Appl Microbiol Biotechnol (2014) 98:807–822 DOI 10.1007/s00253-013-5436-2

GENOMICS, TRANSCRIPTOMICS, PROTEOMICS

Comparative genomic and transcriptomic analyses of NaCl-tolerant Staphylococcus sp. OJ82 isolated from fermented seafood Sungjong Choi & Jaejoon Jung & Che Ok Jeon & Woojun Park

Received: 29 July 2013 / Revised: 25 November 2013 / Accepted: 26 November 2013 / Published online: 18 December 2013 # Springer-Verlag Berlin Heidelberg 2013

Abstract Bacteria belonging to the Staphylococcus genus reside in various natural environments; however, only disease-associated Staphylococcus strains have received attention while ecological function and physiologies of nonpathogenic strains were often neglected. Because high level of tolerance against NaCl is a common trait of Staphylococcus, we investigated the characteristics of halotolerance in Staphylococcus sp. OJ82 isolated from fermented seafood containing a high concentration of NaCl. Among the 292 isolates screened, OJ82 showed the highest β-galactosidase and extracellular protease activities under high-salt conditions. Comparative genomic analysis with other Staphylococcus strains showed that (a) replication origins are highly conserved, (b) the OJ82 strain has a high number of amino acid transport- and metabolism-related genes, and (c) OJ82 has many unique proteins (15 %) and 12 prophage-related genomic islands. RNA-seq analysis under high-salt conditions showed that genes involved in cell membranes, transport, osmotic stress, ATP synthesis, and translation are highly expressed. OJ82 may use the ribulose monophosphate pathway to detoxify some toxic intermediates under high-salt conditions. Six new and three known non-coding small RNAs of the OJ82 strain were also found in the RNA-seq analysis. Sungjong Choi and Jaejoon Jung contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s00253-013-5436-2) contains supplementary material, which is available to authorized users. S. Choi : J. Jung : W. Park (*) Department of Environmental Science and Ecological Engineering, Korea University, Anam-Dong 5Ga, Seungbuk-Ku, Seoul 136-713, Republic of Korea e-mail: [email protected] C. O. Jeon Department of Life Science, Chung-Ang University, Seoul 156-756, Republic of Korea

Genomic and transcriptomic analyses identified target βgalactosidase and extracellular protease. Interestingly, the OJ82 strain became resistant to bacteriocin produced by the Bacillus strain only under high-salt conditions. Our data showed that the OJ82 strain adapted to high-salt conditions by expressing core cellular processes (translation, ATP production) and defense genes (membrane synthesis, compatible solute transports, ribulose monophosphate pathway) could survive bacteriocin exposure under high-salt conditions. Keywords Staphylococcus . Osmotic stress . Ribulose monophosphate pathway . Compatible solute . Protease . RNA-seq

Introduction Currently, the genus Staphylococcus contains 47 type species and 24 subspecies with validly published names. Isolation sources of Staphylococcus species include insects (Hájek et al. 1992), amber (Lambert et al. 1998), fermented fish (Tanasupawat et al. 1992), marine and estuarine surface water (Gunn and Colwell 1983), cheese (Vernozy-Rozand et al. 2000), soil, and plant, indicating the prevalence of Staphylococcus in the natural environment. However, most studies have been focused on the pathogenic Staphylococcus strain such as methicillin-resistant Staphylococcus aureus (MRSA), which is a causative agent of bacteremia and exhibits high mortality (Lambert et al. 2011). However, ecology and physiology of non-pathogenic Staphylococcus in the natural habitat remained unclear. A common feature of Staphylococus species is tolerance with high concentration of NaCl. Many Staphylococcus including S. epidermidis , S. saprophyticus, and other numerous Staphylococcus were reported to grow under 10 % NaCl (Schleifer and Kloos 1975). S. piscifermentans, S. condimentii,

808

and S. carnosus can grow at 15 % NaCl. S. agnetis can grow even at 19 % NaCl (Taponen et al. 2012). Because Staphylococcus resides in various environments including the outside natural environment, animal, food, and human host, they are expected to experience changing environmental conditions and stresses, including osmotic stress. Therefore, resistance to osmotic stress would play an important role in the adaptation of Staphylococcus under high NaCl condition. Food is one of the habitats of Staphylococcus species. S. carnosus and S. piscifermentans were isolated from fermenting sausages (Probst et al. 1998) and fermented fish, respectively (Tanasupawat et al. 1992). S. carnosus is known to have a positive effect on the flavor forming process and the reddening reaction and is used for starter cultures. Previous culture-dependent community analysis of Korean fermented seafood showed that Staphylococcus accounted for a large portion of the bacterial community (Guan et al. 2011). Our unpublished data also indicated that Staphylococcus was the third major genus (9.9 %), while Leuconostoc (37.6 %) and Bacillus (11.0 %) were dominant in Korean fermented squid seafood. However, their role and physiologies in the food environments have not been elucidated. The aims of this study were to investigate the genetic and physiological features for Staphylococcus to adapt in the fermented seafood condition. We studied fermented squid (Ojingeo-jeotgal) because any microbiological analysis has not been investigated in fermented squid. Staphylococcus may have to cope with the high level of osmotic stress and maintain its enzymatic activity in the fermented seafood condition. Therefore, the isolation of Staphyloccoccus species and enzyme activity tests were conducted in the NaCl-rich media to simulate fermented seafood condition. The Staphylococcus sp. OJ82 isolated in this study was subjected to physiological characterization and comparative genomic and transcriptomic analysis to understand its physiological adaptation to high-salt conditions. This study provides the physiological and genetic strategies of a food-borne Staphylococcus to cope with rapid change during high-salt fermentation process.

Materials and methods Isolation of bacterial strain from fermented seafood Squid (Ojingeo) is the main ingredient of Ojingeo-jeotgal. Fish sauce, salt, red pepper powder, starch syrup, crushed garlic, and chopped white radish are also important ingredients. The skin of squid is peeled off and 10 % (w/w) coarse salt is spread on the squid to ripen for 1 day. After the ripening of squid, it is cut into pieces and seasoned with 3 % (w/w) fish sauce, 3 % (w/w) red peppers powder, 3 % (w/w) sesame, 3 % (w/w) scallion, 4 % (w/w) crushed garlic, 10 % (w/w)

Appl Microbiol Biotechnol (2014) 98:807–822

chopped pear, 12 % (w/w) chopped white radish, and 14 % (w/w) starch syrup. The mixed ingredients are fermented at room temperature for 5 days and stored at 4 °C. As measured in our study, the NaCl concentration in Ojingeo-jeotgal is about 7–8 %. Because there could be subtle differences in the recipe by regions, we purchased jeotgal samples from five different manufacturers in Seoul, Korea, and mixed them into a sample. The samples were composited and filtered through sterilized gauze, and the salt content was measured using a PAL-ES2 salt meter (ATAGO, Shiba-koen, Tokyo, Japan). The filtrates were spread on agar plates after serial dilution with phosphate-buffered saline (PBS). Two types of rich agar media (5 % NaCl-containing Luria–Bertani [LB] agar, 2 % NaCl-containing marine agar [Difco, Franklin Lakes, NJ, USA]) were used to isolate bacterial strains, and all media were incubated at 30 °C until distinguishable colonies appeared. Ten to 15 colonies were randomly collected from each plate based on differences in morphology and growth characteristics. Experimental data of OJ82 were compared with other Staphylococcus species including S. aureus ATCC 25923, S. intermedius ATCC 29663, S. nepalensis KACC 13208, S. muscae KACC 13176, S. warneri KACC 13240, S. lentus ATCC 29070, and S. epidermidis ATCC 12228. Identification and phylogenetic analysis of bacterial isolates The isolates were identified using the EzTaxon-e server (http://eztaxon-e.ezbiocloud.net) on the basis of 16S rRNA gene sequence data. PCR amplification of 16S rRNA gene was performed using 27 F (5′-AGAGTTTGATCMTGGCTC AG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′) primers. PCR reactions were conducted at 95 °C for 90 s, followed by 35 cycles at 95 °C for 24 s, at 56 °C for 24 s, at 58 °C for 24 s, and a final extension step at 72 °C for 5 min using Mastercycler PCR machine (Eppendorf, Hauppauge, NY, USA). PCR product was ligased into pGEM-T Easy vector (Promega, WI, USA). The insertion of PCR product was confirmed by PCR amplification with T7 (5′-TAATAC GACTCACTATAGGG-3′) and SP6 (5′-ATTTAGGTGACA CTATAG-3′) primers. T7 primer was used for nucleotide sequencing. For phylogenetic analysis, the most similar 57 sequences from 57 Staphylococcus type species were aligned using ClustalW algorithm in MEGA 5 (Tamura et al. 2011). A neighbor-joining phylogenetic tree was based on the distance matrix calculated with Kimura two-parameter model. Bootstrapping was performed with 1,000 iterations, and bootstrap values greater than 70 were shown. Biochemical identification of the isolates VITEK2 automated system (bioMerieux, Marcy l'Etoile, France) was used for biochemical identification of the isolated strains. Cells were grown for 12 h at 37 °C in tryptic soy agar

