Gene 560 (2015) 226–236

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Comparative analysis of sequence feature and expression of two heat shock cognate 70 genes in mandarin fish Siniperca chuatsi Pengfei Wang a,b, Peng Xu a, Shuang Zeng a, Lei Zhou a, Lei Zeng a, Guifeng Li a,⁎ a b

Institute of Aquatic Economic Animals and Guangdong Province Key Laboratory for Aquatic Economic Animals, School of Life Sciences, Sun Yat-sen University, Guangzhou 510006, China South China Sea Fisheries Research Institute, Chinese Academy of Fishery Science, Guangzhou 510300, China

a r t i c l e

i n f o

Article history: Received 23 September 2014 Received in revised form 28 January 2015 Accepted 5 February 2015 Available online 8 February 2015 Keywords: Siniperca chuatsi HSC70 Heat shock Hypoxia Aeromonas hydrophila

a b s t r a c t Heat shock cognate protein 70 (HSC70) is a molecular chaperone that plays essential roles in maintaining the cellular protein homeostasis. In this study, two HSC70 isoforms were identified and characterized from mandarin fish Siniperca chuatsi. They have similar sequence structures, containing seven introns in their coding regions and sharing 94% similarity of their deduced amino acid sequences with 38 substitutions. Transcripts of both isoforms were detected throughout the embryogenesis, at low levels during the early developmental stages and upregulated at blastula for ScHSC70-1 and appearance of myomere stage for ScHSC70-2. They were ubiquitously expressed in tissues under normal conditions, whereas with tissue-specific variation. Following acute heat shock at 34 °C, the expression of ScHSC70-1 showed no significant changes in the liver, and just a modest increase in the heart and head kidney, while the ScHSC70-2 mRNA levels were markedly up-regulated in these tissues. Compared with their expression under gradual heat shock, the ScHSC70-2 mRNA was rising at a higher rate under fast heat shock, whereas the ScHSC70-1 mRNA increasing rate was lower under fast heat shock. Under hypoxia, transcripts of ScHSC70-1 were not significantly changed, while the expression of ScHSC70-2 was suppressed. Aeromonas hydrophila infection significantly increased the ScHSC70-1 mRNA levels in the head kidney and spleen on early infective stages, while failed to have any significant impact on the expression of ScHSC70-2 in both immune tissues. These results suggest that ScHSC70-1 and ScHSC70-2 are differently involved in the embryogenesis and the stress responses of high temperature, hypoxia and bacterial infection. This study will contribute to further study on enhancing stress tolerance and disease resistance of mandarin fish. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Heat shock proteins (HSPs), an evolutionary conserved multigene family of proteins, are ubiquitously essential molecular chaperones that maintain cellular protein homeostasis under normal and stress conditions (Basu et al., 2002; Roberts et al., 2010; Yamashita et al., 2010). HSPs are generally classified into HSP100, HSP90, HSP70, HSP60 and the small HSP families based on sequence homologies and molecular weights (Roberts et al., 2010). In the 70 kDa heat shock protein family, HSC70 is the constitutively expressed form, which is actively expressed under non-stressed cells and remains unchanged or only mildly induced upon stressful stimuli, while HSP70 is highly induced during stress (Erbse et al., 2004). HSC70 shares some of the structural and functional similarity with HSP70 and as molecular chaperones, Abbreviations: bp, base pare; BW, body weight; DO, dissolved oxygen; dph, day posthatching; HRE, hypoxia response element; HSC, heat shock cognate protein; HSE, heat shock element; HSP, heat shock protein; MBT, midblastula transition period; ORF, open reading frame; PBS, phosphate buffered saline; RACE, rapid amplification of cDNA end; UTR, untranslated region. ⁎ Corresponding author at: School of Life Sciences, Sun Yat-sen University, No. 132, East Outer Ring Road, Guangzhou University City, Guangzhou 510006, China. E-mail address: [email protected] (G. Li).

http://dx.doi.org/10.1016/j.gene.2015.02.007 0378-1119/© 2015 Elsevier B.V. All rights reserved.

they play important roles in protein folding/unfolding, assembly/ disassembly, degradation and translocation, and are also involved in cellular protection when suffered with various stresses (Erbse et al., 2004; Liu et al., 2012; Yan et al., 2010). However, HSC70 also has its own functions in regulating apoptosis, embryo development and innate immune reactions (Dastoor and Dreyer, 2000; de la Rosa et al., 1998; Yan et al., 2010). In the HSP70 family, HSP70 has been well studied on its regulation effects on the cellular resistance to stress (Ming et al., 2010), while compared with HSP70, much about HSC70 in this field remains to be known. Studies have shown that although the expression of HSC70 does not change or is only slightly up-regulated during stress, it does play pivotal roles in allowing cells to cope with stresses, including heat shock (Boone and Vijayan, 2002; Chu et al., 2001). In aquaculture, fish often encounter various environmental stresses, including changes in water temperature, pathogenic infection, hypoxia and heavy metals, sometimes even resulting in serious losses (Ming et al., 2010). Therefore, study on HSC70 in fish is of great significance to improving the animal's tolerance to environmental stresses. HSC70 genes from a number of fish species have been cloned and characterized, and their functions during different stresses were studied preliminarily. For instance, acute heat shock significantly induced the expression of HSC70 in silver sea bream (Sparus

