Tumor Biol. DOI 10.1007/s13277-015-3098-7
RESEARCH ARTICLE
Combined therapy with CTL cells and oncolytic adenovirus expressing IL-15-induced enhanced antitumor activity Yang Yan & Songyan Li & Tingting Jia & Xiaohui Du & Yingxin Xu & Yunshan Zhao & Li Li & Kai Liang & Wentao Liang & Huiwei Sun & Rong Li
Received: 18 July 2014 / Accepted: 9 January 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract Addition of immunoregulation factor to an oncolytic adenovirus being constructed is a developmental step in tumor gene therapy; however, cytokine IL-15 has not been frequently used as a potential cancer therapy agent. Here, we constructed an E2F-1 promoter oncolytic adenovirus based on type 5 adenovirus, which induces viral replication and proliferation in targeted tumor cells. We inserted the IL-15 gene into the E3 region of the model and found that human IL15 expressing oncolytic adenovirus (Ad-E2F/IL15) shows a more intense antitumor effect than simple oncolytic viruses (Ad-E2F) do. Precisely because IL-15 can activate natural killer (NK) cells, CD8+T cells, and other immune cells, in antitumor therapy, Ad-E2F/IL15 was used in combination with cytotoxic T lymphocytes (CTL) to create a virus that can induce IL-15 gene expression while lysing tumors and stimulating the activity and function of adoptive immune cells. The therapeutic effect of this therapy is clearly stronger than that of a single application of oncolytic viruses or CTL, and hence, it could be a potential new tumor therapy.
Electronic supplementary material The online version of this article (doi:10.1007/s13277-015-3098-7) contains supplementary material, which is available to authorized users. Y. Yan : S. Li : X. Du (*) : R. Li General Surgery Department, Chinese PLA General Hospital, 28 Fuxing Road, Haidian Beijing 100853, People’s Republic of China e-mail: [email protected] T. Jia Oral and Maxillofacial Surgery Department, Chinese PLA General Hospital, 28 Fuxing Road, Haidian Beijing 100853, People’s Republic of China Y. Xu (*) : Y. Zhao : L. Li : K. Liang : W. Liang : H. Sun Institute of General Surgery, Chinese PLA General Hospital, 28 Fuxing Road, Haidian Beijing 100853, People’s Republic of China e-mail: [email protected]
Keywords CTL cells . IL-15 . Oncolytic adenovirus
Introduction Oncolytic viruses, which are genetically modified adenoviruses, kill tumor cells while avoiding normal cells and have become a new candidate for tumor treatment [1]. Budding viruses produced by lytic tumor cells further inhibit surrounding tumor cells. Moreover, cell lysates and cytokines can also influence the tumor microenvironment and improve tumor immunosuppression status [2]. Some clinical trials showed that the antitumor effect of a single application of oncolytic viruses is not an ideal tumor therapy [3]. Additionally, some researchers inserted immune regulatory genes into the viral genome, enabling it to release immune factors while directly killing tumor cells and optimize the antitumor immunologic reaction, which has become a new approach for antitumor Bvirus-gene^ strategies [4, 5]. IL-15 is a very promising cytokine for tumor treatment [6, 7]. It has been well-documented that IL-15 can not only promote the activity of neutrophils and macrophages, but it also plays a key role in the function of dendritic cells (DCs) [8]. However, it can also promote lymphatic effector cells, especially the generation, activation, homing, and survival of natural killer (NK), NKT, B, and CD8+ T cells [9–11]. In particular, IL-15 is a chemical inducer of T cells to produce cytokines and receptors, which can promote T cell proliferation, inhibit the apoptosis of activated T cells [12], promote the generation of memory T cells, maintain the vitality of amplificated cytotoxic T lymphocytes (CTL) cells and augment its cytotoxicity for a long time [13], and induce the T cells to produce cytokines, including IFN-γ and TNF-α, to enhance its tumor killing activity [14, 15]. To use the positive immune regulation role of IL-15, some researchers applied it to antitumor immune therapy or oncolytic virus construction for enhanced antitumor effect [16–18].
Tumor Biol.