Appl Microbiol Biotechnol (2014) 98:807–822

(BD, Franklin Lakes, NJ, USA) and emulsified in 0.45 % sterile saline solution according to the manufacturer’s instruction. The prepared cell resuspension was loaded onto VITEK2 GP (Gram positive) cards and the data were analyzed with the AES parameter version of VITEK2 (03.01). Protease activity assay Single colonies of isolated bacteria were streaked onto LB agar plates containing 1 % skim milk and incubated at optimal temperatures overnight. Protease activity was identified by the presence of a halo surrounding the strain, and protease activity was assayed by measuring the release of tyrosine from casein substrate using Folin–Ciocalteu reagent (Sigma, St. Louis, MO, USA). The overnight culture broth was centrifuged at 3,000 rpm for 30 min, and the supernatant served as the crude enzyme source. The cell-free supernatant (CFS) was passed through a 0.45-μm filter (Sartorius, Göttingen, Germany). The CFS (0.5 mL) was then mixed with 2 mL 2 % casein dissolved in 0.2 M phosphate buffer (pH 8.0) and incubated at 37 °C for 30 min. The reaction was stopped by the addition of 2.5 mL 1.2 M trichloroacetic acid. A blank sample was also prepared by adding trichloroacetic acid before enzyme addition. Test and blank solutions were then filtered through centrifugation at 13,000 rpm for 1 min. The filtrate (2.5 mL) was mixed thoroughly with 5 mL 0.4 M Na2CO3 and 0.5 mL 0.5 N Folin–Ciocalteu reagent. The absorbance was measured at 660 nm with an ultraviolet/visible spectrophotometer. One unit of protease activity was defined as the amount of enzyme that liberated 1 μmol tyrosine per minute at 37 °C. Average and standard deviations of protease activity were calculated from biological triplicate experiments. β-Galactosidase activity assay Isolates were streaked on LB agar plates containing X-gal (1 μg/mL). Plates were incubated at optimal temperature overnight. Colonies containing active β-galactosidase stained blue. The β-galactosidase activities of the bacterial cultures were encouraged using a method described by Miller (1992). The cultures were incubated at optimal temperature overnight. The growth media were removed from cells via centrifugation at 13,000×g for 1 min. Cells were subsequently rinsed twice and resuspended in PBS and then sonicated twice on ice for 2 min. Substrate solution (100 μL) was added to 200 μL ortho-nitrophenyl-β-galactoside (4 mg/mL) in a 1.7-mL microcentrifuge tube. The tube was incubated for 30 min at 37 °C. Then, 500 μL Na2CO3 was added to stop the reaction, and debris was removed via centrifugation at 13,000×g for 1 min. The absorbance was measured at 420 nm. One unit of enzyme activity was defined as the amount of enzyme that hydrolyzed 1 μmol substrate (ortho-nitrophenyl-β-galactoside) per minute. Average and standard deviations of β-

809

galactosidase activity were calculated from biological triplicate experiments. Cellulase activity assay Strains were incubated on a shaking platform for 1 day at optimal temperature. Twenty microliters was applied to holes in LB agar plates, and 0.1 % carboxymethylcellulose sodium salt was added (Fluka, St. Louis, MO, USA). After the strains were incubated overnight at optimal temperature, the plates were flooded with 0.1 % Congo red for 3 h and destained with 1 M NaCl for 15 min. The strains were checked for the presence of a surrounding halo (Teather and Wood 1982). Average and standard deviations of halo diameter were calculated from biological triplicate experiments. Quantitative real-time reverse transcriptase PCR Total RNA was isolated from 5 mL exponentially growing cells (optical density at 600 nm [OD600] ~0.9) using an RNeasy mini kit (Qiagen, Valencia, CA, USA) according to manufacturer instructions. Ten micrograms of total RNA were treated with DNase I for 1 h at 37 °C. Complementary DNAs (cDNAs) were synthesized from DNase-treated total RNA to obtain first-strand cDNA suitable for PCR amplification using a RevertAid H Minus first-strand cDNA synthesis kit (Thermo, Waltham, MA, USA). cDNAs were synthesized with the primer pairs SOJ_13740 F (AAAAAGAGGGCAATTCAA GTAAAC)/SOJ_13740 R (CCACCACCAGGAGTATTCAC AGA), SOJ_14750 F (TAATAAATATCCCGTCTA)/ SOJ_14750 R (ATATAAATCAATGGCTTCTCT), SOJ_14760 F (CACGGCGAGTTCGATTTGT)/SOJ_14760 R (CGATGACTTTGCGATAC), and SOJ_18890 F (TCAT TGAAGGGGTTACA)/SOJ_18890 R (TAAACAATGGTC CTGCGAATAA). Quantitative real-time reverse transcriptase PCR (qRT-PCR) was performed using the iCycler iQ realtime PCR detection system (Bio-Rad, Hercules, CA, USA). cDNA was produced from the same RNA used for RT-PCR. For qRT-PCR, 1 μL template cDNA, 5 pmol primers, 0.5× SYBR Green, and 1 U Taq polymerase (Thermo, Waltham, MA, USA) were used. Fluorescence was measured at the end of each 72 °C incubation and analyzed with iCycler iQ 3.0 software (Bio-Rad, Hercules, CA, USA). Melting curve analysis (60–95 °C in 0.5 °C increments) was performed to ensure PCR specificity. For quantification, the 16S rRNA gene was used to obtain reference expression data. Bacteriocin sensitivity assay Bacteriocin sensitivity was examined as previously described (Fredericq 1957) using LB medium. Exponentially grown Staphylococcus sp. OJ82 and S. epidermidis (200 μL) were spread on an LB agar plate. After the plate was dried, 5 μL

810

exponentially grown bacteriocin-producing bacteria cells was spotted on the center of the plate. Growth inhibition zones around the colonies under various NaCl concentrations were considered indications of bacteriocin sensitivity. Bacteriocinlike-compound-producing Bacillus sp. F1 was isolated from Korean fermented seafood in this study. Measurement of cell death using flow cytometry Bacillus sp. F1 was grown overnight in LB under various NaCl conditions. ODs of Bacillus sp. F1 of ~1 were used to obtain the supernatants. CFS was obtained using a 0.45-μm filter (Sartorius, Göttingen, Germany). CFS (45 mL) and 5 mL fresh LB were used to grow Staphylococcus species (collected from exponentially grown cells, OD600 ~0.8, ~107 colonyforming units) for 12 h at 30 °C with aeration. Then, cells were washed with PBS, and an aliquot (~1 ml) was added to flow cytometry tubes. Cells were stained with a BacLightTM RedoxSensorTM Green Vitality Kit (Molecular Probes, Eugene, OR, USA). The density of cells was 106 cells/ml. The cells were washed twice with PBS. Two microliters of carbonyl cyanide 3-chlorophenylhydrazone was added to the washed cells for 5 min to stop their growth. Then, 1 μL propidium iodide was added to the tube and it was incubated in darkness at 37 °C for 10 min. Samples were then analyzed using FACSVerse (BD, Franklin Lakes, NJ, USA) (Yeom et al. 2010). RNA sequencing analysis and confirmation of the gene expression using qRT-PCR Staphylococcus sp. OJ82 was grown in LB medium at 30 °C with continuous shaking. The overnight grown cells were inoculated into two culture flasks containing LB media, one with a final NaCl concentration of 1 % and the other with a final NaCl concentration of 11 %. When OD600 reached ~0.9 (early stationary phase; see Fig. S1 of the “Electronic supplementary material”, arrow), total RNA was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA, USA) following manufacturer instructions. RNA isolation from the early stationary phase was desired to understand transcriptional profiles under osmotic stress-adapted condition. Total RNA (10 μg) from each sample was used as starting material to prepare sequencing libraries with the TruSeq RNA Sample Preparation Kit V2 (Illumina, San Diego, CA, USA) following the manufacturer’s instructions. mRNA was fragmented with a mean length of 200 bp. cDNA reverse transcription was conducted with SuperScript II reverse transcriptase (Invitrogen, Eugene, OR, USA) using random hexamer primer. One lane per sample was used for sequencing with the Illumina Genome Analyzer IIx to generate non-directional, single-ended 36 base pair reads. Quality-filtered reads were mapped to the reference genome sequence (Pruitt et al. 2009)

