Fish & Shellfish Immunology 40 (2014) 485e499

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Comparative study of immune responses in the deep-sea hydrothermal vent mussel Bathymodiolus azoricus and the shallowwater mussel Mytilus galloprovincialis challenged with Vibrio bacteria
nio Figueras c, Beatriz Novoa c, Ricardo Serra ~o Santos a, b, Eva Martins a, b, Anto c b, d, * Rebeca Moreira , Raul Bettencourt a

Department of Oceanography and Fisheries, University of the Azores (DOP/UAç), Rua Prof. Doutor Frederico Machado, 9901-862 Horta, Portugal IMAR Institute of Marine Research and LARSyS Laboratory of Robotics and Systems in Engineering and Science, 9901-862 Horta, Azores, Portugal Instituto de Investigaciones Marinas, IIM e CSIC. Eduardo Cabello, 6, 36208 Vigo, Spain d MARE-Marine and Environmental Science Center, University of the Azores, 9901-862 Horta, Azores, Portugal b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 23 April 2014 Received in revised form 8 July 2014 Accepted 9 July 2014 Available online 1 August 2014

The deep-sea hydrothermal vent mussel Bathymodiolus azoricus and the continental European coast Mytilus galloprovincialis are two bivalves species living in highly distinct marine habitats. Mussels are filter-feeding animals that may accumulate rapidly bacteria from the environment. Contact with microorganism is thus inevitable during feeding processes where gill tissues assume a strategic importance at the interface between the external milieu and the internal body cavities promoting interactions with potential pathogens during normal filtration and a constant challenge to their immune system. In the present study B. azoricus and M. galloprovincialis were exposed to Vibrio alginolyticus, Vibrio anguillarum and Vibrio splendidus suspensions and to a mixture of these Vibrio suspensions, in order to ascertain the expression level of immune genes in gill samples, from both mussel species. The immune gene expressions were analyzed by means of quantitative-Polymerase Chain Reaction (qPCR). The gene expression results revealed that these bivalve species exhibit significant expression differences between 12 h and 24 h post-challenge times, and between the Vibrio strains used. V. splendidus induced the strongest gene expression level in the two bivalve species whereas the NF-kB and Aggrecan were the most significantly differentially expressed between the two mussel species. When comparing exposure times, both B. azoricus and M. galloprovincialis showed similar percentage of up-regulated genes at 12 h while a marked increased of gene expression was observed at 24 h for the majority of the immune genes in M. galloprovincialis. This contrasts with B. azoricus where the majority of the immune genes were down-regulated at 24 h. The 24 h post-challenge gene expression results clearly bring new evidence supporting time-dependent transcriptional activities resembling acute phase-like responses and different immune responses build-up in these two mussel species when challenged with Vibrio bacteria. High Pressure Liquid Chromatography (HPLC)-Electrospray ionization mass spectrometry (ESI-MS/MS) analyses resulted in different peptide sequences from B. azoricus and M. galloprovincialis gill tissues suggesting that naïve animals present differences, at the protein synthesis level, in their natural environment. B. azoricus proteins sequences, mostly of endosymbiont origin, were related to metabolic, energy production, protein synthesis processes and nutritional demands whereas in M. galloprovincialis putative protein functions were assumed to be related to structural and cellular integrity and signaling functions. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Bathymodiolus azoricus Mytilus galloprovincialis Bacterial challenges Gene expression HPLC-ESI-MS/MS

1. Introduction

* Corresponding author. MARE-Marine and Environmental Science Center, University of the Azores, 9901-862 Horta, Azores, Portugal. Tel.: þ351 292 200 400. E-mail addresses: [email protected], [email protected] (R. Bettencourt). http://dx.doi.org/10.1016/j.fsi.2014.07.018 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

The invertebrate immune system distinguishes self from nonself, resulting in physiological responses mediated through cellular and humoral processes that effectively fight against

486

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

invading agents subsequently leading to their removal from the host [1]. This natural immunity is formed by anatomical and chemical protective barriers [2]. In the case of Bivalvia, the first line of defense includes protective barriers such as the cuticle, shell and mucus layer [3]. Once these protective barriers are breached allowing pathogen entry, sensitive recognition of microbial surface components commonly referred as Microbe Associated Molecular Patterns (MAMPs) will ensue, followed by a rapid activation of the cellular component of the hemolymph, the circulating hemocytes or macrophage-like cells, and the participation of humoral factors present in the hemolymph with antimicrobial, cytotoxic properties or with opsonin-like properties, facilitating phagocytosis [4]. Through the open circulatory system of bivalves the hemolymph flows into the hemocoel, bathing all the organs and diffusing through a series of tissues sinuses where infective agents may be disseminated. The hemolymph assumes thus an important role in the immune system circulating around the body of mussels reaching the gills and mantle where potential pathogens interact with innate immune factors [5e7]. The Bivalvia mussels are widely distributed around the world including the Bathymodiolus azoricus and Mytilus galloprovincialis species. B. azoricus (Cosel & Comtet, 1999) is frequently the dominant species in numerous chemosynthesis-based communities such as cold (methane) seeps and hydrothermal vent ecosystems [8,9]. The genus Mytilus includes the Mediterranean mussel M. galloprovincialis (Lamarck, 1819) that is an endemic species to the Mediterranean Sea and Atlantic Ocean, from Morocco to Ireland [10]. Vibrio species are Gram-negative opportunistic pathogens indigenous to aquatic environments. They are ubiquitous and abundant in marine coastal waters, estuaries, ocean sediment and also in deep sea hydrothermal vents [11]. The Vibrio diabolicus strain was first isolated from a deep-sea vent animal, from the Pacific [12] and has been phenotypically related to pathogenic Vibrio species of which Vibrio anguillarum and Vibrio alginolyticus Vibrio parahaemolyticus are associated to human foodborne illnesses due to the consumption of fish and shellfish animals [13]. These Vibrio species demonstrated high genomic similarity to pathogenic Vibrio species in human [11]. Bivalves are filter-feeding animals constantly being exposed to pathogenic bacteria and environmental pollutants. Consequently, bivalves have been used as sentinels in ecotoxicological studies to monitor the quality of the aquatic environment [14]. The foodborne infections in humans cannot be predicted unless we know how they are transmitted. Therefore studying how the immune system of marine mussels work may lead to a better understanding of the physiological defense systems and to the elucidation of the physiological principles underlying the cellular and molecular mechanisms involved in specific adaptation processes of B. azoricus and M. galloprovincialis to very distinct natural habitats. Comparative immunological studies between these two mussel species may shed light into survival strategies of other marine bivalve species enduring unbalanced marine habitats and detrimental effects of climate change. These two mussel species represent valuable models to investigate their strategic adaptation to the surrounding environment and bring insight into the evolution of their innate immune system living under highly divergent environmental conditions. The progressive adaptation of Bathymodiolinae mussels to deep-sea environments [15] during evolution, might be now reflected in B. azoricus capacity to react to Vibrio infections in ways dissimilar to their Mytilid ancestors capacity to withstand Vibrio infections. The presence of endosymbiont bacteria in B. azoricus gills also constitutes another evolutionary feature that confer deepsea vent mussels the hability to adapt to chemosynthesis-based environment while potentially driving host-immune gene expression [16].