Developing tumor combination therapies has become a dominant feature in improving tumor therapy [19–21]. In recent years, cellular level-based immunotherapy has been rapidly developed, and immune cells, including DCs as well as CIK, CTL, and NK cells, were all used in antitumor therapy [22–26]. Among them, CTL cells, which were obtained and cultured from human peripheral blood mononuclear cells (PBMCs), possess strong tumor specificity and exhibit stable antitumor effect in clinical trials [27, 28]. On combining the oncolytic virus with adoptive cellular immunotherapy, the oncolytic virus could infect, replicate, and kill tumor cells at the same time, effectively promoting the efficient expression of therapeutic genes to stimulate the activity of immune cells (e.g., DCs and CIK cells), resulting in the activation of the systemic immune response and improving the antitumor effect [29, 30]. In our previous work, we constructed an E2F-1 genetargeted oncolytic adenovirus in combination with CIK cells that has been used in colorectal cancer therapy, and we observed strong antitumor effect [31]. In addition to further understanding IL-15 function and the clinical application prospects of CTL cells, here we constructed a new IL-15 expression oncolytic adenovirus to investigate its antitumor effect in combination with CTL cells and to provide new experimental evidence for comprehensive cancer treatment.
(Gibco, Inc.), 4 mM glutamine, 50 U/mL penicillin, and 50 mg/mL streptomycin at 37 °C in a humidified atmosphere with 5 % CO2. Virus construction The virus skeleton plasmid PPE3, PXC20 plasmids containing the E1 gene, P55-E2Fp carrier (carrying the E2F-1 gene promoter regulation sequence), and IL-15 gene carrying a PENTER12-hIL2SPIL15 plasmid were constructed by the laboratory at the Eastern Hepatobiliary Hospital (Shanghai, China). The P55-E2Fp and PXC20 plasmids were treated with EcoRI+XhoI, the positive clones of plasmid DNA were extracted, and the enzyme-identified plasmid was named PXC20-E2Fp. LR restructured the PENTER12-hIL2SPIL15 plasmid with PPE3-RC, and extracted positive clones of plasmid DNA and enzyme-identified plasmids were named as PPE3-hIL2SPIL15. The above constructed PXC20-E2Fp was cotransfected with the PPE3-hIL2SPIL15 plasmid into HEK293 cells using Lipofectamine2000 (Gibco Inc.); after virus plaque purification, the identified adenovirus was termed as Ad-E2F1/IL15. At the same time, the replication defect-type adenovirus Ad-EGFP was selected as a control virus. PCR identification and amplification of the virus
Materials and methods Ethics statement The animals were all raised in a specific pathogen-free (SPF) environment. All the procedures were conducted according to protocols approved by the Animal Care and Use Committee of the Chinese PLA General Hospital and conformed to the NIH guidelines on the ethical use of animals. Cell lines and cell culture Human embryonic lung fibroblast cell line Wi38, human glioblastoma cell line U87MG, and human gastric cancer cell line BGC823 were purchased from Peking Union Medical College in China. Human colorectal cancer cell lines SW620 and HCT116, human embryo kidney cell lines HEK293 and 293T, and mouse colon cancer cell line CT26 were purchased from the American Tissue Culture Collection (ATCC, Manassas, VA, USA). Wi38 and U87MG were cultured in minimum essential medium (MEM) with Earle’s balanced salt solution containing 0.1 mM of nonessential amino acids, and 10 % heat-inactivated fetal bovine serum (FBS; Gibco Inc.). The other cell lines were cultured in Dulbecco’s modified essential medium (DMEM) supplemented with 10 % heat-inactivated fetal bovine serum (FBS)
The extraction of recombinant adenovirus DNA using a QIAamp DNA Blood Mini Kit (QIAGEN Co.) was performed by a previously described method [32]. The PCR primers for E2F-1 were forward (5′GTTTCATCCGGACAAAGCC3′) and reverse (5′CTCGAGGATATCATCGAG3′), and those for IL-15 were forward (5′ACGCGTCGACTTATCAAGAA GTGTTGATGAACATTTG3′) and reverse (5′CCGGAATT CGCCACCATGTACAGGATGCAACTCCTGTCTTGCAT T3′). Identified virus Ad-E2F1 and Ad-E2F1/IL15 preservation solution was added to 293 cells, and they were cultivated for 72 h, freeze-thawed into −20∼37 °C to lyse the cells three times, supernatant was collected and was repeatedly amplified to obtain the ideal viral load, and the virus was purified using the conventional cesium chloride gradient centrifugation method. The viral titer was determined using a 50 % tissue culture infection dose method [33]; viruses were then subpackaged and stored at −80 °C. CTL cell preparation CTL cells were prepared as described by a previous method [34, 35]. Briefly, separated and cultivated healthy volunteers’ peripheral blood mononuclear cells (PBMCs), which were adherence cultured in the serum-free Cellix 901 (TBD, Tianjin, China) medium for 3 h, were used. The adherent cells were exposed
Tumor Biol.