P. Wang et al. / Gene 560 (2015) 226–236

sarba) and HSC70-2 in yellowtail (Seriola quinqueradiata) tailfin cells, suggesting that HSC70 might be responsible for cellular survival and adaptation under heat shock conditions (Deane and Woo, 2005; Yabu et al., 2011). The expression of HSC70 in Wuchang bream (Megalobrama amblycephala), walking catfish (Clarias macrocephalus) and humphead snapper (Lutjanus sanguineus) were significantly increased when challenged with pathogenic bacteria, indicating that HSC70 might be involved in the immune response and played vital roles in resisting pathogenic infections (Poompoung et al., 2014; Zhang et al., 2011). It is noted that there is more than one isoform of HSC70 in a same organism. Distinct HSC70 isoforms have been identified in several fish species, such as zebrafish (Danio rerio) (Graser et al., 1996; Santacruz et al., 1997), rainbow trout (Oncorhynchus mykiss) (Ojima et al., 2005; Zafarullah et al., 1992), carp (Cyprinus carpio) (Ali et al., 2003), yellowtail (Yabu et al., 2011), walking catfish (Poompoung et al., 2014) and tilapia (Oreochromis niloticus) (Zhang et al., 2014). Interestingly, distinct HSC70 isoforms exerted different expression profiles under both stressed and non-stressed conditions. For instance, HSC70-1 and HSC70-2 in carp were expressed as one predominantly in a “complementary” manner in some organs under normal conditions (Ali et al., 2003). After treated by Cd (cadmium acetate), the expression of HSC70-1 in liver of carp was markedly elevated, while the induction of HSC70-2 was relatively modest (Ali et al., 2003). Bacterial infection did not affect the expression of walking catfish HSC70-1 in most tissues whereas up-regulated the transcripts of HSC70-2 in a tissue-specific manner (Poompoung et al., 2014). Although different expression profiles between HSC70 isoforms have been found in given species, we don't know whether they exhibited similar differences in other fish species under the same or different stresses and how about their expression during the embryonic development. The mandarin fish is an important cultured fish in China. Various environmental stressors, including the high temperature, hypoxia and pathogenic infection, caused severe economic losses to the aquaculture industry. Crucial roles of heat shock proteins in resistance to stress in aquaculture have been increasingly concerned. However, little information regarding heat shock proteins is available in mandarin fish. To provide molecular basis for further study the mechanism of anti-adversity and improving the ability of stress tolerance and disease resistance of mandarin fish, we identified and characterized two ScHSC70 genes in the present study and comparatively studied their mRNA expression profiles on exposure to three heat shock regimes and acute hypoxia as well as challenged with Aeromonas hydrophila, the major bacterium caused bacterial hemorrhagic septicemia. 2. Materials and methods 2.1. Animals and sampling The mandarin fish were obtained from BaiRong Aquatic Breeding Co., Ltd. (Guangdong, China). All fish were reared for at least three weeks in a circulating water system containing a series of 2000 L water tanks in Sun Yat-sen University. The water temperature was maintained at 25 °C and the fish were fed with juvenile Cirrhinus molitorella at a ratio of approximately 5% of the total biomass before any experiment. The fish were anesthetized with tricaine methanesulfonate (MS-222) before tissue collection. Tissues were sampled quickly and snap-frozen in liquid nitrogen, and then stored at −80 °C until RNA extraction. 2.2. Total RNA and genomic DNA isolation Total RNA from tissues or embryos was isolated using E.Z.N.A. total RNA kit II (Omega Bio-Tec, USA) according to the manufacturer's instructions. Genomic DNA was extracted from the muscle using a TIANamp Genomic DNA Kit (Tiangen Biotech, China). The quality and quantity of RNA and DNA were assessed by the OD260/OD280 method and electrophoresis in 1% agarose gel.

227

2.3. Full-length cDNA cloning and genomic DNA amplification Nested PCR was used to obtain the intermediate fragments of Siniperca chuatsi HSC70 cDNAs. The first-strand cDNA was synthesized from total RNA with the First-Strand cDNA Synthesis Using M-MLV for RT-PCR kit (Invitrogen, USA). A mixture of cDNAs from multiple tissues (heart, liver, head kidney, gill and muscle) was used as the template. Two pairs of degenerate primers were designed and listed in Table 1. Amplification conditions of the nested PCR were: an initial preheating at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 50 °C (for the 1st round PCR) or 55 °C (for the 2nd round PCR) for 30 s, and elongation at 72 °C for 2 min, with a final extension at 72 °C for 10 min. Amplified PCR products were purified using a TIANgel Midi Purification Kit (Tiangen Biotech, China), and cloned into a pEASY-T1 vector using the TA cloning kit (TransGen Biotech, China). Recombinants were identified by blue/white screening and confirmed by PCR, and nine positive ones were selected and sequenced. For 3′-RACE PCR, cDNA template was obtained from total RNA transcribed with the primer Oligo (dT)20. Based on intermediate fragments of the two distinct HSC70 cDNAs, forward gene-specific primers (Table 1) were designed for the two rounds of 3′-RACE PCR. An anchor primer (AP) and an abridged universal amplification primer (AUAP) were used as the reverse primers in the 1st and 2nd round, respectively. For 5′-RACE PCR, total RNAs were transcribed with primers of Oligo (dT)20 plus the random primer. The first-strand cDNA was purified using a Universal DNA purification Kit (Tiangen Biotech, China), and a poly(C) end was added to the 5′terminal with a terminal deoxynucleotidyl transferase (TaKaRa, Japan). Based on the intermediate fragments and the 3′-cDNA end sequences, reverse gene-specific primers (Table 1) for 5′-RACE PCR were designed. An abridged anchor primer (AAP) and AUAP were used as the forward primers in the 1st and 2nd round, respectively. Cycling parameters for the 1st round of 5′- and 3′-RACE PCR were one cycle of 94 °C for 3 min, followed by 35 cycles (94 °C for 30 s, 55 °C for 30 s, 72 °C for 3 min) and a final extension step at 72 °C for 10 min; In the 2nd round, the annealing temperature was up-regulated to 58 °C and the extension time was reduced to 2 min. Using the template of total genomic DNA and the primers that near the terminus of the full-length cDNAs (Table 1), the genomic DNAs of HSC70s were amplified. The PCRs were performed as follows: 94 °C for

Table 1 Primers and their applications in this study. Primer name

Primer sequences (5′–3′)

Objective

HSC-F1 HSC-R1 HSC-F2 HSC-R2 HSC70-1F1 HSC70-1F2 HSC70-1R1 HSC70-1R2 HSC70-2F1 HSC70-2F2 HSC70-2R1 HSC70-2R2 g-HSC70-1F g-HSC70-1R g-HSC70-2F g-HSC70-2R RT-HSC70-1F RT-HSC70-1R RT-HSC70-2F RT-HSC70-2R 18S-F 18S-R

GGNACYACCTACTCCTGYGTNGGa TTAGTCNAYCTCYTCRATGGTNGGa ATCATHGCCAAYGACCAGGGNAA TTRCAYACYTTCTCCARCTCCTT CGTAACACCACTATTCCTACCAAGCAG CGTCCAACGTGACAAGGTGTCG CAAGGCAGCGACATCTCAGTAT TGAACCTTTGGGCGAGTGTT GGAGGAGTCATGACTGTTCTCATTAAGAGG AAGGCTGAGGATGATGTGCAGAGAG CTCCTGAGAAGACCGCCTACCA GCAGGCACAGTCACTACAGCATT ATTCCAGACCCAACACCTAGTCAT CAAGGCAGCGACATCTCAGTAT ACACACAGACAGCGCGATATCAG CAGAAAAGCCACAGCGGAAG AGTGAGAGGCTGATCGGAGATG TGAACCTTTGGGCGAGTGTT TCTTCTCAGGAGACTATATTGCGTTC CGACCATTTCCACCACATAACC CTGAGAAACGGCTACCACATCC GCACCAGACTTGCCCTCCA

1st round intermediate fragment amplification 2nd round intermediate fragment amplification 1st round 3′-RACE 2nd round 3′-RACE 1st round 5′-RACE 2nd round 5′-RACE 1st round 3′-RACE 2nd round 3′-RACE 1st round 5′-RACE 2nd round 5′-RACE Genomic DNA cloning for HSC70-1 Genomic DNA cloning for HSC70-2 Real-time quantitative PCR Real-time quantitative PCR Real-time quantitative PCR

a

N, A/C/T/G; Y, C/T; R, A/G.