2. Material and methods 2.1. Mytilidae samples collection B. azoricus mussels were collected from the hydrothermal vent field Menez Gwen (850 m depth, 37 50.8e37 51.6N, 3130e3131.8W), with the French R/V “Pourquoi Pas?” using the Remote Operated Vehicle (ROV Victor 6000) (MoMARSAT cruise, 28 Junee23 July 2011) and the M. galloprovincialis mussels were obtained from a commercial shellfish farm (Vigo, Galicia, Spain). 2.2. Vibrio preparations and mussel challenges B. azoricus and M. galloprovincialis mussels were acclimatized to aquarium conditions for 24 h, to avoid stress after collection and transportation, prior to the experimental challenges with Vibrio bacteria. The mussels were then maintained in 2 L filtered seawater beakers with aeration at 8  C and 15  C respectively, and grouped into five sets of eight animals from each species and used for experimental V. alginolyticus, V. anguillarum or Vibrio splendidus and a mixture of all these Vibrios hereafter referred as “pool” challenges. 25 mL of overnight Vibrio cultures grown in a TCBS (Thiosulfate Citrate Bile Sucrose) medium were used as suspensions with an OD600 ¼ 1.5 and 1  1010 CFU/mL for the subsequent challenges. After Vibrio challenge, four animals from each experimental conditions were dissected at 12 h post-challenge time and four mussels dissected later at 24 h post-challenge time. 2.3. Total RNA extraction and cDNA synthesis Total RNA was extracted from gill tissues with TRIzol Reagent (Invitrogen) and purified with RNeasy mini kit (Quiagen) following the manufacturer's instructions and resuspended in nuclease-free, DEPC-treated water. Total RNA quality and concentrations were assessed by the A260/280 and A260/230 spectrophotometric ratios using the NanoDrop 1000 spectrophotometer (Thermo Scientific). The cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen) according to the manufacturer's specifications using 2 mg/mL total RNA per sample and its concentration measured using the NanoDrop 1000 spectrophotometer as above. The 12 h and 24 h gill cDNA samples were prepared from a mixture of 4 RNA gill purifications from each of the challenged and unchallenged (control) mussel species and from each Vibrio challenges including the pool challenge. 2.4. Gene expression analyses Gene expression analyses were conducted by means of qPCR following the MIQE guidelines [17] using the 12 h and 24 h cDNA samples from both challenged and unchallenged mussel species. The immune genes selected were Galectin, Peptidoglycan Recognition Protein (PGRP), Aggrecan, Lipopolysaccharide Binding Protein (LBP) and Bactericidal/Permeability-Increasing Protein (BPI) (LBP-BPI), Myeloid Differentiation primary response gene-88 (MyD88), Toll-Like Receptor 2 (TLR2), Lipopolysaccharide (LPS)induced Tumor necrosis factor-alpha TNF-a factor (LITAF) Jun-like, Nuclear-Factor kappa B (NF-kB), Heat Shock Protein 70 (HSP70) and Glutathione peroxidase I (Gpx1) for B. azoricus (Table 1) and M. galloprovincialis (Table 2). The specific primers were designed based on sequences retrieved from the DeepSeaVent [19], MytiBase [20] and Genbank databases for both species using the Oligo Analyzer 1.0.2 program [21]. The primer pair efficiencies for B. azoricus and M. galloprovincialis were analyzed in consecutive cDNA dilutions through the regression line of the Cycle thresholds (Ct) versus the

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

487

Table 1 B. azoricus primer sequences of the housekeeping gene (18S) and target immune genes (Galectin, PGRP, Aggrecan, LBP-BPI, MyD88, TLR2, LITAF, Jun-like, NF-kB, HSP70 and GpxI) used in qPCR analyses. Bathymodiolus azoricus species Gene

Acc. n

Primer sequence (50 e30 )

Housekeeping gene 18S ribosomal

AY64822.1

Forward Reverse

TCAACACGGGAAAACTCACC AACCAGACAAATCGCTCCAC

Present work

Target immune genes Galectin

HM756110.1 HM756116.1

Aggrecan

HM756112.1

LBP-BPI

HM756114.1

MyD88

HM756130.1

TLR2

HM756129.1

LITAF

HM756126.1

Jun-like

HM756138.1

NF-kB

HM756140.1

HSP70

HM756159.1

GpxI

HM756144.1

GCTGGGCTGGATACTGATAATG ACAAGGTCGCTGTAAATGGAAG TGTTGGTGAAGATGGCAAAA CCGTGAGTGGTGTGTGTGT GCACCCGAACAGAGTTGG CCATCGCCAGTCACCATTA GAAGCACCATTTGATCCCATA TGTGCCTGGTATGTCAAGGT GAGTTGTGAACTGCCTGCAA TCGTCTGCTGACTGTTTTCG TCTCCAGTCAGTGGTGCAAG CAGGAGGACTCGGATGACAC ATGAGAGATACCCCCGTGAA CACAAAACAACACCCAGCAT CATCGGCAACAACAACACTC TGTGACGGGATTGACTTTGA GGCTGTGTTTGGTTGGACAT AGTGGCGTATCACCGTTACA TTGAAGAAAATGTGTGGTGACTTG CCCTACCAGAACGACCTCAT TTAACGGCGTCGCTTGG TGGCTTCTCTCTGAGGAACAACTG

Present work

PGRP

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

relative concentration of cDNA using Microsoft Office Excel software [22]. The qPCR assays were performed with the 7300 Real Time PCR System (Applied Biosystems) using 1 ml cDNA to which, 12.5 ml of SYBR green PCR master mix (Applied Biosystems), 1 ml (10 mM) forward and reverse primer and nuclease-free water (Sigma) were added, in a final 25 ml reaction volume. The qPCR standard cycle

Reference

Present work Present work Present work Present work Present work Present work Present work Present work Present work Present work

conditions used in this experiment were 95  C for 10 min, followed by 40 cycles of 95  C for 15 s and 60  C for 1 min. Gene expression was normalized using the housekeeping 18S ribosomal gene which was constitutively expressed and not affected by the Vibrio challenge. Data analyses are based on the DDCt method. Three technical replicates were carried out per condition and species. Fold change units were calculated by dividing the normalized expression values

Table 2 M. galloprovincialis primer sequences of the housekeeping gene (18S) and target immune genes (Galectin, PGRP, Aggrecan, LBP-BPI, MyD88, TLR2, LITAF, Jun-like, NF-kB, HSP70 and GpxI) used in qPCR analyses. Mytilus galloprovincialis species Gene

Acc. n

Primer sequence (50 e30 )

Housekeeping gene 18S ribosomal

L33451.1

Galectin

MGC00516

PGRP

MGC04713

Aggrecan

MGC04514

LBP-BPI

JN935274.1

MyD88

JX112712

TLR2

JX173687.1

LITAF

MGC00041

Jun-like

MGC01107

NF-kB

MGC05614

HSP70

AY861684.1

GpxI

HQ891311.1

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Reference GTACAAAGGGCAGGGACGTA CTCCTTCGTGCTAGGGATTG GTGTACCAAATCCAACAGCA CCAACTTCCGTTCTGACA AGGCGGTAGTTGTCAGGATG CCAGTATCATGTTCCACTGCT TCAATGGTGATTGGAGATGG GGAGTTTGCATTACTGGTTGG GTTGATGGCAATGGGAGACC AGATCCAAGCTCTTCCTCCA GATGTAGGTGTGCTGTTGTCGT TTTACTGTTTCTTCCAGAGGGATA AACGCCCTCGAATAAGACG TCGTCCTGCATTACACCAGA TTACAGCCACCCAGTATGAGA TTTACAACCATCCACACAGAATG AGCATCGCCAGAGTTAGAAAA GCAAAAGATTCCTGTTCGTCT AAGATGAAGATGGCGACACA CTGAATGTCCAACCAAACACA GACTTGGGTGGTGGAAC GGCTACAGCTTCATCAGGG TTAACGGCGTCGCTTGG TGGCTTCTCTCTGAGGAACAACTG