to fresh Cellix 901 medium containing rh-IL-4 (1000 U/ mL) and GM-CSF (1000 U/mL) every other day for 7 days. Then, the adherent cells were loaded with SW620 tumor cell lysate (20 μg/mL) in the presence of 3 μg/mL of Pseudomonas aeruginosa (Weikexi, Haikou, China) and cultured for 48 h. The DCs were harvested, washed, and stained with fluorescentconjugated antibodies against CD80, CD83, CD86, and HLA-DR (Becton Dickinson, San Diego, CA, USA), and flow cytometry analysis was then performed using a FACScan (Becton Dickinson). After the second collection of volunteers’ blood, the separated PBMCs were cocultivated with the Ag-pulsed DCs mentioned above and cultured for 14 days, according to CIK cell cultivation method [36]. The phenotypes of the CTL cells were characterized by flow cytometry analysis using antibodies against CD3, CD4, CD8, and CD56 (Becton Dickinson). Cell survival assay Cells were plated in 96-well plates and treated with various adenoviruses. At the indicated times, the cells were incubated with 3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide (MTT; 15 μL/well; Sigma) [37, 38]. After 4 h, the test was ended by adding 150 μL of dimethyl sulfoxide into each well, after which the plate was shaken in the dark for 15 min. The supernatant (100 μL) was pipetted into another 96-well plate, and its optical density at 490 nm was determined using an enzyme-linked immunosorbent assay (ELISA) reader (Bio-Tek Instruments, Inc.). Cell proliferation was directly determined by crystal violet staining assay [39]. Cell cycle analysis The cellular DNA content was analyzed using the Cycle TESTTM PLUS DNA Reagent Kit (Becton Dickinson) according to the manufacturer’s protocol as described previously [31]. Detection of IL-15 by ELISA The detection of human hIL-15 (P70) in the cell culture supernatant or tissues was performed using an ELISA kit (R&D Systems), according to the manufacturer’s instructions [16].
manufacturer’s protocol [36]. The following formula was used to calculate cytotoxicity: %Cytotoxicity=[A (Experimental)− A (Effector Spontaneous)−A (Target Spontaneous)]×100/[A (Target maximum)−A (Target spontaneous)]. In vivo antitumor experiment of different adenoviruses Male BALB/c nude mice (60 weeks old) obtained from the Laboratory Animal Center of the Academy of Military Medical Sciences (Beijing, China) were used in all the experiments. Aliquots of SW620 cells (1×106) were subcutaneously injected into the lower right flank of the nude mice. When the tumors were 40–50 mm3, the animals were randomized into four treatment groups. Intratumoral injection of phosphate buffered saline (PBS) or Ad-EGFP, Ad-E2F, and Ad-E2F/IL15 (5×108 PFU) was administered to each group every other day, at a specific time; in total, three injections were administered. Tumors were measured every 3 days, and tumor volume was calculated according to the following equation: V (mm3)=(width2 ×length)/2. Immunohistochemistry Deparaffinized tissue sections were treated with antihuman E2F-1 monoclonal antibody (Abcam). After incubation with the appropriate secondary antibody system (UltraVision Quanto Detection System HRP, Thermo), the protein bands were detected using 3′3-diaminobenzidine (Sigma) enhancement. The slides were counterstained with hematoxylin. Ad-E2F/IL15-combined CTL cell in vivo antitumor experiment As in the methods described above, when tumors grew to 120–150 mm3, the animals were randomized into four treatment groups. The groups were treated with PBS, 5×108 IFU of Ad-E2F/IL15 by intratumoral injection, 1×107 CTL cells by intravenous injection, or intravenous injection of 1×107 CTL cells combined with intratumoral injection of 5×108 Ad-E2F/IL15 particles every other day at a specific time, thus totaling to three such injections. Tumor size was measured and calculated every 3 days. Animals were sacrificed when the diameter of the tumor reached 17 mm or when the mean diameter was >15 mm. Statistical analyses
Cytolytic assay The cytotoxicity of CTL cells combined with Ad-E2F/IL15 against SW620 cells was tested using the lactate dehydrogenase (LDH) release assay (CytoTox 96 Non-Radioactive Cytotox ic ity Assay, Prome ga), acco rding to the