228

P. Wang et al. / Gene 560 (2015) 226–236

3 min; 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 6 min, followed by a final extension at 72 °C for 10 min. 2.4. Sequence analysis Nucleotide and amino acid sequences of other species were retrieved by the BLAST programs at the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/). The sequence assembly and alignment were carried out by the programs of Seqman and MegAlign from the LASERGENE V7.1.0 software suite (DNASTAR, USA), respectively. Protein sequences were aligned using Clustalx2.1 before the phylogenetic analysis. The phylogenetic tree was constructed using MEGA 6 software according to the neighbor-joining method (Hall, 2013). The molecular weight and isoelectronic point of protein sequences were calculated with Compute pI/Mw tool of ExPASy, and the protein motifs were searched with the program ScanProsite (http://us. expasy.org/tools/scanprosite/). 2.5. Expression of ScHSC70s in embryos and tissues Embryos at different stages including unfertilized eggs, fertilized eggs, 16-cell stage, morula, blastula, gastrula, closure of blastopore, appearance of myomere, tail-bud stage, muscle burl stage, blood circulating stage, crystal stage, pre-hatched larvae, 1-day post-hatching (dph) and 7-dph larvae incubated at 27 °C were collected and snap-frozen in liquid nitrogen. Tissues including the brain, heart, gill, head kidney, liver, spleen, muscle, stomach, intestines, opisthonephros and ovary of three female fish (150–160 g, body weight, BW) reared in nonstressed conditions were sampled. The expression of the two ScHSC70 isoforms in embryos and tissues were determined by real-time quantitative PCR. 2.6. Heat shock treatment To investigate the effect of heat shock on the gene expression, three heat shock regimes were conducted. For acute heat shock, the fish (140 ± 20 g, BW) maintained at 25 °C were directly shifted into a circulating water system with a constant temperature of 34 °C. Six fish were randomly collected after each heat treatment (2, 6 and 12 h), and another six individuals maintained at 25 °C served as the control group. In the other two heat shock regimes, fish were carefully transferred to the circulating water system (initial temperature: 25 °C) and then the water temperature was elevated from 25 to 38.8 °C at an average speed of 1.2 °C/h for fast heat shock and 0.2 °C/h for gradual heat shock. Six fish were randomly sampled when the temperature reached 34 °C, six more at 38.8 °C, and another six individuals maintained at 25 °C were taken as the control group. 2.7. Hypoxia exposure The fish (130 ± 20 g, BW) acclimated to the normal oxygen environment (dissolved oxygen, DO: N5.6 mg/L) were carefully shifted into a circulating water system with a constant OD of 0.9 ± 0.1 mg/L, which was maintained by controlling the water and nitrogen inflows. Dissolved oxygen was monitored in real-time using an YSI Model 550A dissolved oxygen meter (Geo Scientific Ltd, USA). Six individuals from the treatment were randomly collected and tissues were sampled at 2, 6 and 12 h of hypoxia, respectively, and another six individuals maintained at normal oxygen environment served as the control group. 2.8. Bacterial challenge Sixty healthy fish (140 ± 15 g, BW) were used for challenge of virulent bacteria A. hydrophila, provided by MOE Key Laboratory of Aquatic Product Safety, Sun Yat-sen University. Each fish was intraperitoneally injected with a total of 0.5 mL of A. hydrophila (5 × 108 CFU/mL),

which were diluted with sterile phosphate buffer solution (PBS, pH 7.4). Another 30 fish injected with the same volume of aseptic PBS were used as the control group. Six individuals from the treatment and control groups were randomly collected and tissues were sampled at 6, 12, 24, 48 and 72 h after injection, respectively. 2.9. Real-time quantitative PCR Real-time quantitative PCR was used to quantify the mRNA expression according to MIQE validation guidelines (Bustin et al., 2009). 18S rRNA was selected as the reference gene for its stable expression in all situations in the present study. Specific primers (Table 1) were designed to amplify ScHSC70-1, ScHSC70-2 and 18S rRNA fragments. Total RNA from each sample was reverse-transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan). The amplification was performed on the LightCycler® 480 II Real-Time PCR System (Roche) using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa, Japan) in 384-well plates. The final reaction volume was 10 μL consisting 1 μL of cDNA sample (10 ng/μL), 0.4 μL of each gene-specific primer (10 μM), 3.2 μL of nuclease-free H2O and 5 μL of 2 × SYBR Premix Ex Taq II. All reactions were carried out in three technical replicates, from which mean threshold cycle (CT) values were calculated. Meanwhile, the reaction contained no cDNA sample instead by nuclease-free H2O was set as negative control. Based on Tm value of primer pairs, cycling conditions were designed as: initial denaturation step at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 58 °C for 20 s and extension at 72 °C for 30 s, then a dissociation curve step (95 °C for 1 s, 60 °C for 20 s and 95 °C for 1 s) was conducted to verify the specificity. Ten-fold serial dilutions of plasmid pEASY-T1 containing the target or reference genes were used to construct standard curves. Amplification efficiencies (E) were determined by employing the equation E = 10(−1 / Slope) − 1. Here, amplification efficiencies of ScHSC70-1, ScHSC70-2 and 18S rRNA were 101.1, 103.1 and 104.6%, respectively. 2.10. Statistical analysis The relative expression levels of ScHSC70-1 and ScHSC70-2 were determined by the comparative Ct method 2−ΔCt and analyzed with oneway analysis of variance (ANOVA) followed by Tukey's test. All statistical analyses were performed using the software of SPSS 18.0 (SPSS Inc., Chicago, IL, USA), P b 0.05 was considered as statistical significance. 3. Results 3.1. Cloning of two HSC70 isoforms in mandarin fish To identify whether the mandarin fish has one or more HSC70 paralogs, we designed degenerate primers based on the highly conserved regions of distinct HSC70 members from other fish species and used a mixture of cDNAs from multiple tissues as a template to amplify the intermediate fragments. Results showed that there were two distinct HSC70 intermediate fragments. By using the RACE strategy, 5′ and 3′-ends of the two HSC70 cDNAs were produced and their full lengths were obtained. BLAST analysis of their nucleotide and amino acid sequences revealed that they belong to HSC70-1 and HSC70-2 in the HSP70 family. The full length of ScHSC70-1 cDNA sequence (GenBank accession no. KF042289) was 2344 bp, consisting of a 5′-UTR of 97 bp, an ORF of 1953 bp and a 3′-UTR of 294 bp with a polyadenylation signal located 17 bases upstream the poly (A) tail. The complete cDNA sequence of ScHSC70-2 (GenBank accession no. KF017616) was 2468 bp in length, including a 5′-UTR of 153 bp, an ORF of 1953 bp and a 3′-UTR of 362 bp with a polyadenylation signal located 12 nucleotides upstream the poly (A) tail. The deduced proteins of both genes were composed of 650 amino acids, with calculated molecular masses of 71.28 kDa for