Appl Microbiol Biotechnol (2014) 98:807–822

using CLC Genomics Workbench 4.0 (CLC Bio, Aarhus, Denmark). The relative transcript abundance was computed by counting the reads per kilobase of exon model per million mapped sequence reads (RPKM). We further confirmed the expression level of selected genes based on RNA-seq results. To understand the expression of target genes by osmotic shock, total RNA was isolated from different time points after exposure to 11 % NaCl osmotic shock. Exponentially grown cells were harvested by centrifugation and washed twice with sterile PBS. Resuspended cells were inoculated to 11 % NaCl-containing LB and culture at 30 °C with shaking of 220 rpm. Total RNA was isolated at 3, 10, and 30 min after transfer as described earlier. qRT-PCR was performed with biological triplicate experiments as described earlier using the primers listed in Table S1 of the “Electronic supplementary material”. To test statistical significance, t-test was performed in Microsoft Excel software (Microsoft, Redmond, WA, USA). Bioinformatics analyses The amino acid sequences of all transporters in the OJ82 genome were classified into groups according to the Basic Local Alignment Search Tool (BLAST) results from TransportDB (http://www.membranetransport.org) (Pomeranz 1964). Signal peptide was predicted with SignalP (Petersen et al. 2011). RNA-seq analysis was performed with the Artemis Genome Browser and Annotation Tool (http://www. sanger.ac.uk/resources/software/artemis). Protein alignment was investigated using the BLAST+tool from NCBI (ftp:// ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST). Genomic islands were investigated using the PHAge Search Tool (http://phast.wishartlab.com/index.html) and Prophage Finder server (http://bioinformatics.uwp.edu/~phage/ ProphageFinder.php). Nucleotide sequence accession number The nucleotide sequence of the 16S rRNA of Staphylococcus sp. OJ82 and Bacillus sp. F1 was deposited in GenBank under accession number JX270830 and KC297162, respectively. A Whole-Genome Shotgun Project record was deposited at the DNA Data Bank of Japan/European Molecular Biology Laboratory/GenBank under accession number ALPU00000000 (Sung et al. 2012). The results of RNA-seq experiments have been deposited in GEO database under accession number GSE42992. Deposition of the new isolate in the culture collection Staphylococcus sp. OJ82 was deposited in Korean Agricultural Culture Collection (KACC) under the number KACC 16993.

Appl Microbiol Biotechnol (2014) 98:807–822

Results Isolation of bacterial strains and characterization of their enzyme activities Our unpublished bacterial community analysis data indicated that Staphylococcus is one of the major genera comprising the bacterial community of fermented seafood containing a high concentration of NaCl. A bacterial strain is expected to grow and have its enzyme activities in this condition. To simulate this NaCl-rich environment, we used LB agar containing 5 % NaCl and marine agar plates for isolation and characterization of isolates. We measured β-galactosidase, protease, and cellulase activities of isolates. One hundred eighty-four and 108 colonies from fermented seafood were isolated on 5 % NaCl LB agar and marine agar plates, respectively. A total of 292 isolates were tested to determine the presence of β-galactosidase, protease, and cellulase activities. Our initial screening showed that a substantial number of isolates have β-galactosidase (39.7 %) and protease (36.3 %) activities, but cellulase activity was found in only 11.3 % of the isolates. Among all tested isolates, 52 (17.8 %) isolates had both β-galactosidase and protease activities, and 31 (10.6 %) had both protease and cellulase activities. However, 172 (58.9 %) isolates had no such enzyme activity. When we cultured isolates possessing both βgalactosidase and protease activities using LB agar containing 10, 15, and 20 % NaCl, ten isolates retained both types of enzymatic activity even in the presence of high salt levels. Halotolerant isolates with high enzyme activity in NaClrich condition were identified as Staphylococcus based on the sequence analysis of 16S rRNA genes. An isolate with the highest β-galactosidase activity in LB containing 0–20 % NaCl was designated as OJ82. Interestingly, OJ82 grew and retained β-galactosidase activity up to 25 % NaCl. To our best knowledge, this is a much higher NaCl concentration than any other Staphylococcus species could grow in according to the previous reports (Taponen et al. 2012). For more detailed taxonomic identification, phylogenetic analysis was performed with the 16S rRNA gene sequences of the Staphylococcus type species. Sequence identity was 99.42, 99.35, and 98.49 % with S. equorum subsp. equorum, S. equorum subsp. linens, and S. xylosus, respectively. A phylogenetic tree also showed that OJ82 is closely associated with S. equorum species according to tree topology (Fig. 1). Further identification was conducted biochemically using VITEK 2 automated system. VITEK2 database identified that OJ82 is closest to S. equorum based on the biochemical characteristics, and this was consistent with the 16S rRNA gene sequence data. The results were compared with S. epidermidis and S. aureus. S. epidermidis is a well-known bacterial species found in human skin flora and S. aureus is a human-pathogenic species (Lambert et al. 2011); thereby, we

811

could expect biochemical differences from those species (El Farran et al. 2013). OJ82, S. epidermidis, and S. aureus were all positive in the acidification with mannose and sucrose and all negative with amygdalin, xylose, α-cyclodextrin, sorbitol, ribose, N-acetyl-glucosamine, methyl-β-D -glucopyranoside, pullulan, raffinose, and salicin. Alkalinization was all positive with lactate. Enzymatic test was all negative with Ala-Phe-Proarylamidase, L -aspartic acid arylamidase, proline arylamidase, alanine arylamidase, tyrosine arylamidase, phosphatidylinositol phospholipase C, α-glucosidase, α-mannosidase, αgalactosidase, β-galactosidase, and β-glucuronidase. OJ82, S. epidermidis, and S. aureus were all resistant to 6.5 % NaCl, vibriostatic agent O129, optochin resistance, and polymyxin B. Only differentiating results are listed in Table S2 of the “Electronic supplementary material”. The β-galactosidase activity of the OJ82 strain was compared with that of other well-known species including S. aureus ATCC 25923, S. intermedius ATCC 29663, S. nepalensis KACC 13208, S. muscae KACC 13176, S. warneri KACC 13240, and S. lentus ATCC 29070 under 0, 10, 15, 20, and 25 % NaCl conditions (Fig. 2). We used all species available from Korean Agricultural Culture Collection (KACC) at the moment of research. Our data showed that these species displayed almost no β-galactosidase activity at NaCl levels greater than 10 %. S. intermedius showed a similar level of activity up to 10 % NaCl. However, of all screened species and other types of strains, the OJ82 strain displayed the highest β-galactosidase activity under high-salt conditions. The protease activities of many Staphylococcus strains including OJ82 were not significantly different under high/low salt conditions (data not shown). Staphylococcus sp. OJ82 grew at up to 25 % NaCl in rich media and utilized fructose, glucose, glycerol, starch, galactose, saccharose, citrate, pyruvate, succinate, and sorbitol as a sole carbon source in minimal media. The growth rates of OJ82 were 0.486/h and 0.423/h under 1 and 11 % NaCl LB conditions, respectively, suggesting that OJ82 maintained a high growth rate even in the presence of a high level of salt, although lag time became longer under high-salt conditions (Fig. S1 of the “Electronic supplementary material”). Comparative genomic analysis of OJ82 and other Staphylococcus species The genome of OJ82 has been sequenced previously (Sung et al. 2012), and genomic analysis revealed that the utilization of all tested carbon substrates is feasible. The genomic features, including G+C content, GC skew, and coding sequences, are graphically depicted in Fig. S2 of the “Electronic supplementary material”. The general genome features of the six so far sequenced Staphylococcus species including OJ82 are listed in Table 1. The G+C contents of the Staphylococcus genomes are similar to one another (32.1–37.53 %), and the genome of Staphylococcus sp. OJ82 consists of a 2,899,115-bp circular

