 AG/TG 12 AG/GG 7 GG/TT 5 GG/TG 5 GG/GG 10
8 12 5 30 40 16 14 25 30
0.07 0.00003⁎ 0.04⁎⁎
0 4.85 3.28 0.56 0.72 1.14 0.91 0.48 0.83
0–1.71 2.05–11.55 0.85–12.92 0.21–1.41 0.33–1.55 0.40–3.12 0.27–2.86 0.15–1.39 0.36–1.91
0.57 0.29 0.54
0.18 0.37 0.78 0.86 0.14 0.64
In genotypes, each P value results from comparisons of the values in the corresponding row with the sum of values in the other rows. N, absolute number; CI, confidence interval; OR, odds ratio. ⁎ Considered significant after the Bonferroni correction (P value threshold of 0.005). ⁎⁎ Considered significant with P value threshold of 0.05.
factors determining the outcome of transplantation [15]. Since host ability in cytokine production may be affected by cytokine gene polymorphisms, the aim of the present study was to investigate the effect of IL-21, IL-23R and IL-17 gene polymorphisms in the outcome of kidney transplantation. Our results showed that IL-17 GG carriers and G allele were significantly more frequent in patients with acute rejection as compared to patients without any sign of rejection. There are controversies about the association of genotypes of IL-17 in a different disease. Several studies have shown that in various kinds of cancers such as cervical cancer and gastric cancer, the frequency of rs2275913 AA genotype and A allele were significantly more than the control group [29–32]. Our results are consistent with the report of Nordang et al., who showed that the genotype distribution of IL17A gene (rs2275913) has an increased frequency for G allele among the rheumatoid arthritis (RA)
IL21(C5250T)
0/001
patients as compared with controls, and when analyzed in a recessive model, patients carrying the GG genotype showed an increased risk [33]. Also, in our study IL-17 serum levels have shown a significant difference between rejected and non-rejected groups. Studying acute renal rejection murine models displayed an elevation in IL-17 messenger RNA levels and IL-17 protein on the second day after transplantation [34]. IL-17 has been also detected in urine and tissue samples from patients with early acute renal rejection [18,24]. Similar observations have been made in heart transplant patients [35,36]. These results are consistent with the report of Crispim et al. who showed the higher level of IL-17 of rejecting patients in comparison to non-rejecting patients [37]. It is worth mentioning that exogenous factors such as infection, mental stress or different inflammations have an effect on serum level of IL-17. Therefore, the effect of these factors should also be taken into consideration. Also, in our study we evaluated the correlation of the serum level of IL-17 with its genotypes. There is not any significant difference between its serum level and genotype. Consistent to our study in 2012, it was shown that there is no significant difference between serum levels of IL-17 and genotypes in primary antiphospholipid syndrome (PAPS) patients [38]. After gender classification, IL-23R AA genotype and A allele were shown to have a significant association with kidney allograft rejection in male patients. Tsai et al. showed that polymorphisms of IL23R gene were associated with kidney transplant outcomes. Renal transplant recipients (RTRs) that carried the IL-23R AC/CC genotype and C allele had a higher risk of developing primary outcome as compared to those with IL-23R AA genotype and A allele, respectively [27]. Duan et al. could not find any significant differences in allele frequency of IL-23R (rs10889677) polymorphism between cases and controls in AS (ankylosing spondylitis) [39]. In our study a significant difference was not found between IL-21 gene polymorphisms in rejected and non-rejected kidney transplant patients. A significant association of the IL-21 gene polymorphism with atopic asthma was reported. The T allele of the C5250T SNP is a low producing allele, and this synonymous exonic variant is associated with atopic asthma and serum IgE levels (TsIgE levels) [40]. Up to now there is no study yet evaluating the relationship between IL-21 and transplantation, therefore we cannot compare our results. In conclusion, we suggest IL-17 promoter polymorphism in IL-17 as a regulatory cytokine could be a genetic risk factor for the development of acute rejection. Allograft rejection is a multifactor phenomenon, and cytokines have a major role in this aspect. Given that the 197A allele is significantly associated with the higher production of IL-17, G197A genotyping may be used to predict the susceptibility organ allograft rejection. Acknowledgment
IL21(G1472T)
0/368
This study was financially supported by the Transplant Research Center and Autoimmune Diseases Research Center, Shiraz University of Medical Sciences. Authors would like to thanks Mohammad-Reza Malekmakan for his help in performing PCR experiments. References
IL21(G1472T)
IL21(C5250T)
Fig. 1. Linkage disequilibrium plot of IL-21 polymorphisms in D′ value. Dark colored boxes are representative of high linkage disequilibrium (LD) and light colored boxes indicate low LD. The left upper boxes indicate the P values.