[18] Present work Present work Present work Present work Present work Present work Present work Present work Present work Present work Present work

488

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

Fig. 1. Quantitative expression levels of immune genes from B. azoricus and M. galloprovincialis at 12 h and 24 h post-challenge. The target immune genes were 1A: Galectin; 1B: PGRP; 1C: Aggrecan; 1D: LBP-BPI; 1E: MyD88, 1F: TLR2; 1G: LITAF; 1H: Jun-like; 1I: NF-kB, 1J: HSP70 and 1K: GpxI. Data expressed as means and Standard Deviation with three technical replicates. Bars represent the expression level (fold change) of each target gene, in different time and experimental conditions, and normalized to the housekeeping gene 18S. Different letters stand for significant differences within species (B for B. azoricus and M for M. galloprovincialis). The letter B and b mean significant differences between B. azoricus at 12 he24 h. The letter M and m mean significant differences between M. galloprovincialis at 12 he24 h. The asterisk means significant differences between B. azoricus and M. galloprovincialis at 12 h and also between B. azoricus and M. galloprovincialis at 24 h (Permanova; p < 0.05).

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

489

Fig. 1. (continued).

in Vibrio challenges by the normalized expression values from unchallenged animals. Standarization of expression ratios took into consideration a fold change unit equal to 1 in control samples. Fold changes above 1 were considered as up-regulation of genes (higher mRNA abundance than in the control). Conversely, fold changes below 1 were considered as down-regulation of genes.

2.5. Statistical analyses The statistical analyses were performed with the software package IBM SPSS Statistic 19 and the PRIMER 6.1. 12 & PERMANOVA 1.02 software. The gene expression data were expressed as Mean ± Standard Deviation (SD). The differences between

Fig. 2. Interaction plots of qPCR results with immune genes (NF-kB, Aggrecan, LITAF, PGRP, GpxI, MyD88, Galectin, HSP70, Jun-like, TLR2 and LBP-BPI), Time (12 h and 24 h postchallenge) and Treatments (V. alginolyticus, V. anguillarum, V. splendidus, Pool and Control) from B. azoricus and M. galloprovincialis species. 2A: Species interaction plot with immune genes target (NF-kB, Aggrecan, LITAF, PGRP, GpxI, MyD88, Galectin, HSP70, Jun-like, TLR2 and LBP-BPI); 2B: Species interaction plot with 12 h and 24 h post-challenge; 2C: Species interaction plot with several treatments (control and bacterial challenges; V. splendidus, V. alginolyticus, V. anguillarum, Pool).

490

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

Fig. 3. Percentage of expression gene levels in two Mytilidae species at 12 h and 24 h post-bacterial challenge based on qPCR results. (A) and (B): Percentage of down- and upregulated genes in B. azoricus at 12 h and 24 h respectively. (C) and (D): Percentage of down- and up-regulated genes in M. galloprovincialis at 12 h and 24 h respectively.

B. azoricus and M. galloprovincialis were evaluated using ManneWhitney's and Permanova (Permutational MANOVA) and considered statistically significant at p < 0.05. Different letters stand for significant differences within species and * for significant differences interspecies.

public sequences databases SwissProt and NCBInr suitable for peptide mass fingerprint searches and MS/MS searches. The proteineprotein Basic Local Alignment Search Tool algorithm, Blastp [23] was used to query our protein sequences. The correlation between peptides was based on score value.

2.6. Protein assay

3. Results

B. azoricus and M. galloprovincialis gills from control animals were used for protein assays. These assays were carried out with a mixture of ten gill tissues from the two mussel species not exposured to bacteria. Gill samples were homogenized in 10 mL solution consisting of 10 mM HEPES, 250 mM sucrose, 1 mM DTT, 1 mM EDTA and 1 mM PMSF using Ultra Turrax homogenator. Then, 10% proteases inhibitor cocktail (SigmaeAldrich P8340) was added. The homogenates were centrifuged at 13,200 rpm for 1 h at 4  C. The concentration of supernatants was measured on Nanodrop 1000 Spectrophotometer (Thermo Scientific) and adjust to 1 ng/mL. Afterwards the B. azoricus and M. galloprovincialis samples precipitated and their concentration determined using Bicinchoninc Acid Assay (BCA) method for quantification. Proteins were digested with the enzyme trypsin and analyzed by nano HPLC-ESI-MS/MS. The MS/MS mass spectrum of each peptide was searched through the Mascot Search tool (http://www.matrixscience.com/) using the

3.1. In vivo incubation experiments with different live Vibrio strains The Vibrio challenges were carried out with V. alginolyticus, V. anguillarum or V. splendidus and the pool, and results analyzed taking into consideration three factors affecting gene expression levels, i.e. the different Vibrio strains used, the time of Vibrio challenge and the mussel species subjected to the challenges. Our results demonstrated significant expression differences between B. azoricus and M. galloprovincialis mussels following 12 h and 24 h exposure to bacteria suggesting that the two species followed a time-dependent gene expression pattern. In general, a higher level of expression was observed at 12 h for the majority of the genes tested in B. azoricus whereas in M. galloprovincialis the majority of the genes were expressed at a higher level at 24 h. Moreover, time-dependent differences of gene expression where also seen between 12 h and 24 h post-Vibrio challenges within the same species. In B. azoricus the