812

Appl Microbiol Biotechnol (2014) 98:807–822

Fig. 1 Phylogenetic analysis of OJ82 based on the 16S rRNA gene sequences. Phylogenetic analysis was performed with 57 Staphylococcus type species, and only closely related species were shown. Macrococcus caseolyticus ATCC 13548T (D83359) was used as an outgroup. Bootstrap values >70 % are shown. Bar 0.005 changes per nucleotide position. GenBank accession numbers are in parenthesis

chromosome that is larger than that of other Staphylococcus species (Fig. S2 of the “Electronic supplementary material”), although fewer genes for rRNAs are present. A genomic islands search using the PHAge Search Tool server and Prophage Finder revealed 12 genomic islands of prophage-related genes composing 6.32 % of the genome (Table S3 of the “Electronic supplementary material”). The cumulative GC skew profile showed that the genomic region around the origins of chromosome replication was highly conserved in Staphylococcus species (data not shown). The GC skew profile analysis of S. aureus subsp. aureus Mu3, S. epidermidis ATCC 12228, S. haemolyticus JCSC1435, S. lugdunensis HKU09-01, S. pseudintermedius HKU10-03, and OJ82 strain divided the species into two groups: OJ82 and S. epidermidis have only one amplitude site, whereas other species have more (data not shown). Fig. 2 Comparison of βgalactosidase activities of Staphylococcus species under various NaCl concentrations. βGalactosidase activity of the Staphylococcus sp. OJ82 strain was compared to that of other Staphylococcus species under various NaCl concentrations. The OJ82 strain displayed the highest β-galactosidase activity in Luria– Bertani agar containing 0–25 % NaCl

To analyze the genome of the OJ82 strain, we used clusters of orthologous groups (COGs) of protein categories. In the OJ82 genome, the majority of whole COGs were carbohydrate transport and metabolism (E), amino acid transport and metabolism (G), and transcription (K) with percentage of 7.4, 6.8, and 5.9 %, respectively. A comparison of the COGs of OJ82 with those of S. epidermidis and S. aureus showed that the OJ82 genome is more similar to that of S. epidermidis than to that of S. aureus. The three genomes have high levels of Grelated genes and low levels of cell motility (N)-related genes in common. OJ82 and S. epidermidis have more energy production and conversion (C)- and coenzyme transport and metabolism (H)-related genes compared with those of S. aureus. However, S. aureus has a large number of inorganic ion transport and metabolism (P)- and secondary metabolite biosynthesis, transport, and catabolism (Q)-related genes

Appl Microbiol Biotechnol (2014) 98:807–822

813

Table 1 Main genomic features of Staphylococcus species Characteristic

Valuesa Staphylococcus sp. OJ82

S. aureus subsp. aureus Mu3

S. epidermidis ATCC 12228

S. haemolyticus JCSC1435

S. lugdunensis HKU09-01

S. pseudintermedius HKU10-03

Total size (bp)

2,899,115

2,880,168

2,499,279

2,685,015

2,658,366

2,617,381

GC content (%) No. of proteincoding genes No. of plasmids Transfer RNAs rRNAs 5s 16 s 23 s Total tRNA genes Total genes Protein coding genes DNA scaffolds GenBank accession number

32.86 2,841 None 58

32.88 2,698 None 61

32.1 2,419 6 60

32.78 2,692 3 59

33.87 2,490 None 61

37.53 2,450 None 59

4 3 3 58 2,909 2,841 11 ALPU00000000.1

6 5 5 61 2,776 2,698 1 AP009324.1

6 5 5 60 2,602 2,485 7 AE015929.1

6 5 5 59 2,809 2,692 4 AP006716.1

7 6 6 61 2,570 2,490 1 CP001837.1

7 6 6 59 2,528 2,450 1 CP002439.1

a

Information for S. aureus subsp. aureus Mu3, S. epidermidis ATCC 12228, S. haemolyticus JCSC1435, S. lugdunensis HKU09-01, and S. pseudintermedius HKU10-03 genomes, respectively, is presented for comparison. With the exception of that for Staphylococcus sp. OJ82, information about the genomes is available on the IMG website (http://img.jgi.doe.gov/)

compared with those of the other two species (Fig. S3 of the “Electronic supplementary material”). A comparison of amino acid sequences deduced from all genes of OJ82 with S. epidermidis and S. aureus (97.2 and 96.6 % 16 s rRNA similarities, respectively) showed that 434 proteins of OJ82 are unique among the three tested species (Cutoff was E-value 2.0-fold) in LBHS condition makes OJ82 a more competitive strain in high-salt fermenting condition. Identification of target β-galactosidase and protease genes Genome sequencing data predicted that OJ82 harbors one β-galactosidase gene (SOJ_03470) and multiple protease genes (Sung et al. 2012). RNA-seq results

816

Appl Microbiol Biotechnol (2014) 98:807–822

Fig. 5 Schematic diagram showing important genes that are highly upregulated under high NaCl concentrations. Transcription and translation activity of Staphylococcus sp. OJ82 increases via upregulation of nucleoside triphosphate (NTP) synthesis, RNA polymerase, transfer RNA (tRNA), and ribosomal proteins. Uptake of compatible solutes, transporters, and cell membranes was highly upregulated, which might be an important adaptive mechanism of OJ82 under salt stress. Red class colors indicate the relative level of gene expression. RuMP ribulose monophosphate

indicated that the expression of four genes for proteases (SOJ_07900, SOJ_17070, SOJ_19600, and SOJ_16930) increased at least 1.8-fold under 11 % NaCl conditions. However, expression of the β-galactosidase gene was downregulated (−2.4-fold change), which is consistent with data (Fig. 2) indicating that NaCl reduces the production of β-galactosidase. qRT-PCR results reconfirmed that the proteases are highly expressed under salt-rich conditions (Fig. S5 of the “Electronic supplementary material”). SOJ_13740 seemed to be responsible for extracellular protease activity measured in high-salt condition because SOJ_13740 was the only protease gene with a signal peptide for translocation across the membrane among all upregulated proteases. High β-galactosidase and protease activity of OJ82 indicated that OJ82 could be actively involved in a fermentation process. Antibiotic resistance in high-salt condition Interestingly, OJ82 harbors β-lactamase genes ampC (SOJ_20810) and penP (SOJ_25740) and they were downregulated in LBHS condition. Experimental data confirmed that minimum inhibitory concentration of ampicillin in LB (0.5 μg/ mL) completely inhibited the growth of the OJ82 in LBHS. Small RNA candidates RNAseq reads were mapped to the genome of OJ82 using Artemis Comparison Tool (Carver et al. 2005). Interestingly, nine intergenic regions were highly expressed (Table S4 and Fig. S6 of the “Electronic supplementary material”). BLASTN search revealed that intergenic sequences of