[1] Stepkowski SM. Immunobiology of allograft rejection. In: Kahan BD, Ponticielli C, editors. Principles and practice of renal transplantation. Malden, MA, USA: Blackwell Science Inc.; 2000. p. 41–87. [2] Romagnami S. The 1/Th2 paradigm. Immunol Today 1997;18:263–6. [3] Zhai Y, Ghobrial RM, Busuttil RW, Kupiec-Weglinski JW. Th1 and Th2 cytokines in organ transplantation: paradigm lost? Crit Rev Immunol 1999;19:155–72. [4] Amirzargar A, Lessanpezeshki M, Fathi A, Amirzargar M, Khosravi F, Ansaripour B, et al. Th1/Th2 cytokine analysis in Iranian renal transplant recipients. Transplant Proc 2005;37:2985–7. [5] Harrington LE, Mangan PR, Weaver CT. Expanding the effector CD4 T-cell repertoire: the Th17 lineage. Curr Opin Immunol 2006;18(3):349–56.
M.H. Karimi et al. / Transplant Immunology 30 (2014) 46–51 [6] Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, et al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 2005;6(11):1123–32. [7] Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 2005;6(11):1133–41. [8] Chen Z, Tato CM, Muul L, Laurence A, O'Shea JJ. Distinct regulation of interleukin-17 in human T helper lymphocytes. Arthritis Rheum 2007;56(9):2936–46. [9] Yang L, Anderson DE, Baecher-Allan C, Hastings WD, Bettelli E, Oukka M, et al. IL-21 and TGF-beta are required for differentiation of human T(H)17 cells. Nature 2008;454:350–2. [10] Tesmer LA, Lundy SK, Sarkar S, Fox DA. Th17 cells in human disease. Immunol Rev 2008;223:87–113. [11] Kotake S, Yago T, Kawamoto M, Nanke Y. Role of osteoclasts and interleukin-17 in the pathogenesis of rheumatoid arthritis: crucial ‘human osteoclastology’. J Bone Miner Metab 2012;30(2):125–35. [12] Wang YH, Wills-Karp M. The potential role of interleukin-17 in severe asthma. Curr Allergy Asthma Rep 2011;11(5):388–94. [13] Oh SH, Roh HJ, Kwon JE, Lee SH, Kim JY, Choi HJ, et al. Expression of interleukin-17 is correlated with interferon-α expression in cutaneous lesions of lupus erythematosus. Clin Exp Dermatol 2011;36(5):512–20. [14] Wang HH, Dai YQ, Qiu W, Lu ZQ, Peng FH, Wang YG, et al. Interleukin-17-secreting T cells in neuromyelitis optica and multiple sclerosis during relapse. J Clin Neurosci 2011;18(10):1313–7. [15] Loverre A, Divella C, Castellano G, Tataranni T, Zaza G, Rossini M, et al. T helper 1, 2 and 17 cell subsets in renal transplant patients with delayed graft function. Transpl Int 2011;24(3):233–42. [16] Li T, Si Z, Qi H, He Z, Li Y. IL-17 in the early diagnosis of acute renal allograft rejection in mice. Zhong Nan Da Xue Xue Bao Yi Xue Ban 2011;36(12):1147–52. [17] Taflin C, Favier B, Baudhuin J, Savenay A, Hemon P, Bensussan A, et al. Human endothelial cells generate Th17 and regulatory T cells under inflammatory conditions. Proc Natl Acad Sci U S A 2011;108(7):2891–6. [18] Deteix C, Attuil-Audenis V, Duthey A, Patey N, McGregor B, Dubois V, et al. Intragraft Th17 infiltrate promotes lymphoid neogenesis and hastens clinical chronic rejection. J Immunol 2010;184(9):5344–51. [19] Abadja F, Atemkeng S, Alamartine E, Berthoux F, Mariat C. Impact of mycophenolic acid and tacrolimus on Th17-related immune response. Transplantation 2011;92(4):396–403. [20] Wang H, Zhong X, Wang K, Qiu W, Li J, Dai Y, et al. Interleukin 17 gene polymorphism is associated with anti-aquaporin 4 antibody-positive neuromyelitis optica in the Southern Han Chinese — a case control study. J Neurol Sci 2012;314(1–2):26–8. [21] Espinoza JL, Takami A, Nakata K, Onizuka M, Kawase T, Akiyama H, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS One 2011;6(10):e26229. [22] Kim SW, Kim ES, Moon CM, Park JJ, Kim TI, Kim WH, et al. Genetic polymorphisms of IL-23R and IL-17A and novel insights into their associations with inflammatory bowel disease. Gut 2011;60(11):1527–36. [23] Sawalha AH, Kaufman KM, Kelly JA, Adler AJ, Aberle T, Kilpatrick J, et al. Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus. Ann Rheum Dis 2008;67(4):458–61.