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

expression of Galectin, PGRP, Aggrecan, LBP-BPI, MyD88, TLR2, Junlike, NF-kB, and HSP70, was higher at 12 h as compared to 24 h expression levels. In the case of M. galloprovincialis a higher level of expression was obtained at 24 h for Galectin, LBP-BPI, MyD88, TLR2, LITAF, Jun-like, NF-kB, HSP70 and GpxI genes as compared to 12 h expression levels. The effect of the four Vibrio strains on the expression of immune and stress genes were examined between B. azoricus and M. galloprovincialis, at 12 h and 24 h post-Vibrio challenges. No major differences of gene expression profiles were seen among the V. alginolyticus, V. anguillarum and V. splendidus strains used whereas a mixture of the same Vibrios resulted in the highest expression levels measured in this study for M. galloprovincialis at 24 h post-challenge time. In a more restrictive way, only V. alginolyticus and V. anguillarum could induced the upregulation of LPB-BPI, HSP70 in B. azoricus at 12 h (Fig 1). To further analyze the results from gene expression studies between the two mussel species, interaction plots were considered taking into account the immune genes tested, the time of Vibrio challenge and the effect of Vibrio strains used to challenge the mussels in relation to the control treatment. The NF-kB and Aggrecan expressions were clearly distinct between the two mussel species at 12 h and 24 h post-challenge. On the other hand, gene expression in the control (unchallenged) and Vibrio challenged mussels were remarkably different, as seen in V. splendidus and pool. The V. alginolyticus and V. anguillarum challenge results were visualized as exhibiting similar plot interactions (Fig. 2). The percentage of up- and down- regulated immune genes observed at 12 h and 24 h post-bacterial challenge (all expression levels combined) was compared in B. azoricus and M. galloprovincialis and presented as pie charts (Fig. 3). A global decreased of up-regulated genes was seen in B. azoricus from 12 h (36%, Fig. 3(A)) to 24 h (27%, Fig. 3(B)) contrasting sharply with the increase of up-regulation of immune genes seen in M. galloprovincialis from 12 h (36%, Fig. 3(C)) to 24 h (73%, Fig. 3(D)). These results clearly point at distinct kinetic and onset of immune gene responses between the two mussel species where different lag phase responses may incur as a result from initial exposure to Vibrio. The boxplot of global gene expression results for B. azoricus and M. galloprovincialis at 12 h and 24 h. Post-challenge gene expression results from B. azoricus and M. galloprovincialis are represented in the boxplot (Fig. 4) as 4 clusters where most of the highest fold change expression occurred in M. galloprovincialis constituting thus outliers for the distant positioning relative to the median. At 12 h, B. azoricus showed up-regulation of LBP-BPI and HSP70 after V. anguillarum challenge while at 24 h, no significant expression was detected. In contrast, gene expression results 12 h, in M. galloprovincialis presented more outliers, namely for PGRP and Aggrecan genes, after V. alginolyticus, V. splendidus and pool challenges. NF-kB was also up-regulated after V. splendidus challenge at 12 h. Likewise, NF-kB had a strong up-regulation, at 24 h upon V. alginolyticus, V. anguillarum and V. splendidus challenges (Fig. 4). The global gene expression results, as evaluated by qPCR, were subjected to hierarchical clustering dendrogram using the average linkage method, embedded in the SPSS Statistic package, between four groups: B. azoricus at 12 h and 24 h, and M. galloprovincialis at 12 h and 24 h post-Vibrio challenges. The global gene expression dendrogram (Fig. 5) illustrates how the results from 12 h to 24 h post-Vibrio challenges in B. azoricus show closer similarity gene profiles than M. galloprovincialis 12 h and 24 h challenges (Fig. 5)

491

Fig. 4. Boxplot of global gene expression results for B. azoricus and M. galloprovincialis at 12 h and 24 h. The outliers are represented by numbers, indicating gene and challenge: 1) and 2) LBP-BPI and HSP70 B. azoricus genes at 12 h post-V. anguillarum challenges. 3), 4) and 5) PGRP gene when challenged with V. alginolyticus, V. splendidus and Pool respectively in M. galloprovincialis mussels at 12 h. 6), 7) and 8) Aggrecan gene when challenged with V. alginolyticus, V. splendidus and Pool of Vibrios respectively. 9) NF-kB gene challenged with V. splendidus in M. galloprovincialis at 12 h. 10), 11) and 12) NF-kB M. galloprovincialis gene at 24 h of challenged with V. alginolyticus, V. anguillarum and V. splendidus respectively.

peptide-searches revealed differences between these species (Table 3, Appendix A and B). In the case of B. azoricus, five peptide sequences were identified: Alpha-actin, Predicted ornithine aminotransferase mitochondrial-like isoform 2, Phosphoenolpyruvate carboxykinase, full Actin sequence and Glyceraldehyde 3phosphate dehydrogenase. On the other hand, four peptide sequences were found in M. galloprovincialis gill samples: Actin, Betatubulin, Protein phosphatase-1 and also full Actin-11.

4. Discussion The deep-sea hydrothermal vent mussel B. azoricus and shallow-water mussel M. galloprovincialis are members of the Mytilidae family from distinct marine natural habitats. Regardless

3.2. Nano HPLC-ESI-MS/MS This study also included proteomics studies by nano HPLC-ESIMS/MS in both species. This assay was carried out with unchallenged gills for each mussel species. Results from the Mascot

Fig. 5. Dendrogram of global gene expression results using average linkage between B. azoricus and M. galloprovincialis per bacterial challenge (12 h and 24 h).

492

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

Table 3 Nano HPLC-ESI-MS/MS results from naïve gill tissue in B. azoricus and M. galloprovincialis. Name

Homology peptide sequence

Species

Alpha-actin PREDICTED: ornithine aminotransferase, mitochondrial-like isoform 2 Phosphoenolpyruvate carboxykinase Full actin

LENS FNTLQTR IVFAAG NFWGR TD PADVARVESK AVFPSIVGRPR.H VAPEEHPVLLTEAPLNPK VAPEEHPVLLTEAPLNPKANR TTGIVLDSGDGVSHTVPIYEGYALPHAIMR SYELPDGQVITIGNER. GGRGASQNIIPSSTGAAK

B. azoricus

HTMYNELRVAPEEHPVLLTEAPLNPK GYSFTTTAER VYELPDGQVITIGNER FWEVISDEHGIDPTGTYHGDSDLQLER AGFAGDDAPR DSYVGDEAQSK VAPEEHPVLLTEAPLNPK GYSFTTTAER LCYVALDFENEMTTAASSSSLEK TFTDCFNCLPLAAIIDEK

M. galloprovincialis

Glyceraldehyde 3-phosphate dehydrogenase Actin

Beta-tubulin Full ¼ Actin-11

Protein phosphatase-1

of the environment to which these mussels have adapted, the need for immunity is common to both species. While gene and protein expression profiles may bring insight into cellular and molecular mechanisms involved in innate immune responses, transcriptional regulation of immune genes and protein synthesis in these distinct mussels, are likely to be different. Bacterial challenges using Vibrio bacteria were carried out to compare the transcriptional activities of these mussels using conserved immune genes whose expression levels are presumably revealing their species-specificity to engage the immune system. Whereas both species are Mytilidae family members, significant gene expression differences were found due to multifactorial effects linked to the Vibrio strain used, the course of bacterial challenge, and inherent capabilities to transcribe different immune genes in both mussel species. Between 12 h and 24 h course of bacterial challenge significant differences were found between and within the species as demonstrated by our results, evidencing several distinct profiles of up and down-regulation of immune genes. Up-regulation was seen in B. azoricus at an earlier time, 12 h after Vibrio challenge, followed by a general down-regulation at 24 h, suggesting that this deep-sea vent mussel is a faster responder when compared to the coastal mussel M. galloprovincialis. In contrast, M. galloprovincialis seems to potentiate the expression levels of immunes genes 24 h after Vibrio challenges, evidencing a different immune response kinetics in this species, known for its capabilities to overcome microbial burden from the environment [24,25]. The immune response between these two mussel species shows differences in the kinetics and intensity. This might be due to their different hability to recognized microbes in their natural environment and how acclimatization processes affected their capacity to transcribe immune genes. The immune recognition-like lectin, Galectin, can mediate and regulate cell differentiation and immune homeostasis and also interact with bacterial surface glycans, thus functioning as Pattern Recognition Receptor (PPR) and/or immune singular regulator [26e28]. Our results showed that the levels of Galectin expression in these mussels were significantly different at 12 h and 24 h (ManneWhitney U test) reaching its highest level in M. galloprovincialis at 24 h, thus corroborating that up- or down-regulation of Galectin may be dramatically modulated in these two mussels (Fig. 1(A)). Interestingly, the Galectin BbtGal-L from the cephalochordate amphioxus Branchiostoma belcheri specifically recognizes Vibrio vulnificus but not V. parahaemolyticus or Staphylococcus aureus, and its expression is up-regulated by