P. Wang et al. / Gene 560 (2015) 226–236

ScHSC70-1 and 71.25 kDa for ScHSC70-2, and their theoretical isoelectric points were 5.22 and 5.32, respectively. Using specific primers close to the terminus of ScHSC70-1 and ScHSC70-2 full-length cDNAs, their genomic sequences were obtained and deposited in GenBank under the accession numbers KF500540 and KF500541, respectively. The coding region of ScHSC70-1 was consisted of eight exons (206, 206, 152, 556, 203, 199, 233 and 195 bp) and seven introns (418, 82, 119,146, 193, 79 and 74 bp). Besides, there was an initial non-coding exon and a longest intron of 1024 bp within the 5′-UTR. Similar with the structure of ScHSC70-1, the coding region of ScHSC70-2 was also consisted of eight exons (205, 206, 153, 556, 203, 199, 233 and 195 bp) and seven introns (87, 464, 247, 103, 71, 94 and 122 bp), and there was also an initial non-coding exon and a longest intron of 2941 bp located at the 5′UTR (Fig. 1). 3.2. Characterization of amino acid sequences the ScHSC70s Amino acid sequence analysis showed that ScHSC70-1 and ScHSC70-2 had three identical characteristic signature motifs of the HSP70 family (IDLGTTYS, IFDLGGGTFDVSIL and IVLVGGSTRIPKIQK), and shared three major functional domains: N-terminal ATPase domain (amino acid, aa, 1–381), peptide binding domain (aa, 385–543) and C-terminal domain (aa, 537–620). The cytoplasmic characteristic EEVD motif at C-terminus and the non-organellar stress protein motif RARFEEL (Lo et al., 2004), as well as putative bipartite nuclear localization signals (KK and RRLRT) involved in the selective translocation into the nucleus were found in both sequences (Knowlton and Salfity, 1996). Four repeats of tetrapeptide, GGMPGGMPEGMPGGFP and GGMPGGMPGGMPGGFP were presented in the C-terminal region of ScHSC70-1 and ScHSC702, respectively (Fig. 2).

229

into two distinct groups based on HSC70s, here we referred to them as HSC70 group I and HSC70 group II. HSC70 group II contained Fugu rubripes (Takifugu rubripes) (XP_003966054), spotted green pufferfish (Tetraodon nigroviridis) (CAG12065), Atlantic salmon (Salmo salar) (NP_001135156), zebrafish (NP_956908) and carp (AAP51387) are basal branches of the phylogenetic tree, suggesting that HSC70 group II is an ancestral group of vertebrate HSC70s. On the other hand, HSC70 group I was further divided into fish HSC70-1 subgroup and HSC70-2 subgroup, ScHSC70-1 identified in this study is closely related to HSC71 of Fugu rubripes (XP_003977939), and nested within the HSC70-1 subgroup, while ScHSC70-2 is closely related to HSC71 of tilapia (XP_003455104), together with yellowtail (BAG82849), southern platyfish (Xiphophorus maculatus) (BAB72169), and Japanese medaka (Oryzias latipes) (XP_004075395, XP_004075396) made up HSC70-2 subgroup with good statistical support (Bootstrap value = 97%). Besides, other higher vertebrate HSC70s formed a well-supported clade and is the sister lineage to the HSC70 group I.

3.4. Expression patterns of ScHSC70s during embryonic development Both gene transcripts were detected constitutively throughout the embryogenesis, but at relatively low levels during the early developmental stages (stages 0–4 for ScHSC70-1 and stages 0–6 for ScHSC702) (Fig. 5). The expression of ScHSC70-1 was significantly increased from the gastrula stage, peaked at tail-bud stage and maintained at high levels until post-larvae. However, the ScHSC70-2 mRNA levels were significantly increased from the stage of appearance of myomere and peaked at crystal stage. Additionally, the ScHSC70-2 mRNA accumulation was much lower than that of ScHSC70-1 at every developmental stage.

3.3. Multiple sequence alignment and phylogenetic analysis 3.5. Tissue expression of ScHSC70s BLAST analysis revealed that ScHSC70-1 and ScHSC70-2 had 94% similarity with 38 substitutions and had high identities with HSC70s of other fish and vertebrates (Fig. 3). Deduced amino acid sequence of ScHSC70-1 showed a very high similarity of 99% with HSC70-1 of yellowtail and tilapia, and even 95% with HSC70 of humans and rats. The amino acid sequence of ScHSC70-2 shows 97% similarity with HSC702 of yellowtail and tilapia, and 93% similarity with HSC70 of humans and rats. Phylogenetic analysis of the amino acid sequences of ScHSC70-1 and ScHSC70-2 was performed with HSC70s reported in other vertebrates (Fig. 4). According to the phylogenetic tree, fish could be classified

ScHSC70-1 and ScHSC70-2 were expressed in all tissues under normal physiological conditions (Fig. 6). However, the transcript levels of ScHSC70-1 were much higher than that of ScHSC70-2 in each tissue. Both genes exhibited tissue-specific variation. ScHSC70-1 was expressed at the highest level in the ovary and the lowest level in the muscle, while ScHSC70-2 was expressed at the highest level in the heart and the lowest level in the liver. In addition, relatively high expression of ScHSC70-1 was also found in the spleen and head kidney, on the contrary, ScHSC70-2 was at relatively very low levels in these two immune tissues.

Fig. 1. Genomic structures of two ScHSC70-1 and ScHSC70-2. Wide boxes represent exons, and narrow boxes indicate introns. The ORFs are indicated by dark gray boxes, and the UTRs are indicated by light gray boxes. Boxes between wide and narrow represent the terminus region in the UTRs of the cDNAs which were not amplified in the genomic DNA. Abbreviations: E, exon; I, intron.

230

P. Wang et al. / Gene 560 (2015) 226–236

Fig. 2. The alignment of deduced amino acid sequences of ScHSC70-1 and ScHSC70-2. The “.” indicates the identifiable amino acid residues. Three HSP70 protein family signature sequences are indicated by gray and the roman numerals I–III. The non-organellar motif RARFEEL is marked by “*” above the sequence, and the C-terminal EEVD motif is marked by double overlines. The putative bipartite nuclear localization signals, KK and RRLRT, are indicated by empty circles above the residues. Four repeats of the tetrapeptide located in the C-terminal region are boxed.