Data were expressed as mean±SD. The difference between groups was analyzed by ANOVA and a Student’s t test using the SPSS 19.0 statistical software (SPSS, Inc., Chicago, IL, USA). A p value of
RESEARCH ARTICLE
Combined therapy with CTL cells and oncolytic adenovirus expressing IL-15-induced enhanced antitumor activity Yang Yan & Songyan Li & Tingting Jia & Xiaohui Du & Yingxin Xu & Yunshan Zhao & Li Li & Kai Liang & Wentao Liang & Huiwei Sun & Rong Li
Received: 18 July 2014 / Accepted: 9 January 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract Addition of immunoregulation factor to an oncolytic adenovirus being constructed is a developmental step in tumor gene therapy; however, cytokine IL-15 has not been frequently used as a potential cancer therapy agent. Here, we constructed an E2F-1 promoter oncolytic adenovirus based on type 5 adenovirus, which induces viral replication and proliferation in targeted tumor cells. We inserted the IL-15 gene into the E3 region of the model and found that human IL15 expressing oncolytic adenovirus (Ad-E2F/IL15) shows a more intense antitumor effect than simple oncolytic viruses (Ad-E2F) do. Precisely because IL-15 can activate natural killer (NK) cells, CD8+T cells, and other immune cells, in antitumor therapy, Ad-E2F/IL15 was used in combination with cytotoxic T lymphocytes (CTL) to create a virus that can induce IL-15 gene expression while lysing tumors and stimulating the activity and function of adoptive immune cells. The therapeutic effect of this therapy is clearly stronger than that of a single application of oncolytic viruses or CTL, and hence, it could be a potential new tumor therapy.
Electronic supplementary material The online version of this article (doi:10.1007/s13277-015-3098-7) contains supplementary material, which is available to authorized users. Y. Yan : S. Li : X. Du (*) : R. Li General Surgery Department, Chinese PLA General Hospital, 28 Fuxing Road, Haidian Beijing 100853, People’s Republic of China e-mail: [email protected] T. Jia Oral and Maxillofacial Surgery Department, Chinese PLA General Hospital, 28 Fuxing Road, Haidian Beijing 100853, People’s Republic of China Y. Xu (*) : Y. Zhao : L. Li : K. Liang : W. Liang : H. Sun Institute of General Surgery, Chinese PLA General Hospital, 28 Fuxing Road, Haidian Beijing 100853, People’s Republic of China e-mail: [email protected]
Keywords CTL cells . IL-15 . Oncolytic adenovirus
Introduction Oncolytic viruses, which are genetically modified adenoviruses, kill tumor cells while avoiding normal cells and have become a new candidate for tumor treatment [1]. Budding viruses produced by lytic tumor cells further inhibit surrounding tumor cells. Moreover, cell lysates and cytokines can also influence the tumor microenvironment and improve tumor immunosuppression status [2]. Some clinical trials showed that the antitumor effect of a single application of oncolytic viruses is not an ideal tumor therapy [3]. Additionally, some researchers inserted immune regulatory genes into the viral genome, enabling it to release immune factors while directly killing tumor cells and optimize the antitumor immunologic reaction, which has become a new approach for antitumor Bvirus-gene^ strategies [4, 5]. IL-15 is a very promising cytokine for tumor treatment [6, 7]. It has been well-documented that IL-15 can not only promote the activity of neutrophils and macrophages, but it also plays a key role in the function of dendritic cells (DCs) [8]. However, it can also promote lymphatic effector cells, especially the generation, activation, homing, and survival of natural killer (NK), NKT, B, and CD8+ T cells [9–11]. In particular, IL-15 is a chemical inducer of T cells to produce cytokines and receptors, which can promote T cell proliferation, inhibit the apoptosis of activated T cells [12], promote the generation of memory T cells, maintain the vitality of amplificated cytotoxic T lymphocytes (CTL) cells and augment its cytotoxicity for a long time [13], and induce the T cells to produce cytokines, including IFN-γ and TNF-α, to enhance its tumor killing activity [14, 15]. To use the positive immune regulation role of IL-15, some researchers applied it to antitumor immune therapy or oncolytic virus construction for enhanced antitumor effect [16–18].
Tumor Biol.