SOJ_00040/SOJ_00050, SOJ_14570/SOJ_14580, and SOJ_22840/SOJ_22850 were matched to previously experimentally confirmed small RNA (sRNA) sequences of S. aureus , S. epidermidis , and S. xylosus , respectively (Geissmann et al. 2009). The predicted sRNAs have 42–102 nucleotides and 51.0–56.7 % G+C content. sRNA has usually high G+C content because it can give rise to a stable RNA secondary structure (Chan et al. 2009). Gene arrangement neighboring sRNA were conserved in S. aureus and S. epidermidis , suggesting that our sRNA candidates of OJ82 could be functional as identified from other Staphylococcus species. Bacteriocin resistance of OJ82 under high-salt conditions The sensitivity of OJ82 to bacteriocin was determined qualitatively via the agar diffusion test (data not shown) and quantitatively with flow cytometry (Fig. S7 of the “Electronic supplementary material”). The OJ82 strain appeared to be inhibited by bacteriocin from Bacillus sp. F1 under 1 % NaCl conditions, whereas it was resistant to bacteriocin under high-salt (6 % NaCl) conditions. The inhibition zone of the OJ82 strain was 45–50 mm in diameter by bacteriocin under 1 % NaCl conditions, while the halo zone was not detected under 11 % NaCl conditions. Similar percentage of the living S. epidermidis cells under 1 % and 6 % NaCl condition indicated that the effect of bacteriocin produced by Bacillus sp. F1 was not significantly different. However, the percentage of living cells of OJ82 was increased to 34.2 % in 6 % NaCl condition. Our data showed that higher NaCl concentrations protected OJ82 from the bacteriocin-like compound produced by Bacillus sp. F1.

Appl Microbiol Biotechnol (2014) 98:807–822

Comparison of gene expression under acute osmotic stress condition To distinguish the level of gene expression between high-saltadapted cells and osmotically shocked cells, we selected 11 genes related to RuMP pathway, transcription, translation, potassium uptake system, biosynthesis, and transport of proline and glycine betaine (Fig. 6). Our qRT-PCR with adapted cells was consistent with RNA-seq data (Fig. 6). The qRTPCR demonstrated that the RuMP pathway presented by hxlA and hxlB was expressed more than twofold within 30 min; however, they were significantly induced under adaptated condition, suggesting that the RuMP pathway is required in osmotic stress adaptation condition rather than in osmotic shock condition. Similar gene expression patterns were observed for RNA polymerase gene (rpoB) and 50S ribosomal protein gene (rpmH) (Fig. 6a). The expression level of potassium uptake system (ktrA) was not changed statistically in all tested conditions. It appeared that potassium uptake is not important for osmotic stress defense in OJ82 (Fig. 6b). Interestingly, we observed transiently expressed betaine aldehyde dehydrogenase (gbsA) in 30 min after exposure to 11 % NaCl shock (4.5-fold), while its expression was statistically insignificant in adapted conditions (Fig. 6b). Glycine betaine transporters (betT and opuA ) had a similar expression profile showing the highest expression at 30 min; however, their expression remained more than twofold in adapted conditions. Expression analysis of gbsA, betT, and opuA genes indicated that OJ82 might require both biosynthesis and uptake of glycine betaine to defense osmotic stress; however, our physiological data suggest that OJ82 preferred uptaking glycine betaine to synthesizing it under osmotic stress adaptation process. OJ82 used proline as a major, compatible solute, as shown in the expression pattern of pyrroline-5-carboxylate reductase (proH) and two sodium/proline symporter (putP1 and putP2 ) as well as growth curves (Fig. S8 of the “Electronic supplementary material”). The growth defect under 11 % NaCl was recovered by addition of proline and glycine betaine. Our data confirmed that proline was the most effective compatible solute for OJ82.

Discussion Our unpublished pyrosequencing-based community analysis of Korean fermented seafood showed that the dominant genera of bacteria in fermented seafood are Leuconostoc, Bacillus, and Staphylococcus. Interestingly, many isolates were identified as Staphylococcus even though Staphylococcus was the third largest genus. This may be because the isolation was performed from media containing high levels of NaCl, and Staphylococcus strains could be tolerant to NaCl-rich conditions. Previous culture-dependent community analysis

817

of jeotgal containing high levels of NaCl reported that Staphylococcus isolated from jeotgal did not have proteolysis activity; however, they were described as “too numerous to ignore” (Guan et al. 2011). Many other studies also showed that the isolates from fermented seafood were predominantly Staphylococcus species (Corbière et al. 2006; Guan et al. 2011; Leroy et al. 2010; Nam et al. 2012). Therefore, Staphylococcus seemed to be relatively easily isolated in a lab culture condition compared to other predominant species. Up-regulation of transcription- and translation-related genes was quite interesting because under 11 % NaCl condition the growth rate was decreased. Our previous comparative transcriptomic study performed with Alishewanella species showed similar results (Jung and Park 2013). While the growth rate was slowed down, transcription- and translationrelated genes were highly up-regulated in Alishewanella species grown on pectin as a sole carbon source. Therefore, it is worthwhile to note that the transcriptional and translational activities uncoupled with cell growth are not limited to the current study. Considering the up-regulated protein folding-, degradation-, and turnover-related genes, cells under osmotic stress condition should require newly synthesized proteins to replace damaged or malfunctioning proteins. Up-regulation of the RuMP pathway, many transporters, and biosynthesis or uptake of compatible solute-related genes also suggested that many kinds of proteins should be produced to defend against salt stress condition regardless to cell growth. We speculated that methylglyoxal might be produced during growth under high-salt conditions. Methylglyoxal, a byproduct of several metabolic pathways such as threonine catabolism, lipid peroxidation, and glycerol metabolism, is reportedly an inducer for the hxlAB operon via hxlR-dependent regulation (Nguyenet al. 2009). Methylglyoxal is highly toxic to cellular processes; however, its production is inevitable because it originates from non-enzymatic dephosphorylation of glyceraldehyde phosphate and dihydroxyacetone phosphate, intermediates of glycolysis. Methylglyoxal is a known by-product of reactions under high-salt conditions, and the glyoxalase system, encoded by gloA and gloB genes, is necessary for the detoxification of methylglyoxal (MacLean et al. 1998). The OJ82 genome has gloA and gloB candidates (SOJ_07440 and SOJ_13410, respectively), which have 79 % identity with those of S. saprophyticus. Our data showed that their expression was changed 1.9- and −1.1-fold, respectively, under 11 % NaCl conditions. This observation suggested that methylglyoxal could be also generated during the growth of OJ82 under high-salt conditions and that the RuMP pathway might be required for the detoxification of methylglyoxal. Under high-salt conditions, metabolic versatility in bacteria is managed through changes in gene expression. High-salt conditions lead to low carbohydrate concentration in bacteria. In the OJ82 genome, the three top-level functional COGs are amino acid transport and metabolism (E), carbohydrate

818

Appl Microbiol Biotechnol (2014) 98:807–822

Fig. 6 Expression of genes related to a RuMP pathway, transcription, and translation; b potassium uptake, biosynthesis and transport of glycine betaine and biosynthesis and transport of proline. Relative expression indicated the fold change compared to exponentially growing cell in 1 % NaCl containing LB. RNA-seq data were shown for comparison.