3.6. Expression patterns of ScHSC70s under heat shock The time-dependent expression patterns of ScHSC70-1 and ScHSC702 in the heart, liver and head kidney under acute heat shock at 34 °C are shown in Fig. 7. The results showed that mRNA levels of ScHSC70-1 in the head kidney had no significant changes after acute heat shock treatment, nevertheless, it was slightly but significantly increased in the heart and head kidney, up to 2.45- and 1.74-fold, respectively, compared to the control group. In a sharp contrast with the mildly increased ScHSC70-1, the ScHSC70-2 mRNA levels were markedly up-regulated by averages of 20.83-, 24.02- and 17.50-fold in the heart, head kidney and liver, respectively, following acute heat shock for 2 h. Total expression abundances of ScHSC70-2 in the heart were far more than that of ScHSC70-1 during heat shock. In the fast and gradual heat shock regimes, both genes were significantly induced, however, in very different degrees (Fig. 8). Following fast heat shock from 25 to 34 °C, the mRNA levels of ScHSC70-1 and ScHSC70-2 were increased by averages of 2.09- and 26.62-fold, respectively. With the temperature elevating to 38.8 °C, their expression continued to be induced to 4.87- and 61.63-fold, respectively. Similarly, gradual heat shock also up-regulated the expression of both genes. Under gradual heat shock, the expression of ScHSC70-1 and ScHSC70-2 was increased by averages of 3.67- and 16.90-fold, respectively, when the temperature gradually elevated to 34 °C, and with the temperature elevating to 38.8 °C, their expression continued to be up-regulated by 8.41- and 39.00-fold, respectively. Compared with their expression

under gradual heat shock, ScHSC70-2 mRNA was rising at a higher rate under fast heat shock, while the ScHSC70-1 mRNA increasing rate was lower under fast heat shock. 3.7. Expression of ScHSC70s on exposure to acute hypoxia In the liver, acute hypoxia had no effect on the expression of ScHSC70-1, while significantly suppressed the expression of ScHSC702, which decreased to 46.8% of the control at 12 h on exposure to hypoxia (Fig. 9). 3.8. Expression of ScHSC70s during A. hydrophila infection The expression patterns of ScHSC70-1 and ScHSC70-2 in the head kidney and spleen challenged by A. hydrophila are shown in Fig. 10. Since there were no significant changes in the mRNA levels of both ScHSC70 isoforms during 72 h after injection with PBS, the average expression level was used as a control. The transcripts of ScHSC70-1 were significantly up-regulated in the head kidney and spleen at early stages following A. hydrophila infection, by 1.43-fold in the head kidney at 6 h and 1.76fold in the spleen at 12 h, respectively. In the spleen, the ScHSC70-1 mRNA level was gradually reduced to its normal level after reaching the peak at 12 h, while in the head kidney, its expression was downregulated to 64.04% of its control level at 24 h after reaching the peak at 6 h, and then increased gradually to the baseline. On the other hand, the

P. Wang et al. / Gene 560 (2015) 226–236

231

Fig. 3. Alignment of amino acid sequences of ScHSC70s and other vertebrate HSC70s. Identical amino acid residues are indicated by dots. Missed amino acids are marked by dashes. Three HSP70 protein family signature sequences are indicated by shaded regions. The C-terminal EEVD motif is marked by a box. The GenBank accession numbers of the HSC70s are as follows: mandarin fish HSC70-1 (KF042289), tilapia HSC70-1 (XP_003448938), yellowtail HSC70-1 (BAG82848), mandarin fish HSC70-2 (KF017616), tilapia HSC70-2 (XP_003455104), yellowtail HSC70-2 (BAG82849), rat HSC70 (NP_077327), and human HSC70 (CAA68445).

232

P. Wang et al. / Gene 560 (2015) 226–236

Fig. 4. Phylogenetic analysis of the vertebrate HSC70 proteins. Amino acid sequences of HSC70s were compared using the neighbor-joining method with the MEGA 6 program. Bootstrap support values (1000 replicates) of greater than 50% are indicated at the nodes. The three clusters of HSC70 proteins are boxed. HSC70-1 and HSC70-2 identified from mandarin fish in this study are indicated by filled circles. All accession numbers indicated in parentheses refer to the NCBI database.

expression of ScHSC70-2 did not change significantly during the 72-h A. hydrophila infection compared with its normal levels in both tissues. 4. Discussion 4.1. Analysis of sequence features In the present study, two HSC70 isoforms, ScHSC70-1 and ScHSC70-2, were identified and characterized in mandarin fish. The full lengths of ScHSC70-1 and ScHSC70-2 cDNAs are 2344 bp and 2468 bp, respectively, with ORFs of 1953 bp encoding 650 amino acids. Their deduced amino acid sequences are highly homologous with their counterparts in other fish species. ScHSC70-1 and ScHSC70-2 sequences have three canonical signature sequences and major functional domains of the eukaryotic HSP70 family. The non-organellar stress protein motif RARFEEL and the regulatory motif EEVD of cytoplasmic characteristic at Cterminus were found in both ScHSC70-1 and ScHSC70-2, indicating that they are located in the cell cytosol and cytoplasm (Demand et al., 1998; Lo et al., 2004). The bipartite nuclear localization signals of both sequences are needed for the selective translocation of the ScHSC70-1 and ScHSC70-2 proteins into the nucleus (Demand et al., 1998; Liu et al., 2004). Having introns in the coding region is considered to be a typical characteristic of constitutively expressed HSC70s that differs from the inducible form HSP70s (Yost and Lindquist, 1986). In our previously study, we have shown that two mandarin fish HSP70 genes,

ScHSP70a and ScHSP70b, have no introns in their coding regions (Wang et al., 2014). Here, we found that both ScHSC70-1 and ScHSC70-2 genes contain seven introns in their coding regions, which are similar to the genomic structures of HSC70 genes in other fish (Ali et al., 2003; Ming et al., 2010; Park et al., 2001; Zafarullah et al., 1992). Although the lengths of ScHSC70-1 and ScHSC70-2 coding exons are almost the same, their corresponding introns have very different lengths, suggesting that they are encoded by distinct genes in the genome. 4.2. Sequence alignment and phylogenetic analysis It is believed that there is more than one HSC70 isoform in an individual genome (Liu et al., 2012). However, different HSC70 isoforms were only reported in a few fish species, such as zebrafish, common carp, yellowtail, rainbow trout, walking catfish and tilapia (Ali et al., 2003; Ojima et al., 2005; Poompoung et al., 2014; Santacruz et al., 1997; Yabu et al., 2011). The amino acid sequences of HSC70-1 and HSC70-2 from carp, walking catfish and yellowtail showed 88%, 94% and 95% similarities, respectively. Similarly, high sequence identity (94%) between ScHSC70-1 and ScHSC70-2 was found in mandarin fish. Phylogenetic tree analysis in the present study divided fish HSC70s into two big groups, fish HSC70 group I and group II, group I being composed of HSC70-1 subgroup and HSC70-2 subgroup. This was supported by a similar report (Yabu et al., 2011), where fish HSC70s were classified into fish HSC70-1 group and HSC70-2 group.

P. Wang et al. / Gene 560 (2015) 226–236

233

Fig. 5. Relative expression of ScHSC70-1 (a) and ScHSC70-2 (b) during embryo developmental stages of mandarin fish. The mRNA levels were qualified by real-time quantitative PCR and normalized by 18S rRNA. Thirty eggs or twelve larvae in each stage were collected as one sample. Each bar represents the mean ± SD of three samples. Bars with different letters indicate statistical differences (P b 0.05). 0, unfertilized eggs; 1, fertilized eggs; 2, 16-cell stage; 3, morula; 4, blastula; 5, gastrula; 6, closure of blastopore; 7, appearance of myomere; 8, tail-bud stage; 9, muscle burl stage; 10, crystal stage; 11, blood circulating stage; 12, pre-hatched larvae; 13, 1-day post-hatched (dph) larvae; 14, 7-dph larvae.