bacterial challenge [29]. Host Galectins can bind directly to glycoconjugates on the surface of bacteria, either facilitating or inhibiting pathogen entry, followed by positive and negative regulation of host innate and adaptive immunity [30]. PGRPs represent another example of immune recognition genes involved in innate immunity in several different taxonomic groups as insects, mollusks, echinoderms, and vertebrates. Its expression in insects is often up-regulated by exposure to Gram-positive and Gram-negative bacteria pointing at its induction specificity and effector functions [31,32]. Our results indicate that expression levels of PGRP were up-regulated in M. galloprovincialis at 12 h and 24 h whereas in B. azoricus lower expression levels were attained for both post-challenge times in comparison to non-bacterial challenges (Fig. 1(B)). Differences found for these two immune recognition genes bring evidence supporting different mechanisms of recognition and capacity to counteract bacterial challenges in these two mussels, likely due to inherent differential regulation of transcriptional activities and the presence of endosymbiont bacteria localized in modified epithelial cells from B. azoricus gill tissues. The presence of endosymbiont bacteria may affect the host immune response in B. azoricus as suggested in Boutet et al., 2011 [16] and Martins et al., 2013 [33] to the extent which immune recognition gene LBP-BPI is differentially regulated in both species when challenged with V. alginolyticus and V. anguillarum. Lipopolysaccharide binding protein is a protein that in humans is encoded by the LBP gene. LBP is a soluble acute-phase protein that binds to bacterial lipopolysaccharide (LPS) to elicit immune responses by presenting the LPS to important cell surface pattern recognition receptors (PRRs). LBP acts together with Bactericidal Permeability-Increasing Protein (BPI), which increases the permeability of bacterial membranes allowing the opsonisation of Gramnegative bacteria [34,35]. In oysters, LBP protein may participate in the first line of defense in early development of Crassostrea gigas and during bacterial challenge [36]. In agreement with a possible role in mediating acute-phase response, LBP-PBI in B. azoricus was up-regulated at 12 h followed by a transcriptional activity decrease at 24 h, suggesting that deep-sea vent mussels are able to mount earlier immune responses which soon decline after 24 h. This contrasts sharply with the coastal mussel M. galloprovincialis which suggests a different time immune response build-up whose highest expression levels were observed at 24 h (Fig. 1(D)). The proteoglycan family member Aggrecan is a major component of the animal extracellular matrix. A proteoglycans, they are heavily

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

glycosylated with glycosaminoglycans (GAGs) covalently attached to its protein core [37]. The biological functions of proteoglycans are largely dependent on the interaction of the GAG chains with different protein ligands and have been implicated in basement membrane integrity and structural tissue organization, tissue coagulation, host defense [37]. Many viruses, bacteria, and parasites express adhesins that bind to cell surface Heparan Sulfate Proteoglycans (HSPGs) to facilitate their initial attachment and subsequent cellular entry [38]. Some pathogens also secrete virulence factors that modify HSPG expression. Soluble proteoglycans may act as a protective agent against bacterial and viruses through their ectodomains, such as in Syndecans, believed to retain their ability to interact with the same ligands as the cell surface proteoglycans and thus acting as soluble autocrine or paracrine effectors [38]. In view of this, the up-regulation of Aggrecan in M. galloprovincialis following Vibrio challenges is suggestive of a possible role in innate immune response reactions in bivalves acting as soluble forms counteracting with Vibrio surface ligands. While a precise role of bacterial toxins on the disintegration of extracellular matrix proteins has not been clearly established in invertebrates, our results indicate a possible host inflammatory response following Vibrio challenges in both mussel species. The Aggrecan expression was down-regulated at 12 h and 24 h in B. azoricus in presence of Vibrio corroborating previous results obtained by our group [33]. In M. galloprovincialis, Aggrecan expression levels were up-regulated at 12 h and then down-regulated at 24 h (Fig. 1(C)). This distinct transcriptional signature in these two mussels regarding Aggrecan expression levels was the most outstanding of all the genes tested following the first 12 h postVibrio challenges, pointing at the importance of the immune regulation mechanisms during initial hours of challenge where immune recognition and signal transduction reactions may determine how immune reactions unfold subsequently and differently in B. azoricus and M. galloprovincialis. MyD88 is known as a universal adapter protein involved in immune-response signaling. Lee et al. (2011) demonstrated that MyD88 was up-regulated in the clam Ruditapes philippinarum gills after Vibrio tapetis challenge suggesting that MyD88 plays a crucial role in molluscan immunity during pathogenic infection [39,40]. The MgMyD88a expression was up-regulated in the mussel M. galloprovincialis hemocytes at 24 h after V. splendidus and V. anguillarum infections [41]. This is in agreement with our MyD88 results from M. galloprovincialis gills demonstrating similar gene expression patterns. In B. azoricus the level of MyD88 was downregulated at 12 h and 24 h. In M. galloprovincialis, the MyD88 expression was down-regulated at 12 h and up-regulated in all Vibrio challenge at 24 h (Fig. 1(E)). This distinct gene expression feature at 24 h in M. galloprovincialis points at differences in signaling processes between the two mussel species used in this study. A higher MyD88 expression in M. galloprovincialis at 24 h indicates an extended signaling response probably engaging the immune response over prolonged periods of time, irrespectively of the environmental conditions to which the two mussel species are exposed to. The activation of Toll-like receptor pathways is essential for inducing immune related-gene expression in the defense against bacterial infections in invertebrates [42]. Previous studies have shown, for instance, that injection of LPS into Chlamys farreri resulted in the up-regulation of TLR and MyD88 in hemocytes at 6 h and 12 h [43]. Injection of V. anguillarum stimulated the expression of Toll-like in Crassostrea gigas hemocytes starting at 3 h, peaking at 12 h [40]. The time effect of the V. anguillarum and V. splendidus challenge in hemocytes from M. galloprovincialis clearly induce TLR and MyD88 transcripts. The Gram-negative injection resulted in significant up-regulation at 3 h post-infection but the effect was