Developing tumor combination therapies has become a dominant feature in improving tumor therapy [19–21]. In recent years, cellular level-based immunotherapy has been rapidly developed, and immune cells, including DCs as well as CIK, CTL, and NK cells, were all used in antitumor therapy [22–26]. Among them, CTL cells, which were obtained and cultured from human peripheral blood mononuclear cells (PBMCs), possess strong tumor specificity and exhibit stable antitumor effect in clinical trials [27, 28]. On combining the oncolytic virus with adoptive cellular immunotherapy, the oncolytic virus could infect, replicate, and kill tumor cells at the same time, effectively promoting the efficient expression of therapeutic genes to stimulate the activity of immune cells (e.g., DCs and CIK cells), resulting in the activation of the systemic immune response and improving the antitumor effect [29, 30]. In our previous work, we constructed an E2F-1 genetargeted oncolytic adenovirus in combination with CIK cells that has been used in colorectal cancer therapy, and we observed strong antitumor effect [31]. In addition to further understanding IL-15 function and the clinical application prospects of CTL cells, here we constructed a new IL-15 expression oncolytic adenovirus to investigate its antitumor effect in combination with CTL cells and to provide new experimental evidence for comprehensive cancer treatment.
(Gibco, Inc.), 4 mM glutamine, 50 U/mL penicillin, and 50 mg/mL streptomycin at 37 °C in a humidified atmosphere with 5 % CO2. Virus construction The virus skeleton plasmid PPE3, PXC20 plasmids containing the E1 gene, P55-E2Fp carrier (carrying the E2F-1 gene promoter regulation sequence), and IL-15 gene carrying a PENTER12-hIL2SPIL15 plasmid were constructed by the laboratory at the Eastern Hepatobiliary Hospital (Shanghai, China). The P55-E2Fp and PXC20 plasmids were treated with EcoRI+XhoI, the positive clones of plasmid DNA were extracted, and the enzyme-identified plasmid was named PXC20-E2Fp. LR restructured the PENTER12-hIL2SPIL15 plasmid with PPE3-RC, and extracted positive clones of plasmid DNA and enzyme-identified plasmids were named as PPE3-hIL2SPIL15. The above constructed PXC20-E2Fp was cotransfected with the PPE3-hIL2SPIL15 plasmid into HEK293 cells using Lipofectamine2000 (Gibco Inc.); after virus plaque purification, the identified adenovirus was termed as Ad-E2F1/IL15. At the same time, the replication defect-type adenovirus Ad-EGFP was selected as a control virus. PCR identification and amplification of the virus
Materials and methods Ethics statement The animals were all raised in a specific pathogen-free (SPF) environment. All the procedures were conducted according to protocols approved by the Animal Care and Use Committee of the Chinese PLA General Hospital and conformed to the NIH guidelines on the ethical use of animals. Cell lines and cell culture Human embryonic lung fibroblast cell line Wi38, human glioblastoma cell line U87MG, and human gastric cancer cell line BGC823 were purchased from Peking Union Medical College in China. Human colorectal cancer cell lines SW620 and HCT116, human embryo kidney cell lines HEK293 and 293T, and mouse colon cancer cell line CT26 were purchased from the American Tissue Culture Collection (ATCC, Manassas, VA, USA). Wi38 and U87MG were cultured in minimum essential medium (MEM) with Earle’s balanced salt solution containing 0.1 mM of nonessential amino acids, and 10 % heat-inactivated fetal bovine serum (FBS; Gibco Inc.). The other cell lines were cultured in Dulbecco’s modified essential medium (DMEM) supplemented with 10 % heat-inactivated fetal bovine serum (FBS)
The extraction of recombinant adenovirus DNA using a QIAamp DNA Blood Mini Kit (QIAGEN Co.) was performed by a previously described method [32]. The PCR primers for E2F-1 were forward (5′GTTTCATCCGGACAAAGCC3′) and reverse (5′CTCGAGGATATCATCGAG3′), and those for IL-15 were forward (5′ACGCGTCGACTTATCAAGAA GTGTTGATGAACATTTG3′) and reverse (5′CCGGAATT CGCCACCATGTACAGGATGCAACTCCTGTCTTGCAT T3′). Identified virus Ad-E2F1 and Ad-E2F1/IL15 preservation solution was added to 293 cells, and they were cultivated for 72 h, freeze-thawed into −20∼37 °C to lyse the cells three times, supernatant was collected and was repeatedly amplified to obtain the ideal viral load, and the virus was purified using the conventional cesium chloride gradient centrifugation method. The viral titer was determined using a 50 % tissue culture infection dose method [33]; viruses were then subpackaged and stored at −80 °C. CTL cell preparation CTL cells were prepared as described by a previous method [34, 35]. Briefly, separated and cultivated healthy volunteers’ peripheral blood mononuclear cells (PBMCs), which were adherence cultured in the serum-free Cellix 901 (TBD, Tianjin, China) medium for 3 h, were used. The adherent cells were exposed
Tumor Biol.