51
[24] Messaoudi S, Al-Khateeb GM, Dendana M, Sater MS, Jazia KB, Nouira M, et al. Genetic variations in the interleukin-21 gene and the risk of recurrent idiopathic spontaneous miscarriage. Eur Cytokine Netw 2011;22(2):123–6. [25] Zwiers A, Kraal L, van de Pouw Kraan TC, Wurdinger T, Bouma G, Kraal G. A variant of the IL-23R gene associated with inflammatory bowel disease induces loss of MicroRNA regulation and enhanced protein production. J Immunol 2012;188(4):1573–7. [26] Chien MH, Hsin CH, Shih-Shen Chou L, Chung TT, Lin CH, Weng MS, et al. Interleukin-23 receptor polymorphism as a risk factor for oral cancer susceptibility. Head Neck 2012;34(4):551–6. [27] Tsai JP, Yang SF, Wu SW, Hung TW, Tsai HC, Lian JD, et al. Association between interleukin 23 receptor polymorphism and kidney transplant outcomes: a 10-year Taiwan cohort study. Clin Chim Acta 2011;412(11–12):958–62. [28] Solez K, Colvin RB, Racusen LC, Haas M, Sis B, Mengel M, et al. Banff 07 classification of renal allograft pathology: updates and future directions. Am J Transplant 2008;8(4):753–60. [29] Arisawa T, Tahara T, Shiroeda H, Matsue Y, Minato T, Nomura T, et al. Genetic polymorphisms of IL17A and pri-microRNA-938, targeting IL17A 3′-UTR, influence susceptibility to gastric cancer. Hum Immunol 2012;73(7):747–52. [30] Hayashi R, Tahara T, Shiroeda H, Matsue Y, Minato T, Nomura T, et al. Association of genetic polymorphisms in IL17A and IL17F with gastro-duodenal diseases. J Gastrointestin Liver Dis 2012;21(3):243–9. [31] Quan Y, Zhou B, Wang Y, Duan R, Wang K, Gao Q, et al. Association between IL17 polymorphisms and risk of cervical cancer in Chinese women. Clin Dev Immunol 2012;2012:258293. [32] Zhou B, Zhang P, Wang Y, Shi S, Zhang K, Liao H, et al. Interleukin-17 gene polymorphisms are associated with bladder cancer in a Chinese Han population. Mol Carcinog 2013;52(1):871–8. [33] Nordang GB, Viken MK, Hollis-Moffatt JE, Merriman TR, Førre ØT, Helgetveit K, et al. Association analysis of the interleukin 17A gene in Caucasian rheumatoid arthritis patients from Norway and New Zealand. Rheumatology 2009;48:367–70. [34] Loong CC, Hsieh HG, Lui WY, Chen A, Lin CY. Evidence for the early involvement of interleukin 17 in human and experimental renal allograft rejection. J Pathol 2002;197(3):322–32. [35] Antonysamy MA, Fanslow WC, Fu F, Li W, Qian S, Troutt AB, et al. Evidence for a role of IL-17 in alloimmunity: a novel IL-17 antagonist promotes heart graft survival. Transplant Proc 1999;31(1–2):93. [36] Tang JL, Subbotin VM, Antonysamy MA, Troutt AB, Rao AS, Thomson AW. Interleukin-17 antagonism inhibits acute but not chronic vascular rejection. Transplantation 2001;72(2):27348–50. [37] Crispim JC, Grespan R, Martelli-Palomino G, Rassi DM, Costa RS, Saber LT, et al. Interleukin-17 and kidney allograft outcome. Transplant Proc 2009;41(5):1562–4. [38] Popovic-Kuzmanovic D, Novakovic I, Stojanovich L, Aksentijevich I, Zogovic N, Tovilovic G, et al. Increased activity of interleukin-23/interleukin-17 cytokine axis in primary antiphospholipid syndrome. Immunobiology 2013;218(2):186–91. [39] Duan Z, Pan F, Zeng Z, Zhang T, Wang S, Li G, et al. Interleukin-23 receptor genetic polymorphisms and ankylosing spondylitis susceptibility: a meta-analysis. Rheumatol Int 2012;32(5):1209–14. [40] Chatterjee R, Batra J, Ghosh B. A common exonic variant of Interleukin21 confers susceptibility to atopic asthma. Int Arch Allergy Immunol 2009;148(2):137–46.