493

still evident after 24 h. The highest response was induced by V. anguillarum at 9 h post infection [41]. Most of the Toll pathway genes were ubiquitously expressed in M. galloprovincialis, although at different levels, and clearly induced after injection with V. anguillarum and V. splendidus bacteria [44]. In view of this, our results in M. galloprovincialis infected with V. alginolyticus also revealed up-regulation expression of TLR2 at 12 h (Fig. 1(F)) indicating that TLR2 signaling pathway is specifically involved in mediating immune responses against V. alginolyticus and not in other Vibrio strains tested. Furthermore these results are consistent with the idea of a first stage activation of the TLR2, which is not immediately transduced to the TLR2 intracellular domain but rather until MyD88 up-regulation is seen at 24 h. Moreover, MyD88 seems to be a common denominator in our Vibrio challenges with M. galloprovincialis since an up-regulation was observed for all the Vibrios tested at 24 h, unlike TLR2 that was only induced upon V. alginolyticus challenge. B. azoricus exposure to different Vibrio strains led to a completely different scenario. Both MyD88 and TLR2 were down-regulated at 12 h and 24 h regardless the Vibrio strain utilized. This suggests that deep-sea vent mussels are not as responsive as coastal mussels whether due to inherent immune recognition specificities, different on-set immune reaction mechanisms, or the presence of endosymbiont bacteria modulating host immune reactions. Interestingly, in another study regarding the deep sea vent Ridgeia piscesae trophosome, the TLR gene was significantly expressed suggesting the involvement of this signaling molecule in innate immunity, most likely, under the influence of endosymbiosis [45]. Transcription factors play an important role in controlling transcription of immunity genes. Infections with bacterial pathogens induce the activation of transcription factors in both invertebrates and vertebrates [46e48]. The transcription factor LPSinduced TNF-alpha factor (LITAF) showed a similar mRNA expression profile in B. azoricus or M. galloprovincialis irrespectively of all the Vibrio challenges. LITAF expression was higher in all challenges at 24 h in M. galloprovincialis (Fig. 1(G)). This is in agreement with analyses performed with the clam Scapharca broughtonii, revealing up-regulation of LITAF in gill and hemocytes tissues at 24 h postLPS challenge, supporting the evidence that LITAF gene expression can be induced by bacterial endotoxin [49]. Bacterial lipopolysaccharides also known as bacterial endotoxins, are cell surface molecules with high immunonogenic potential to elicit a variety of inflammatory responses as part of the pathogenic Gram-negative bacterial infections such as Vibrio cholerae, V. parahaemolyticus and the Vibrio strains used in this study [50e52]. LITAF was shown also to play a role in regulating the expression of TNF-a in a study with the oyster Crassostrea ariakensis challenged with a rickettsialike organism where a higher expression level of LITAF was seen in gills [50,51]. As mentioned above, differences of LITAF mRNA levels between B. azoricus and M. galloprovincialis may be attributed to cis- and trans- regulatory elements driving the transcription of immune genes. The Jun-like protein is an another transcription factor whose mRNA in B. azoricus species was down-regulated at 12 h and 24 h following Vibrio challenges. In M. galloprovincialis, a higher expression was seen in the presence of V. alginolyticus, V. anguillarum and pool at 24 h (Fig. 1(H)), suggesting an increased transcription capacity in these mussels to counter react bacterial challenges. This contrasts sharply with the expression of Jun-like in B. azoricus which seems unresponsive or down-regulated in the presence of Vibrio. A similar pattern of expression was seen for NFkB whose expression was down-regulated in B. azoricus and upregulated in M. galloprovincialis at 12 h and 24 h (Fig. 1(I)). As a result of transcriptional responses induced by Vibrio challenges in both mussels species, effector molecules are being synthesized such as Heat Shock Proteins (HSPs) and Glutathione

494

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

peroxidases (Gpxs). HSP70 proteins are synthesized in response to a range of environmental stresses in all organisms [53]. HSP70 gene regulation in marine mussels provide important insights into the molecular basis of the response to environmental challenges [54]. In our mussel species models, the HSP70 expression levels were upregulated at 12 h in B. azoricus challenged with all the Vibrio strains except for the pool challenge. In contrast, HSP70 expression in M. galloprovincialis was higher with pool at 24 h (Fig. 1(J)). Given the HSP70 homology between the two mussel species, these results suggest that gene expression profiles of this gene are different most likely due to differences in cis-regulatory DNA binding sequences driving transcription of HSP70 in B. azoricus and M. galloprovincialis, or to differences related to timescales of transcription of HSP70 in these species. Indeed, this different timescales of transcription seems to be the case as in B. azoricus, the expression of HSP70 was higher at 12 h declining after 24 h, whereas M. galloprovincialis expression increased between the two time points tested, 12 he24 h and was even higher at 24 h with the pool of Vibrio (Fig. 1(J)). HSP overexpression is a ubiquitous molecular mechanism when coping with stress irrespectively of individual differences in threshold of sensitivity and tissue specificity that animals may demonstrate [55]. HSPs are induced by factors including inflammation, osmotic pressure, oxidative stress, and heavy metals exposure are known to affect the cell's proteins structure and function [56]. The resultant HSPs assist to repair and to protect cellular proteins from stressor-induced damage and to minimize protein aggregation. HSP70 is the most abundant HSP family member whose expression is detected in mussels under natural environmental conditions where it is considered a form of endogenous protection [57]. Therefore, mussels have been used for several environmental studies involving HSP expression [55e58]. In spite of living in an environment with elevated temperature and pressure, and the presence of heavy metals and highly toxic reduced chemical compounds to which vent organisms are exposed to, B. azoricus does show a modest increase of HSP70 expression under the bacterial challenges carried out with Vibrio during the initial 12 h of exposure. This may be attributed to the presence of endosymbiont bacteria in gill tissues during the initial stages of acclimatization probably priming the vent mussel innate immune system before experimental challenges. On the other hand the filter feeding mussel M. galloprovincialis has been shown to increase its HSP70 expression following heat shock and exposure to heavy metals [55,58]. Our results reveal that HSP70 is differentially regulated immune genes in this study in spite of the phylogenetic relationship between these two species. Gpxs are key enzymes involved in scavenging oxyradicals in animals and are considered the main cellular defense against oxidative destruction of membranes [59]. Gpx mRNA has been found to increase steadily under different environmental stresses and pathogen infection [60]. In B. azoricus GpxI expression is downregulated upon Vibrio challenge at 12 h and 24 h, unlike in M. galloprovincialis which is up-regulated at 24 h (Fig. 1(K)). In one study regarding glutathione peroxidase activity in M. galloprovincialis gill tissues, it was shown a significant higher expression of this gene than in the same tissues of the clam Anadara inaequivalvis [61].

495

Overall our results demonstrate significant differences in gene expression levels between B. azoricus and M. galloprovincialis (ManneWhitney U test and Permanova test). Interaction plots considering the variables immune genes, the bacterial challenges, and time of exposure (12 h and 24 h of treatment) in both species are illustrated in Fig. 2. The results evidenced significant differences (p < 0.05) within the expression levels at 12 h and 24 h postchallenge and between Vibrio challenges. In B. azoricus most of the immune genes revealed lower expression or down-regulation. These results are in agreement with our previous experimental studies in B. azoricus, showing also down-regulation of immunes genes as a result of Vibrio challenges [33]. Differences in gene expression were also found among the effects induced separately by the different Vibrio strains used to challenge the two mussel species and between 12 h and 24 h exposure time (Fig. 2(C)). The present study included proteomics studies by nano HPLC-ESIMS/MS for both species, resulting in the detection of the described peptide sequences (Table 3 and Appendix A and B). In B. azoricus, five peptide sequences were identified: Alpha-actin, Predicted ornithine aminotransferase mitochondrial-like isoform 2, Phosphoenolpyruvate carboxykinase, full Actin sequence and Glyceraldehyde 3phosphate dehydrogenase. On the other hand, four peptide sequences were found in M. galloprovincialis samples: Actin, Betatubulin, Protein phosphatase-1 and full Actin-11. Actin sequences were found in both mussel species supporting the ubiquitous nature of this protein as one of the most abundant protein in typical eukaryotic cells and highly conserved across all Phyla. Actin plays a crucial role in the maintenance of cell morphology, motility and cell division, functioning as a constituent of microfilaments [62]. The Phosphoenolpyruvate carboxykinase (PEPCK) is an enzyme that has been almost exclusively linked to gluconeogenesis to the extent which changes in the of PEPCK mRNA or its activity, are associated with the control of hepatic glucose output and, more recently, with alterations in life span [63]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme involved in glycolysis, and exerts several functions as diverse as apoptosis induction, receptor-associated kinase, tRNA export and DNA repair [64]. The gapA gene has also been used as a marker to determine phylogenetic relationships between different strains of Vibrio bacteria found in members of the molluscan class Cepalophoda. Interestingly the light emitting Vibrio bacteria are found in symbiosis in light organs of Loliginid squid [65]. The Mascot peptide sequences PEPCK and GAPDH were queried against our DeepSeaVent database [19] and perfect BLASTX hits here found (E-value 0.0) corresponding to GAPDH. Most likely the GAPDH aminoacid sequenced found in B. azoricus gill tissues is of bacterial origin and tied to the presence of endosymbiont bacteria present in their modified epithelial cells, the bacteriocytes. The Protein phosphatase type 1 (PP1) is a major eukaryotic protein serine/threonine phosphatase involved in a wide range of cell activities such as cell division [66,67]. For the most part, the B. azoricus protein sequences ensued from our proteomic analyses were related to metabolic, energy production and protein synthesis processes and nutritional demands whereas in M. galloprovincialis putative protein functions were assumed to be in relation with structural and cellular integrity and signaling functions.