Standard deviation could be calculated from a single run of RNA-seq. Different letters on bar graphs indicate statistical significance between results. Average and standard deviations were calculated from biological triplicate experiments

transport and metabolism (G), and transcription (K) at 7.4, 6.8, and 5.9 %, respectively. However, in the transcriptome analysis of the OJ82 genome, genes acting in amino acid metabolism (E) and carbohydrate transport and metabolism (G) are 2.4 and 2.7 % downregulated, whereas genes acting in translation, ribosomal structure, and biogenesis (J) is 1.7 % upregulated under 11 % NaCl conditions. Responses to salt stress in OJ82 revealed that metabolism was downregulated, whereas translation, ribosomal structure, and biogenesis were upregulated. Induction of σB and σB-regulated genes by diverse stresses such as heat shock, MnCl2, alkaline shock, and NaCl has been reported in B. subtilis , Listeria monocytogenes, S. aureus (van Schaik and Abee 2005; Hahne et al. 2010; Ringus et al. 2012 ). Transcriptomic analysis of OJ82 under salt stress showed that the expression of σB and the homologs of σB regulation in S. aureus were mostly downregulated (data not shown) (Pane-Farre et al. 2006). We have suggested that this discrepancy in the level of σB operon expression is due to the time-dependent regulatory mechanism of σ factors for adaptation under stress conditions (Hahne et al. 2010) because the OJ82 strain was not shocked by high-salt exposure for short periods of time but instead adapted to such stress. Genome sequencing of OJ82 revealed four σ factors (SOJ_11450, SOJ_13140, SOJ_15220, and SOJ_26210) consistent with a previous report indicating that S. aureus has only four σ factors (Miller et al. 2012). Different expression levels of the σ factors (−2.0-, -1.4-, 1.4-, and 1.1-fold for SOJ_11450, SOJ_13140, SOJ_15220, and SOJ_26210, respectively) implied that certain groups of genes are affected differently by increased transcriptional activity. The σB-encoding sigB (SOJ_11450) was neighbored with genes for anti-σ factor (RsbW homolog, SOJ_11440) and anti-anti-σ factor (RsbV homolog, SOJ_11430). However, expression of RsbW and

RsbV was downregulated (−1.9- and −1.6-fold, respectively). The expression of σB and σB-controlled genes was also downregulated (−1.9- and −1.8-fold, respectively; data not shown), indicating that σB is not involved in the adaptation of the OJ82 strain to osmotic stress (Ringus et al. 2012; Zhang et al. 2012). The gene expression profiles shown in Fig. 6 might be a clue to understand transcriptional regulation in a timely manner. For example, genes related to biosynthesis and transport such as gbsA, betT, opuA, proH, and putP began to be significantly expressed after 30 min of exposure to 11 % NaCl-containing LB and gbsA was down-regulated at the adaptation status. In S. aureus, proline transporter putP was identified as a σB regulon, and the involvement of σB in other compatible solute metabolisms is expected (Schwan et al. 2006). Currently, we determined a limited number of the gene expression profiles with different time points at osmotic stress condition. Involvement of σB in transcriptional regulation under osmotic stress will need further detailed genetic analysis. Staphylococcus species need to import proline through proline transporters to survive under high-salt conditions. The putP gene, which encodes a high-affinity proline permease, is important for the survival of Staphylococcus species under these conditions (Schwan et al. 2006). The OJ82 strain has two putP homolog genes, SOJ_07220 and SOJ_03230, with expressions that were 3.2- and 2.2-fold upregulated, respectively. SsaA protein has d-alanyl-glycyl endopeptidase activity, which is involved in peptidoglycan cross-linking relaxation (Delaune et al. 2011). The OJ82 genome has a gene for SsaA-like protein, SOJ_24070, which displayed 3.8-fold increases in expression, suggesting that peptidoglycan relaxation conferred by SsaA might contribute to the survival of OJ82 under high-salt conditions.

Appl Microbiol Biotechnol (2014) 98:807–822 Table 2 Upregulated (more than twofold) cell wall and membraneassociated genes of the Staphylococcus sp. OJ82 genome under 11 % NaCl conditions

ND not detected a

Transmembrane

Function and locus tag

819

Annotated product

Gene

TMa

Fold change

acm

ND ND ND ND ND ND ND ND ND

16.1 14.0 11.4 3.8 3.6 3.3 3.1 3.1 2.8 2.7 2.7 2.6 2.6 2.5 2.5 2.5 2.5 2.4 2.4 2.4 2.3 2.3 2.2 2.2 2.2 2.1 2.1

Cell membrane SOJ_04970 SOJ_04330 SOJ_11190 SOJ_24070 SOJ_01060 SOJ_09420 SOJ_21250 SOJ_06350 SOJ_01010

Hypothetical protein putative M23 family peptidase Hypothetical protein transglycosylase domain protein Hypothetical protein probable transglycosylase SceD Secretory antigen SsaA-like protein 1,4-β-N-Acetylmuramidase Secretory antigen precursor Enoyl-(acyl carrier protein) reductase Putative transglycosylase IsaA Extracellular amidase

SOJ_17330 SOJ_24260 SOJ_13600 SOJ_14150 SOJ_04040 SOJ_12300 SOJ_19700 SOJ_23860 SOJ_14490 SOJ_13930 SOJ_19780 SOJ_12420 SOJ_27140 SOJ_04030 SOJ_28360 SOJ_02890 SOJ_12310 SOJ_20430

Large-conductance mechanosensitive channel Penicillin binding protein 4 1-Acyl-sn-glycerol-3-phosphate acyltransferase Trigger factor VanW family protein Uridine diphosphate N-acetylmuramyl tripeptide synthase Cell division protein FtsZ Undecaprenyl pyrophosphate phosphatase Preprotein translocase subunit Acetyl-CoA carboxylase carboxyltransferase subunit α Cell division protein MraZ Leucyl aminopeptidase Membrane spanning protein VanW family protein Putative cell division protein N-Acetylmuramoyl-l-alanine amidase Glutamine amidotransferase Peptide deformylase

def

2 1 ND ND ND ND ND 6 1 ND ND ND 6 ND 7 ND ND ND

Transporter SOJ_23450 SOJ_23440 SOJ_17320 SOJ_07220 SOJ_02040 SOJ_08660

Di-tripeptide permease Di-tripeptide permease Glycine betaine transporter High-affinity proline permease Putative α-ketoglutarate permease

dtp dtp betT putP narK

14 14 12 13 9

4.4 4.0 3.6 3.2 3.2

SOJ_27210 SOJ_02050 SOJ_07690 SOJ_09340 SOJ_26340 SOJ_27390 SOJ_08610 SOJ_22250 SOJ_03230 SOJ_00700 SOJ_23530

L -Lactate permease Glycerol-3-phosphate transporter Putative α-ketoglutarate permease Transporter SMR-type multidrug efflux transporter Nucleoside permease Glycine betaine transporter Major facilitator superfamily permease ATP-binding cassette transporter permease Sodium/proline symporter Sodium/dicarboxylate symporter protein Divalent heavy-metal cation transporter

lldP uhpC araJ araJ emrE nupC betT araJ abcD putP

14 12 3 11 3 9 12 12 5 13 9 7

3.2 3.1 3.0 3.0 2.8 2.4 2.4 2.4 2.3 2.3 2.2 2.1

SOJ_21470 SOJ_04840

Major facilitator superfamily permease Sodium-alanine symporter

melB alsT

12 1

2.1 2.0

fabI

mscL dacC plsC tig murE ftsZ bacA yajC accA ampS

ftsW flgJ

820

Under salt stress, transporters for ion uptake, ion export, and osmoprotectant uptake play important defensive roles. Not all transporters are used for defense when they exist in multiple copies. OJ82 upregulated only selected genes of glycine betaine uptake, proline uptake, and Na+/H+ antiporters (Fig. 5), which may explain the various regulatory systems for those genes or different contributions to cell viability (Zuleta et al. 2003). Important molecular chaperones play essential roles in stress tolerance (Tang et al. 2012). However, the chaperone-associated genes in OJ82 were almost downregulated under 11 % NaCl conditions. The level of protein expression of OJ82 under high osmotic stress needs to be investigated. The present study showed that many membrane-associated and division-related genes are highly upregulated (Fig. 5). The M23-peptidase family performs (D , D )-carboxypeptidation and regulates cell shape (Bonis et al. 2010). The OJ82 strain has one gene for a M23 family protein (SOJ_07970) with 16.1-fold expression increase under high-salt conditions. Bacterial cell wall peptidoglycan undergoes hydrolysis for cell wall growth and division. Staphylococcus species have many known and putative peptidoglycan hydrolases, including two lytic transglycosylases, IsaA and SceD. Both proteins reportedly have autolytic activity (Stapleton et al. 2007). The expression of these genes in the OJ82 strain increased 11.4- and 3.1-fold, respectively. Another study has demonstrated that SceD is highly upregulated by the presence of salt (Stapleton et al. 2007) (Table 2). Small RNA molecules are ubiquitous regulatory molecules that may function at the transcriptional or posttranscriptional levels (Gottesman 2005; Toledo-Arana et al. 2007; Waters and Storz 2009). Staphylococcus sp. OJ82 has sequences for nine small RNA candidates in intergenic regions (Table S4 of the “Electronic supplementary material”). BLASTN and BLASTP identified that three sequences for small RNA candidates are similar with previously confirmed small RNA sequences of Staphylococcus species. They are neighbored with genes for a recombination protein RecR (SOJ_00010), tRNA synthetases (HisS; SOJ_14560, AspS; SOJ_14570), and an SsrA-binding protein (SmpB; SOJ_22850), respectively, located in contig 01, 08, and 11. Other candidates have no significant matches in the database (Fig. S6 of the “Electronic supplementary material”). Staphylococcus sp. OJ82 also has a gene for RNA-binding protein (Hfq; SOJ_18330). The Hfq gene (hfq) had 68 % amino acid identity with that of S. aureus (Castro et al. 2011) and is a global regulator that modulates the stability, translation, and polyadenylation of numerous messenger RNAs (Valentin-Hansen et al. 2004). Inactivation of the hfq gene in bacteria results in lower growth and sensitivity to various environmental stresses (Hempel et al. 2013). When Staphylococcus sp. OJ82 is exposed to high salt concentrations, the hfq product (−1.2-fold change) might be important for its