Fig. 7. Induction of ScHSC70-1 and ScHSC70-2 in the heart (a), head kidney (b) and liver (c) under acute heat shock at 34 °C. The mRNA levels were determined by real-time quantitative PCR and normalized by 18S rRNA. The fish that maintained at 25 °C over the entire experimental period were taken as the control group. Data are represented as mean ± SD, n = 6. Different letters above the bars represent significant difference (P b 0.05).

The two mandarin fish HSC70s identified in this study were classified into the fish HSC70 group I, and they belong to HSC70-1 subgroup and HSC70-2 subgroup, respectively. 4.3. Comparative analysis of expression HSC70 isoforms

Fig. 6. Relative mRNA expression levels of ScHSC70-1 and ScHSC70-2 in various tissues in mandarin fish. The mRNA levels were quantified by real-time quantitative PCR and normalized by 18S rRNA. Data are represented as mean ± SD, n = 3 fish.

It has been suggested that HSC70 isoforms differ with respect to their expression patterns in different tissues and upon stresses. For instance, expression of carp HSC70-1 in the muscle showed no significant change by a 30-min heat shock, while the HSC70-2 was mildly induced by a 3-

234

P. Wang et al. / Gene 560 (2015) 226–236

Fig. 8. Relative expression levels of ScHSC70-1 and ScHSC70-2 under fast heat shock (elevating temperature rate: ~1.2 °C/h) and gradual heat shock (elevating temperature rate: ~0.2 °C/h). The transcript levels were qualified by real-time quantitative PCR and normalized by 18S rRNA. Data are represented as mean ± SD of six samples. Significant differences in the expression of ScHSC70s under fast and gradual heat shock regimes compared to the control (25 °C) are indicated by a symbol (P b 0.05) or double symbols (P b 0.01).

fold increase (Ali et al., 2003). In cultured tailfin cells, yellowtail HSC701 showed constitutive expression under normal and heat shock conditions, whereas the HSC70-2 expression levels were markedly induced by heat shock (Yabu et al., 2011). To investigate the expression patterns of ScHSC70-1 and ScHSC70-2 identified in the present study, their mRNA levels during the embryonic development, in different tissues and exposing to heat shock, hypoxia and A. hydrophila infection were determined by real-time quantitative PCR. 4.3.1. During the embryonic development In vertebrates, embryonic development requires the expression of the HSP70 family members, which intervene as modulators in many developmental events (Rupik et al., 2011). In our previous work, we have shown that the inducible ScHSP70a and ScHSP70b mRNAs were maternal original, and their levels were significantly decreased after the blastula stage (Wang et al., 2014). In the present study, both ScHSC70-1 and ScHSC70-2 transcripts were detected throughout the embryogenesis as early as in the mature eggs, and maintained unchanged during the early developmental stages, suggesting that they were also maternal

Fig. 9. Expression of ScHSC70-1 and ScHSC70-2 in response to hypoxia (DO, 0.9 ± 0.1 mg/L). The mRNA levels in the liver were qualified by real-time quantitative PCR and normalized by 18S rRNA. Data are represented as mean ± SD (n = 6). The asterisk above the bar represents a significant difference (P b 0.05).

original. However, in contrast with the expression of the ScHSP70s, ScHSC70-1 and ScHSC70-2 mRNA levels were significantly increased from gastrula and the appearance of myomere, respectively, indicating their different roles during these stages. The expression patterns of ScHSC70s were similar with that of HSC70 in zebrafish and Xenopus laevis (Edwards et al., 1995; Herberts et al., 1993; Lang et al., 2000; Santacruz et al., 1997), whose HSC70 transcripts were proved to be maternal original and increased after the mid-blastula transition period (MBT), until when the zygotic transcription was considered to be activated (Kane and Kimmel, 1993). It was demonstrated that the increasing expression of HSC70 was involved in the development of somitogenesis, neurogenesis and retina formation (Santacruz et al., 1997). Therefore the increasing ScHSC70-1 and ScHSC70-2 should be consistent with their functions involved in the development. The stage when ScHSC70-2 mRNA began to increase was later than that for ScHSC70-1, and the expression levels of ScHSC70-2 were always lower than that of ScHSC70-1 at every stage, suggesting that the two ScHSC70 isoforms may have different functions during embryonic development. 4.3.2. In tissues Both ScHSC70-1 and ScHSC70-2 were highly expressed in tissues under normal conditions, raveling their property of constructively expression, which was in stark contrast with the expression profiles of their homologous genes — ScHSP70s, which were not or only lowly expressed in most tissues under normal physiological conditions (Wang et al., 2014). Additionally, much higher expression level of ScHSC70-1 in the ovary than other tissues/organs indicated that ScHSC70-1 may play pivotal physiological roles in ovary development. On the other hand, the levels of ScHSC70-1 mRNA were much higher than that of ScHSC70-2 in all tissues, suggesting that ScHSC70-1 may play more roles in maintaining the cellular protein homeostasis under normal physiological conditions. 4.3.3. Under heat shock The heart, liver and head kidney, three vital organs in the blood circulation, material metabolism and immune system, respectively, were selected to investigate the expression profiles of the two ScHSC70 isoforms under acute heat shock at 34 °C. Acute heat shock had no effect on the expression of ScHSC70-1 in the liver, but could modestly induced its expression in the heart and head kidney, indicating that although ScHSC70-1 was constitutively expressed under normal conditions, it could be induced by heat stress in a tissue-specific manner. In contrast, transcripts of ScHSC70-2 were strongly up-regulated in the three tissues following heat shock, which was similar with the expression patterns of the inducible ScHSP70s under acute heat shock (Wang et al., 2014), suggesting that the induction of ScHSC70-2 and ScHSP70s was more sensitive than that of ScHSC70-1 when exposed to heat shock. ScHSC70-2 and ScHSP70s may play more important roles than ScHSC70-1 in protecting cells against damage from high temperature. Nevertheless, compared with the dramatically increased levels of ScHSP70s reported by our previous study (Wang et al., 2014), the inducibility of ScHSC702 is still slighter. It is known that transcriptional induction of HSP70 requires the binding of activated heat shock transcription factors (HSFs) to heat shock elements (HSEs) located within the HSP70 gene promoter regions (Iwama et al., 1998; Murtha and Keller, 2003), therefore, the different inducible levels of ScHSC70s and ScHSP70s can be associated with the characteristic of their HSEs (Iwama et al., 1998; Sung et al., 2001; Yabu et al., 2011). And their profiles of increasing at first and reducing then in given tissues/organs by heat shock may be the result of feedback regulation mediated by HSFs (Morimoto, 1993). We further investigated the expression profiles of the ScHSC70 isoforms in the heart under fast and gradual heat shock regimes. The ScHSC70-2 transcripts were up-regulated gradually with the increasing temperature under both regimes, at a lower increasing rate under gradual heat shock than that under fast heat shock. When the temperature