Fig. 6. Hypothetical bacterial challenge pathway in B. azoricus and M. galloprovincialis mussels. (A) and (B): Hypothetical bacterial challenge pathway in B. azoricus at 12 h and 24 h respectively. (C) and (D): Hypothetical bacterial challenge pathway in M. galloprovincialis at 12 h and 24 h respectively. A hypothetical bacterial challenge model was structured using the mean of the quantitative expression levels for the immune genes tested during Vibrio challenges. A representative vertical line across the schematic pathway divides genes that are up-regulated from genes that are down-regulated. The relative abundance and distribution of geometric figures (representing Vibrio challenges and immune genes) to the right or left side of the vertical line indicates the up-regulation and down-regulation status, respectively, after Vibrio challenges. A qualitative Vibrio challenge expression scale is represented by oval geometric figures in which the highest gene expression levels induced corresponds to 4 figures and the lowest levels to 1 figure. The relative positioning of genes, respectively to the vertical line, represents the level of gene expression from a down regulation (farther left) to an up regulation (farther right) status. Immune genes are grouped as Recognition, Signaling, Transcription and Effectors genes [19]. The following letters represent: CM: cell membrane; EM: extracellular milieu; IM: intracellular milieu and N: nucleus.

496

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

5. Conclusions Our results suggested that the level of gene expression in deepsea vent and coastal mussels are significantly different. In the case of B. azoricus, the levels of immune gene expression are often down-regulated. Bacterial challenges carried out with different Vibrio strains revealed distinct patterns of gene expression for the majority of the genes tested, whose expression reached higher levels at 12 h, soon declining hereafter as seen at 24 h (Fig. 6(A and B)). This contrast markedly with levels of gene expression attained in M. galloprovincialis Vibrio challenges. The majority of the genes tested showed significant increased levels of expression expressed at 24 h denoting a different time-dependent response in coastal mussels (Fig. 6(C and D)). Given the conservation between B. azoricus and M. galloprovincialis genes tested in this study it is plausible that the differential gene expression results obtained here were linked to differences at the transcription-regulation level, affecting the promoter regions of immune and stress-related genes and mRNA transcription in both mussel species. Although the two mussel species belong to members of the same taxonomic family, the immune transcriptional profiles are distinct, as well as their physiological capabilities to sense immune signals from the environment in unique ways, as shown in the presence of different Vibrio challenges. The different peptide sequences found in naïve B. azoricus and M. galloprovincialis, using nano HPLC-ESI-MS/MS also bring evidence supporting differential expression at the protein level due to differences in protein synthesis in both mussel species. The presence of endosymbiont bacteria in B. azoricus is yet another driving factor likely to affect host gene and protein expressions and the overall physiological statuses of vent mussels while interacting with microbes in the environment. Analysis of differences at the promoter region level should, in the future, further contribute to our understanding of the regulation of immune responses in these two mussel species living in such disparate marine environment. Acknowledgments We are grateful to the Portuguese Foundation for Science and Technology (FCT) for the Doctoral grant to E. Martins (SFRH/BD/ 68951/2010). The authors are grateful to A. Colaço (IMAR, Azores) and S. Lino (DOP/Uaç, Azores) for B. azoricus sampling during the mission of the BIOBAZ-ANR project and Dr. A. Romero (CSIC, Vigo) for helping of M. galloprovincialis challenge. We thank to P. Balseiro (CSIC, Vigo), G. Menezes (IMAR, Azores) and D. Catarino (DOP/Uaç, Azores) for their thoughtful comments and suggestions and also R. Chamorro (CSIC, Vigo) for support in the acquisition and maintenance of M. galloprovincialis aquarium. We acknowledge funds provided by FCT to LARSyS Associated Laboratory & IMAR-University of the Azores (Thematic Area E) through the FCT/MCE project PEst-OE/EEI/LA0009/2011-2014 and by the FRCT e Government of the Azores pluriannual funding. Appendix A. B. azoricus protein sequences A1: Alpha-actinin sequence Match to: gij23394914 Score: 58, alpha-actinin (Biomphalaria glabrata) Nominal mass (Mr): 89962; Calculated pI value: 6.08 NCBI BLAST search of gij23394914 against nr Unformatted sequence string for pasting into other applications Matched peptides shown in Bold

1 DGYMEEEEEW DREGLLDPAW EKQQKKTFTA WCNSHLRKTG PQNQIENIEE 51 DFRNGLKLML LLEVISGEHL PKPDRGKMRF HKIANVNKAL DFIASKGVKL 101 VSIGAEEIVD GNVKMTLGMI WTIILRFAIQ DITVEELTAK EGLLLWCQRK 151 TAPYKNVNVQ NFHLSWKDGL AFCALIHRHR PDLLDYYKLS RENPLENLNT 201 AFDIAEKHLD IPRMLGPEDM VNSAKPDERS VMAYVSSYYH AFSGAQQAET 251 AANRICKVLK VNQENERLME EYERLASDLL EWIRRTRPWL ENRTTDNTLP 301 GTQRRLEEFR DYRRKQKPPK LEDKARLENS FNTLQTRLRL SNRPAYLPTE 351 GKMVSDIANA WKGLETAEKG FEEWLLSELQ RLERLDHLAQ KFRHKCEIHE 401 EWAAGKEDML KSGDFKKCRL NELKAMKKKH EAFESDLAAH QDRVEQIAAI 451 AQELNSLDYH DLVTVNSRCQ RICDQWDVLG QLTQKRRDAL EEAERVLERI 501 DQLHLEFAKR AAPFNNWMDG AKEDLLDMFI VHTTEEVQGL VDAHEQFKAT 551 LGRLIKSMPQ IVGLVQEVQR LGQQFGITPP DNPYTTLHAQ DITNKWGEVK 601 QLVPHRDTTL QQEMMRQQNN ERLRRQFAAK ANVVGQWIEN QLDAVASIGV 651 TGRSSLEEQL KKLQQFDKAV VAYKPNMEEL EKYNQEVQEA MIFENRYTQY 701 TMETLRVGWE QLLTAIARNI NEVENQILTR DSKGISEAQM NEFRMSFNHF 751 DKNRTKRLEP KEFKACL