Appl Microbiol Biotechnol (2014) 98:807–822

survival although the expression of the hfq was not changed significantly. Bacteriocin producers have an advantage in competing with other bacteria sharing the same ecological niche (Diep and Nes 2002; Eijsink et al. 2002). Most of the bacteriocinproducing bacteria have been isolated from fermented food, and such microorganisms have been considered important in food preservation. Bacteriocin likely plays an important role in keeping pathogens away from fermented food. The OJ82 strain is also affected by bacteriocin under 1 % NaCl conditions. However, bacteriocin does not affect the OJ82 strain under 11 % NaCl conditions. OJ82 survives bacteriocin exposure in a salted environment. This characteristic might be helpful for an abundance of OJ82-like species in many types of fermented seafood. In conclusion, we investigated the enzymatic, genomic, and transcriptomic analyses to provide comprehensive understanding of the halotolerant characteristics of Staphylococcus sp.OJ82. Numerous studies on the isolation and characterization of clinical sample-originated staphylococci have been reported; however, our data is distinguished by taking the approaches from the environmental aspects. Many previous researches about bacterial response to osmotic stress were limited to a small number of characteristics, providing not enough information for one to have comprehensive understanding of bacterial stress response. In this study, we provided a whole picture of cellular function by employing RNA-seq technique as summarized in Fig. 5. Briefly, genomics and transcriptomic analysis of OJ82 suggested that expression of transcription, translation, protein turnover, membrane integrity, and compatible solute transport would be important for adaptation in high-salt condition. Experimental data such as qRT-PCR from different time points after exposure to stress and growth curves corroborated the sequencing data. Additionally, we also demonstrated that the different physiology of antibiotic and bacteriocin resistance under high-salt condition might affect the interaction among bacterial communities. This study will improve our understanding of the characteristics of halotolerance in Staphylococcus in natural environments.

Acknowledgments This study was supported by a grant from the NextGeneration BioGreen 21 Program (PJ0082082013), Rural Development Administration, Korea.

References Bonis M, Ecobichon C, Guadagnini S, Prévost MC, Boneca IG (2010) A M23B family metallopeptidase of Helicobacter pylori required for cell shape, pole formation and virulence. Mol Microbiol 78:809– 819

Appl Microbiol Biotechnol (2014) 98:807–822 Carver TJ, Rutherford KM, Berriman M, Rajandream MA, Barrell BG, Parkhill J (2005) ACT: the Artemis Comparison Tool. Bioinformatics 21:3422–3423 Castro SL, Nelman-Gonzalez M, Nickerson CA, Ott CM (2011) Induction of attachment-independent biofilm formation and repression of hfq expression by low-fluid-shear culture of Staphylococcus aureus. Appl Environ Microbiol 77:6368–6378 Chan CY, Carmack CS, Long DD, Maliyekkel A, Shao Y, Roninson IB, Ding Y (2009) A structural interpretation of the effect of GC-content on efficiency of RNA interference. BMC Bioinforma 30:10 Corbière Morot-Bizot S, Leroy S, Talon R (2006) Staphylococcal community of a small unit manufacturing traditional dry fermented sausages. Int J Food Microbiol 108:210–217 Dartigalongue C, Raina S (1998) A new heat-shock gene, ppiD, encodes a peptidyl-prolyl isomerase required for folding of outer membrane proteins in Escherichia coli. EMBO J 17:3968–3980 Delaune A, Poupel O, Mallet A, Coic YM, Msadek T, Dubrac S (2011) Peptidoglycan crosslinking relaxation plays an important role in Staphylococcus aureus WalKR-dependent cell viability. PLoS ONE 28:17054 Diep DB, Nes IF (2002) Ribosomally synthesized antibacterial peptides in gram positive bacteria. Curr Drug Targets 3:107–122 Eijsink VG, Axelsson L, Diep DB, Havarstein LS, Holo H, Nes IF (2002) Production of class II bacteriocins by lactic acid bacteria; an example of biological warfare and communication. Antonie Van Leeuwenhoek 81:639–654 El Farran CA, Sekar A, Balakrishnan A, Shanmugam S, Arumugam P, Gopalswamy J (2013) Prevalence of biofilm-producing Staphylococcus epidermidis in the healthy skin of individuals in Tamil Nadu, India. Indian J Med Microbiol 31:19–23 Epstein W (1986) Osmoregulation by potassium transport in Escherichia coli. FEMS Microbiol Rev 39:73–78 Fredericq P (1957) Colicins. Ann Rev Microbiol 11:7–22 Geissmann T, Chevalier C, Cros MJ, Boisset S, Fechter P, Noirot C, Schrenzel J, François P, Vandenesch F, Gaspin C, Romby P (2009) A search for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequence motif for regulation. Nucleic Acids Res 37:7239–7257 Göthel SF, Scholz C, Schmid FX, Marahiel MA (1998) Cyclophilin and trigger factor from Bacillus subtilis catalyze in vitro protein folding and are necessary for viability under starvation conditions. Biochemistry 37:13392–13399 Gottesman S (2005) Micros for microbes: non-coding regulatory RNAs in bacteria. Trends Genet 21:399–404 Guan L, Cho KH, Lee JH (2011) Analysis of the cultivable bacterial community in jeotgal, a Korean salted and fermented seafood, and identification of its dominant bacteria. Food Microbiol 28:101–113 Gunn BA, Colwell RR (1983) Numerical taxonomy of Staphylococci isolated from the marine environment. Int J Syst Evol Microbiol 33: 751–759 Hahne H, Mäder U, Otto A, Bonn F, Steil L, Bremer E, Hecker M, Becher D (2010) A comprehensive proteomics and transcriptomics analysis of Bacillus subtilis salt stress adaptation. J Bacteriol 192:870–882 Hájek V, Ludwig W, Schleifer KH, Springer N, Zitzelsberger W, Kroppenstedt RM, Kocur M (1992) Staphylococcus muscae , a new species isolated from flies. Int J Syst Evol Microbiol 42:97–101 Hempel RJ, Morton DJ, Seale TW, Whitby PW, Stull TL (2013) The role of the RNA chaperone Hfq in Haemophilus influenzae pathogenesis. BMC Microbiol 13:134 Holtmann G, Bakker EP, Uozumi N, Bremer E (2003) KtrAB and KtrCD: two K+ uptake systems in Bacillus subtilis and their role in adaptation to hypertonicity. J Bacteriol 185:1289–1298 Ito M, Guffanti AA, Oudega B, Krulwich TA (1999) mrp, a multigene, multifunctional locus in Bacillus subtilis with roles in resistance to cholate and to Na+ and in pH homeostasis. J Bacteriol 181:2394– 2402