P. Wang et al. / Gene 560 (2015) 226–236

235

Fig. 10. Expression profiles of ScHSC70-1 and ScHSC70-2 in the head kidney (a, b) and spleen (c, d) after infection with A. hydrophila. The mRNA levels were qualified by real-time quantitative PCR and normalized by 18S rRNA, each bar represents the mean ± SD of six samples. Significant differences were indicated by different letters above the bars (P b 0.05).

elevated to 38.8 °C, the ScHSC70-2 mRNA levels under both heat shock regimes were still lower than its maximum expression during the acute heat shock at 34 °C. These results indicate that the induction of ScHSC70-2 is positively correlated with the increasing rate of temperature, which was consistent with the expression features of ScHSP70s (Wang et al., 2014). On the contrary, the expression of ScHSC70-1 was increased faster under gradual heat shock compared to that under fast heat shock, suggesting that the induction of ScHSC70-1, to some extent, seems to be related to the high temperature accumulation. 4.3.4. On exposure to acute hypoxia Despite current studies in the literature have suggest that the inducible HSP70 in fish can be up-regulated to protect cells against hypoxic injury (Delaney and Klesius, 2004), little is known about the expression of fish HSC70 when exposure to hypoxic stress. Here, we found that acute hypoxia did not affect the mRNA level of ScHSC70-1 in the liver of mandarin fish, while suppressed the expression of ScHSC70-2, which was in a stark contrast with the expression profiles of ScHSP70s that was strongly induced under hypoxia (Wang et al., 2014). Huang et al. (2009) proved that up-regulation of HSP70-2 in human hepatocellular carcinoma and hepatoma cells under hypoxia is due to the direct binding of hypoxia-inducible factor (HIF) to hypoxia-responsive elements (HREs) in HSP70-2 promoter. The expression of mandarin fish HIF-1α was also up-regulated significantly under the acute hypoxic stress in this study (data not shown). Thus, we speculate that the specific characteristics of ScHSC70-1, ScHSC70-2 and ScHSP70s promoters are responsible for their different expression patterns under hypoxic condition. In addition, more research is needed to understand the relationship between hypoxic injury and down-regulation of HSC70-2. 4.3.5. Challenged with A. hydrophila Previous studies have shown that HSC70 not only functions as the cellular molecular chaperone, but also is involved in immune response in aquatic animals. Deane et al. (2004) reported that the HSC70 mRNA

levels were significantly increased in the liver of silver sea bream after Vibrio alginolyticus challenge. Infection with Vibrio harveyi increased humphead snapper HSC70 expression in the head kidney (Zhang et al., 2011). The expression of HSC70 in the liver of Wuchang bream was peaked at 6 h, and then decreased to below of its baseline after 24 h infected with A. hydrophila (Ming et al., 2010). By silencing HSC70 protein expression Yan et al. (2010), proved that the HSC70 in shrimp is directly involved in prevention of primary cell death infected by white spot syndrome virus. Likewise, clear time-dependent mRNA expression patterns of ScHSC70-1 in the head kidney and spleen of mandarin fish were observed in this study when infected with A. hydrophila. The ScHSC70-1 expression levels were significantly up-regulated in both tissues during the early phase of infection. This was in accordance with the expression patterns of ScHSP70s following A. hydrophila infection (Wang et al., 2014). In contrast to ScHSC70-1, A. hydrophila did not significantly affect the expression of ScHSC70-2 in both immune tissues. These results revealed that it is ScHSC70-1 rather than ScHSC70-2 participated in mediating immune responses of mandarin fish when challenged with A. hydrophila. 5. Conclusion Two distinct HSC70 isoforms, ScHSC70-1 and ScHSC70-2, were identified and characterized from the mandarin fish for the first time. Their amino acid sequence characteristic features, DNA structures and mRNA expression patterns suggest that the two ScHSC70 isoforms correspond to the constitutive nuclear-cytosolic HSC70. Their mRNA expression profiles were comparatively analyzed and the results showed that although ScHSC70-1 and ScHSC70-2 shared some similarities on the expression at later embryonic developmental stages and in specific tissues under heat shock, there were more differences between their expression profiles under both normal and stressful conditions including heat shock, hypoxia and bacterial infection, indicating the two ScHSC70 isoforms are differently involved in the early embryogenesis

236

P. Wang et al. / Gene 560 (2015) 226–236

and the stress responses of high temperature, hypoxia and bacterial infection. The identification and expression analysis of the two ScHSC70 isoforms will benefit for further study of the anti-adverse mechanism as well as possible improvement of stress tolerance and disease resistance of mandarin fish. Acknowledgments This work was supported by grant of the Educational Commission of Guangdong Province, China (No. cxzd1104), and funds of the Science and Technology Planning Projects of Guangdong Province, China (No. 2012A020800001, No. 2008A020100003, No. 2007A020300001-1), the Agriculture Science Technology Achievement Transformation project (No. 2012GB2E000338) and the Cooperative Project of Guangdong Province, China (No. 2011B090400179). References Ali, K.S., Dorgai, L., Abraham, M., Hermesz, E., 2003. Tissue- and stressor-specific differential expression of two hsc70 genes in carp. Biochem. Biophys. Res. Commun. 307, 503–509. Basu, N., Todgham, A.E., Ackerman, P.A., Bibeau, M.R., Nakano, K., Schulte, P.M., Iwama, G.K., 2002. Heat shock protein genes and their functional significance in fish. Gene 295, 173–183. Boone, A.N., Vijayan, M.M., 2002. Constitutive heat shock protein 70 (HSC70) expression in rainbow trout hepatocytes: effect of heat shock and heavy metal exposure. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 132, 223–233. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–622. Chu, A., Matusiewicz, N., Stochaj, U., 2001. Heat-induced nuclear accumulation of hsc70s is regulated by phosphorylation and inhibited in confluent cells. FASEB J. 15, 1478–1480. Dastoor, Z., Dreyer, J., 2000. Nuclear translocation and aggregate formation of heat shock cognate protein 70 (Hsc70) in oxidative stress and apoptosis. J. Cell Sci. 113 (Pt 16), 2845–2854. de la Rosa, E.J., Vega-Nunez, E., Morales, A.V., Serna, J., Rubio, E., de Pablo, F., 1998. Modulation of the chaperone heat shock cognate 70 by embryonic (pro)insulin correlates with prevention of apoptosis. Proc. Natl. Acad. Sci. U. S. A. 95, 9950–9955. Deane, E.E., Woo, N.Y., 2005. Cloning and characterization of the hsp70 multigene family from silver sea bream: modulated gene expression between warm and cold temperature acclimation. Biochem. Biophys. Res. Commun. 330, 776–783. Deane, E.E., Li, J., Woo, N.Y., 2004. Modulated heat shock protein expression during pathogenic Vibrio alginolyticus stress of sea bream. Dis. Aquat. Org. 62, 205–215. Delaney, M.A., Klesius, P.H., 2004. Hypoxic conditions induce Hsp70 production in blood, brain and head kidney of juvenile Nile tilapia Oreochromis niloticus (L.). Aquaculture 236, 633–644. Demand, J., Luders, J., Hohfeld, J., 1998. The carboxy-terminal domain of Hsc70 provides binding sites for a distinct set of chaperone cofactors. Mol. Cell. Biol. 18, 2023–2028. Edwards, J.L., Ealy, A.D., Hansen, P.J., 1995. Regulation of heat shock protein 70 synthesis by heat shock in the preimplantation murine embryo. Theriogenology 44, 329–337. Erbse, A., Mayer, M.P., Bukau, B., 2004. Mechanism of substrate recognition by Hsp70 chaperones. Biochem. Soc. Trans. 32, 617–621. Graser, Robert T., Malnar, D., Vincek, D.V., 1996. Cloning and characterization of a 70 kDa heat shock cognate (hsc70) gene from the zebrafish (Danio rerio). Genetica 273–276. Hall, B.G., 2013. Building phylogenetic trees from molecular data with MEGA. Mol. Biol. Evol. 30, 1229–1235. Herberts, C., Moreau, N., Angelier, N., 1993. Immunolocalization of HSP70-related proteins constitutively expressed during Xenopus laevis oogenesis and development. Int. J. Dev. Biol. 37, 397–406. Huang, W.J., Xia, L.M., Zhu, F., Huang, B., Zhou, C., Zhu, H.F., Wang, B., Chen, B., Lei, P., Shen, G.X., 2009. Transcriptional upregulation of HSP70-2 by HIF-1 in cancer cells in response to hypoxia. Int. J. Cancer 124, 298–305.