to fresh Cellix 901 medium containing rh-IL-4 (1000 U/ mL) and GM-CSF (1000 U/mL) every other day for 7 days. Then, the adherent cells were loaded with SW620 tumor cell lysate (20 μg/mL) in the presence of 3 μg/mL of Pseudomonas aeruginosa (Weikexi, Haikou, China) and cultured for 48 h. The DCs were harvested, washed, and stained with fluorescentconjugated antibodies against CD80, CD83, CD86, and HLA-DR (Becton Dickinson, San Diego, CA, USA), and flow cytometry analysis was then performed using a FACScan (Becton Dickinson). After the second collection of volunteers’ blood, the separated PBMCs were cocultivated with the Ag-pulsed DCs mentioned above and cultured for 14 days, according to CIK cell cultivation method [36]. The phenotypes of the CTL cells were characterized by flow cytometry analysis using antibodies against CD3, CD4, CD8, and CD56 (Becton Dickinson). Cell survival assay Cells were plated in 96-well plates and treated with various adenoviruses. At the indicated times, the cells were incubated with 3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide (MTT; 15 μL/well; Sigma) [37, 38]. After 4 h, the test was ended by adding 150 μL of dimethyl sulfoxide into each well, after which the plate was shaken in the dark for 15 min. The supernatant (100 μL) was pipetted into another 96-well plate, and its optical density at 490 nm was determined using an enzyme-linked immunosorbent assay (ELISA) reader (Bio-Tek Instruments, Inc.). Cell proliferation was directly determined by crystal violet staining assay [39]. Cell cycle analysis The cellular DNA content was analyzed using the Cycle TESTTM PLUS DNA Reagent Kit (Becton Dickinson) according to the manufacturer’s protocol as described previously [31]. Detection of IL-15 by ELISA The detection of human hIL-15 (P70) in the cell culture supernatant or tissues was performed using an ELISA kit (R&D Systems), according to the manufacturer’s instructions [16].
manufacturer’s protocol [36]. The following formula was used to calculate cytotoxicity: %Cytotoxicity=[A (Experimental)− A (Effector Spontaneous)−A (Target Spontaneous)]×100/[A (Target maximum)−A (Target spontaneous)]. In vivo antitumor experiment of different adenoviruses Male BALB/c nude mice (60 weeks old) obtained from the Laboratory Animal Center of the Academy of Military Medical Sciences (Beijing, China) were used in all the experiments. Aliquots of SW620 cells (1×106) were subcutaneously injected into the lower right flank of the nude mice. When the tumors were 40–50 mm3, the animals were randomized into four treatment groups. Intratumoral injection of phosphate buffered saline (PBS) or Ad-EGFP, Ad-E2F, and Ad-E2F/IL15 (5×108 PFU) was administered to each group every other day, at a specific time; in total, three injections were administered. Tumors were measured every 3 days, and tumor volume was calculated according to the following equation: V (mm3)=(width2 ×length)/2. Immunohistochemistry Deparaffinized tissue sections were treated with antihuman E2F-1 monoclonal antibody (Abcam). After incubation with the appropriate secondary antibody system (UltraVision Quanto Detection System HRP, Thermo), the protein bands were detected using 3′3-diaminobenzidine (Sigma) enhancement. The slides were counterstained with hematoxylin. Ad-E2F/IL15-combined CTL cell in vivo antitumor experiment As in the methods described above, when tumors grew to 120–150 mm3, the animals were randomized into four treatment groups. The groups were treated with PBS, 5×108 IFU of Ad-E2F/IL15 by intratumoral injection, 1×107 CTL cells by intravenous injection, or intravenous injection of 1×107 CTL cells combined with intratumoral injection of 5×108 Ad-E2F/IL15 particles every other day at a specific time, thus totaling to three such injections. Tumor size was measured and calculated every 3 days. Animals were sacrificed when the diameter of the tumor reached 17 mm or when the mean diameter was >15 mm. Statistical analyses
Cytolytic assay The cytotoxicity of CTL cells combined with Ad-E2F/IL15 against SW620 cells was tested using the lactate dehydrogenase (LDH) release assay (CytoTox 96 Non-Radioactive Cytotox ic ity Assay, Prome ga), acco rding to the
Data were expressed as mean±SD. The difference between groups was analyzed by ANOVA and a Student’s t test using the SPSS 19.0 statistical software (SPSS, Inc., Chicago, IL, USA). A p value of