821 Jung J, Park W (2013) Comparative genomic and transcriptomic analysis reveal habitat differentiation and different transcriptional responses during pectin metabolism in Alishewanella species. Appl Environ Microbiol 79:6351–6361 Jung J, Chun J, Park W (2012) Genome sequence of extracellularprotease-producing Alishewanella jeotgali isolated from traditional Korean fermented seafood. J Bacteriol 194:2097 Kandror O, Sherman M, Rhode M, Goldberg AL (1995) Trigger factor is involved in GroEL-dependent protein degradation in Escherichia coli and promotes binding of GroEL to unfolded proteins. EMBO J 14:6021–6027 Kato N, Yurimoto H, Thauer RK (2006) The physiological role of the ribulose monophosphate pathway in bacteria and archaea. Biosci Biotech Biochem 70:10–21 Lambert LH, Cox T, Mitchell K, Rosselló-Mora RA, Del Cueto C, Dodge DE, Orkand P, Cano RJ (1998) Staphylococcus succinus sp. nov., isolated from Dominican amber. Int J Syst Evol Microbiol 48:511– 518 Lambert ML, Suetens C, Savey A, Palomar M, Hiesmayr M, Morales I, Agodi A, Frank U, Mertens K, Schumacher M, Wolkewitz M (2011) Clinical outcomes of health-care-associated infections and antimicrobial resistance in patients admitted to European intensive-care units: a cohort study. Lancet Infect Dis 11:30–38 Leroy S, Giammarinaro P, Chacornac JP, Lebert I, Talon R (2010) Biodiversity of indigenous staphylococci of naturally fermented dry sausages and manufacturing environments of small-scale processing units. Food Microbiol 27:294–301 MacLean MJ, Ness LS, Ferguson GP, Booth IR (1998) The role of glyoxalase I in the detoxification of methylglyoxal and in the activation of the KefB K+ efflux system in Escherichia coli. Mol Microbiol 27:563–571 Miller JH (1992) A short course in bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Miller HK, Carroll RK, Burda WN, Krute CN, Davenport JE, Shaw LN (2012) The extracytoplasmic function sigma factor σS protects against both intracellular and extracytoplasmic stresses in Staphylococcus aureus. J Bacteriol 194:4342–4354 Nam YD, Lee SY, Lim SI (2012) Microbial community analysis of Korean soybean pastes by next-generation sequencing. Int J Food Microbiol 155:36–42 Nguyenet TT, Eiamphungporn W, Mäder U, Liebeke M, Lalk M, Hecker M, Helmann JD, Antelmann H (2009) Genome-wide responses to carbonyl electrophiles in Bacillus subtilis: control of the thioldependent formaldehyde dehydrogenase AdhA and cysteine proteinase YraA by the MerR-family regulator YraB (AdhR). Mol Microbiol 71:876–894 Padan E, Maisler N, Taglicht D, Karpel R, Schuldiner S (1989) Deletion of ant in Escherichia coli reveals its function in adaptation to high salinity and an alternative Na+/H+ antiporter systems(s). J Biol Chem 264:20297–20302 Pane-Farre J, Jonas B, Förstner K, Engelmann S, Hecker M (2006) The σB regulon in Staphylococcus aureus and its regulation. Int J Med Microbiol 296:237–258 Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8:785–786 Pomeranz Y (1964) Lactase occurrence and properties. Food Tech 88:682 Probst AJ, Hertel C, Richter L, Wassill L, Ludwig W, Hammes WP (1998) Staphylococcus condimenti sp. nov., from soy sauce mash, and Staphylococcus carnosus subsp. utilis subsp. nov. Int J Syst Evol Microbiol 48:651–658 Pruitt KD, Tatusova T, Klimke W, Maglott DR (2009) NCBI reference sequences: current status, policy and new initiatives. Nucleic Acids Res 37:32–36 Ringus DL, Ivy RA, Wiedmann M, Boor KJ (2012) Salt stress-induced transcription of σB- and CtsR-regulated genes in persistent and non-

822 persistent Listeria monocytogenes strains from food processing plants. Foodborne Pathog Dis 9:198–206 Schleifer KH, Kloos WE (1975) Isolation and characterization of staphylococci from human skin I. Amended description of Staphylococcus epidermidis and Staphylococcus saprophyticus and descriptions of three new species: Staphylococcus cohnii , Staphylococcus haemolyticus, and Staphylococcus xylous. Int J Syst Evol Microbiol 25:50–61 Schwan WR, Lehmann L, McCormick J (2006) Transcriptional activation of the Staphylococcus aureus putP gene by low-proline-high osmotic conditions and during infection of murine and human tissues. Infect Immun 74:399–409 Sklar JG, Wu T, Kahne D, Silhavy TJ (2007) Defining the roles of the periplasmic chaperones SurA, Skp, and DegP in Escherichia coli. Genes Dev 21:2473–2484 Sleator RD, Hill C (2001) Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol Rev 26:49–71 Stapleton MR, Horsburgh MJ, Hayhurst EJ, Wright L, Jonsson IM, Tarkowski A, Kokai-Kun JF, Mond JJ, Foster SJ (2007) Characterization of IsaA and SceD, two putative lytic transglycosylases of Staphylococcus aureus . J Bacteriol 189: 7316–7325 Stoller G, Rücknagel KP, Nierhaus KH, Schmid FX, Fischer G, Rahfeld JU (1995) A ribosome-associated peptidyl-prolyl cis/trans isomerase identified as the trigger factor. EMBO J 14:4939–4948 Sung J, Chun J, Choi S, Park W (2012) Genome sequence of the halotolerant Staphylococcus sp. strain OJ82, isolated from Korean traditional salt-fermented seafood. J Bacteriol 194:6353–6354 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 Tanasupawat S, Hashimoto Y, Ezaki T, Kozaki M, Komagata K (1992) Staphylococcus piscifermentans sp. nov., from fermented fish in Thailand. Int J Syst Evol Microbiol 42:577–581

Appl Microbiol Biotechnol (2014) 98:807–822 Tang T, Wu C, Li J, Ren G, Huang D, Liu F (2012) Stress-induced HSP70 from Musca domestica plays a functionally significant role in the immune system. J Insect Physiol 58:1226–1234 Taponen S, Supré K, Piessens V, Van Coillie E, De Vliegher S, Koort JM (2012) Staphylococcus agnetis sp. nov., a coagulase-variable species from bovine subclinical and mild clinical mastitis. Int J Syst Evol Microbiol 62:61–65 Teather RM, Wood PJ (1982) Use of Congo red–polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl Environ Microbiol 43:777–780 Toledo-Arana A, Repoila F, Cossart P (2007) Small noncoding RNAs controlling pathogenesis. Curr Opin Microbiol 10:182–188 Valentin-Hansen P, Eriksen M, Udesen C (2004) The bacterial Sm-like protein Hfq: a key player in RNA transactions. Mol Microbiol 51: 1525–1533 van Schaik W, Abee T (2005) The role of σB in the stress response of Gram-positive bacteria—targets for food preservation and safety. Curr Opin Biotechnol 16:218–224 Vernozy-Rozand C, Mazuy C, Meugnier H, Bes M, Lasne Y, Fiedler F, Etienne J, Freney J (2000) Staphylococcus fleurettii sp. nov., isolated from goat's milk cheeses. Int J Syst Evol Microbiol 50:1521– 1527 Waters LS, Storz G (2009) Regulatory RNAs in bacteria. Cell 136:615– 628 Whatmore AM, Chudek JA, Reed RH (1990) The effects of osmotic upshock on the intracellular solute pools of Bacillus subtilis. J Gen Microbiol 136:2527–2535 Yeom J, Imlay JA, Park W (2010) Iron homeostasis affects antibioticmediated cell death in Pseudomonas species. J Biol Chem 285: 22689–22695 Zhang Z, Meng Q, Qiao J, Yang L, Cai X, Wang G, Chen C, Zhang L (2012) RsbVof Listeria monocytogenes contributes to regulation of environmental stress and virulence. Arch Microbiol 195:113–120 Zuleta LF, Italiani VC, Marques MV (2003) Isolation and characterization of NaCl-sensitive mutants of Caulobacter crescentus. Appl Environ Microbiol 69:3029–3035