Iwama, G.K., Thomas, P.T., Forsyth, R.B., Vijayan, M.M., 1998. Heat shock protein expression in fish. Rev. Fish Biol. Fish. 8, 35–56. Kane, D.A., Kimmel, C.B., 1993. The zebrafish midblastula transition. Development 119, 447–456. Knowlton, A.A., Salfity, M., 1996. Nuclear localization and the heat shock proteins. J. Biosci. 21, 123–132. Lang, L., Miskovic, D., Lo, M., Heikkila, J.J., 2000. Stress-induced, tissue-specific enrichment of hsp70 mRNA accumulation in Xenopus laevis embryos. Cell Stress Chaperones 5, 36–44. Liu, J., Yang, W.J., Zhu, X.J., Karouna-Renier, N.K., Rao, R.K., 2004. Molecular cloning and expression of two HSP70 genes in the prawn, Macrobrachium rosenbergii. Cell Stress Chaperones 9, 313–323. Liu, T., Daniels, C.K., Cao, S., 2012. Comprehensive review on the HSC70 functions, interactions with related molecules and involvement in clinical diseases and therapeutic potential. Pharmacol. Ther. 136, 354–374. Lo, W.Y., Liu, K.F., Liao, I.C., Song, Y.L., 2004. Cloning and molecular characterization of heat shock cognate 70 from tiger shrimp (Penaeus monodon). Cell Stress Chaperones 9, 332–343. Ming, J., Xie, J., Xu, P., Liu, W., Ge, X., Liu, B., He, Y., Cheng, Y., Zhou, Q., Pan, L., 2010. Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih). Fish Shellfish Immunol. 28, 407–418. Morimoto, R.I., 1993. Cells in stress: transcriptional activation of heat shock genes. Science 259, 1409–1410. Murtha, J.M., Keller, E.T., 2003. Characterization of the heat shock response in mature zebrafish (Danio rerio). Exp. Gerontol. 38, 683–691. Ojima, N., Yamashita, M., Watabe, S., 2005. Quantitative mRNA expression profiling of heat-shock protein families in rainbow trout cells. Biochem. Biophys. Res. Commun. 329, 51–57. Park, J.H., Lee, J.J., Yoon, S., Lee, J.S., Choe, S.Y., Choe, J., Park, E.H., Kim, C.G., 2001. Genomic cloning of the Hsc71 gene in the hermaphroditic teleost Rivulus marmoratus and analysis of its expression in skeletal muscle: identification of a novel muscle-preferred regulatory element. Nucleic Acids Res. 29, 3041–3050. Poompoung, P., Dutrudi, P., Prapansak, S., Supawadee, Poompuang, 2014. Cloning and expression of two HSC70 genes in walking catfish Clarias macrocephalus (Günther, 1864) challenged with Aeromonas hydrophila. Aquac. Res. 45, 1319–1331. Roberts, R.J., Agius, C., Saliba, C., Bossier, P., Sung, Y.Y., 2010. Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J. Fish Dis. 33, 789–801. Rupik, W., Jasik, K., Bembenek, J., Widlak, W., 2011. The expression patterns of heat shock genes and proteins and their role during vertebrate's development. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 159, 349–366. Santacruz, H., Vriz, S., Angelier, N., 1997. Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev. Genet. 21, 223–233. Sung, D.Y., Vierling, E., Guy, C.L., 2001. Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. Plant Physiol. 126, 789–800. Wang, P.F., Zeng, S., Xu, P., Zhou, L., Zeng, L., Lu, X., Wang, H.F., Li, G.F., 2014. Identification and expression analysis of two HSP70 isoforms in mandarin fish Siniperca chuatsi. Fish. Sci. 80, 803–817. Yabu, T., Imamura, S., Mohammed, M.S., Touhata, K., Minami, T., Terayama, M., Yamashita, M., 2011. Differential gene expression of HSC70/HSP70 in yellowtail cells in response to chaperone-mediated autophagy. FEBS J. 278, 673–685. Yamashita, M., Yabu, T., Ojima, N., 2010. Stress protein HSP70 in fish. Aqua-BioSci. Monogr. 3, 111–141. Yan, F., Xia, D., Hu, J., Yuan, H., Zou, T., Zhou, Q., Liang, L., Qi, Y., Xu, H., 2010. Heat shock cognate protein 70 gene is required for prevention of apoptosis induced by WSSV infection. Arch. Virol. 155, 1077–1083. Yost, H.J., Lindquist, S., 1986. RNA splicing is interrupted by heat shock and is rescued by heat shock protein synthesis. Cell 45, 185–193. Zafarullah, M., Wisniewski, J., Shworak, N.W., Schieman, S., Misra, S., Gedamu, L., 1992. Molecular cloning and characterization of a constitutively expressed heat-shockcognate hsc71 gene from rainbow trout. Eur. J. Biochem. 204, 893–900. Zhang, X., Pang, H., Wu, Z., Jian, J., 2011. Molecular characterization of heat shock protein 70 gene transcripts during Vibrio harveyi infection of humphead snapper, Lutjanus sanguineus. Fish Physiol. Biochem. 37, 897–910. Zhang, L., Sun, C., Ye, X., Zou, S., Lu, M., Liu, Z., Tian, Y., 2014. Characterization of four heatshock protein genes from Nile tilapia (Oreochromis niloticus) and demonstration of the inducible transcriptional activity of Hsp70 promoter. Fish Physiol. Biochem. 40, 221–233.