A2: Actin sequence Match to: gij3182893 Score: 272, Full¼Actin (C. gigas) Nominal mass (Mr): 42050; Calculated pI value: 5.30 NCBI BLAST search of gij3182893 against nr Unformatted sequence string for pasting into other applications. Links to retrieve other entries containing this sequence from NCBI Entrez: gij2564711 from C. gigas; gij229472810 from C. gigas; gij229472812 from C. gigas; gij229472816 from C. gigas. Matched peptides shown in Bold 1 MGDEDIAALV VDNGSGMCKA GFAGDDAPRA VFPSIVGRPR HQGVMVGMGQ 51 KDSYVGDEAQ SKRGILTLKY PIEHGIVTNW DDMEKIWHHT FYNELRVAPE 101 EHPVLLTEAP LNPKANREKM TQIMFETFNS PAMYVAIQAV LSLYASGRTT 151 GIVLDSGDGV SHTVPIYEGY ALPHAIMRLD LAGRDLTDYL MKILTERGYS 201 FTTTAEREIV RDIKEKLCYV ALDFEQEMTT AASSSSLEKS YELPDGQVIT 251 IGNERFRCPE AMFQPSFLGM ESSGIHETSY NSIMKCDVDI RKDLYANIVL 301 SGGTTMFPGI ADRMQKEVTA LAPPTMKIKV IAPPERKYSV WIGGSILASL 351 STFQQMWISK QEYDESGPSI VHRKCF

A3: Glyceraldehyde 3-phosphate dehydrogenase protein sequence Match to: gij317039808 Score: 44, glyceraldehyde 3-phosphate dehydrogenase (Michelopagurus limatulus)

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

Nominal mass (Mr): 18703; Calculated pI value: 8.65 NCBI BLAST search of gij317039808 against nr Unformatted sequence string for pasting into other applications. Matched peptides shown in Bold 1 TGVFTTIEKA SAHFTGGAKK VIISAPSADA PMFVCGVNLE KYTKDMNVVS 51 NASCTTNCLA PVAKVLHENF EIVEGLMTTV HAATATQKTV DGPSSKDWRG 101 GRGASQNIIP SSTGAAKAVG KVIPELNGKL TGMAFRVPTP DVSVVDLTVR 151 LGKECTYDDI KAAMKAASEG PLKGVLGY A4: Ornithine aminotransferase protein sequence Match to: gij189526312 Score: 55, PREDICTED: ornithine aminotransferase, mitochondrial-like isoform 2 (Danio rerio) Nominal mass (Mr): 49134; Calculated pI value: 6.58 NCBI BLAST search of gij189526312 against nr Unformatted sequence string for pasting into other applications. Matched peptides shown in Bold 1 MNSMKSLMRG VSRVTPSLTR AVHSGMRTSS SAASRAKTQE RPMTSEEVFA 51 REDRYGAHNY HPLPVALERG EGVHMWDVEG RRYFDFLSAY SAVNQGHCHP 101 KIIAALTAQA SRLTLTSRAF YNDILGAYEQ YITGLFGYDK VLPMNTGVEG 151 GETACKLARK WAYSVKGIPK YEAKIVFAAGNFWGRTMAAI SSSTDPSSYD 201 GFGPFMPGFE LVPYNDIPAL EKALQDPHVA AFMVEPIQGE AGVVVPDAGY 251 LQKVRELCTK YNVLFIADEV QTGLCRTGRR LAVDHEAVRP DLVILGKALS 301 GGVYPVSAVL CDDEVMLTIK PGEHGSTYGG NPLACRVAIA ALEVLEEENL 351 AANAERMGQI LRAELNKLPR EIVSGVRGKG LLNAIIIKET KDYDAWQVCL 401 RLRDNGLLAK PTHGDIIRLA PPLTINEQEV RECVEIISRT ILSF

A5: Phosphoenolpyruvate carboxykinase protein sequence Match to:gij113207854 Score: 40, phosphoenolpyruvate carboxykinase (C. gigas) Nominal mass (Mr): 72276; Calculated pI value: 6.51 NCBI BLAST search of gij113207854 against nr Unformatted sequence string for pasting into other applications. Matched peptides shown in Bold 1 MEDDAPEFME IHEIVIQKLG HVPIVKGDFH MLPKKVQKFL AKWVYTCKPR 51 ALYICDGSHA EAEEVTHKLI ERGVLTKLKK YENCYLCRTD PADVARVESK 101 TWIATDDKYE TVPHVRQGVR GILGQWKHTK EMEEEVNSDL DGCMAGRTMY 151 VIPFSMGPIG GPLSKIGVQL TDSNYVLLCM RIMTRVSADI WEVLGDNDFV 201 RCVHSMGCPR PVQRKVVNHW PCNPDKIMIG HFPARREIVS FGSGYGGNSL 251 LGKKCFALRI ASVIARDEGW LAEHMLIMGL TNEKTGEEKF VCAAFPSACG 301 KTNLAMIQPT IPGYKVRVVG DDIAWLRFDD KGVLRAINPE NGFLGVLPGT 351 NMKTNPNAML SFQNISIFTN VAETADGGVF WEGMEDEIDK NIAITNWLGQ 401 PWKIGMPGNA AHPNSRFTCP ASQCPIIHPK WEDPKGVPVS ALIFGGRRPT 451 GVPLVFESYS WQHGVMVGAC VKSESTAAAE HTGKKIMHDP MAMRPFMGYN

497

501 FGKYLQHWLD MEKPDRNMPK SFHVNWFRVD EHGKFLWPGF GDNVRVLDWV 551 LRRCAGDESI AVKSPIGYLP KKGSIDLTGL GDIKWDELFS LPKHYWLDDM 601 RESKLFLEDQ VGTDFPQVIW ETHAQEKRIE EQL Appendix B. M. galloprovincialis Protein Sequences B1: Actin protein sequence Match to: gij315572184 Score: 165, actin (Gonospira palanga) Nominal mass (Mr): 19763; Calculated pI value: 4.82 NCBI BLAST search of gij315572184 against nr Unformatted sequence string for pasting into other applications. Matched peptides shown in Bold 1 HTXYNELRVA PEEHPVLLTEAPLNPKANRE KMTQIMFETF NSPXMYVAIQ 51 AVLSLYASGR TTGIVLDSGD GVTHTVPIYE GYALPHAIMR LDLAGRDLTD 101 YLMKILTERGYSFTTTAERE IVRDIKEKLX YVALDFEQEM FTVATSSSLE 151 KXYELPDGQV ITIGNERFXX PEAXF

B2: Beta-tubulin protein sequence Match to: gij343455255 Score: 48 beta-tubulin (Mytilus edulis) Nominal mass (Mr): 18275; Calculated pI value: 4.78 NCBI BLAST search of gij343455255 against nr Unformatted sequence string for pasting into other applications. Matched peptides shown in Bold 1 VHMQAGQCGN QIGAKFWEVI SDEHGIDPTG TYHGDSDLQL ERINVYYNEA 51 TGGKYVPRAV LVDLEPGTMD SVRSGPFGQI FRPDNFVFGQ SGAGNNWAKG 101 HYTEGAELVD SVLDVVRKEA ESCDCLQGFQ LTHSLGGGTG SGMGTVLISK 151 IREEYPDRIM LTFSVVP

B3: Actin-11 protein sequence Match to: gij728798 Score: 233, Full¼Actin-11; Flags: Precursor (Limulus polyphemus) Nominal mass (Mr): 42218; Calculated pI value: 5.24 NCBI BLAST search of gij728798 against nr Unformatted sequence string for pasting into other applications. Links to retrieve other entries containing this sequence from NCBI Entrez: gij558673 from L. polyphemus. Matched peptides shown in Bold 1 MCEEDVAALV VDNGSGMCKAGFAGDDAPRA VFPSIVGRPR HQGVMVGMGQ 51 KDSYVGDEAQSKRGILTLKY PIEHGIVTNW DDMEKIWHHT FYNELRVAPE 101 EHPVLLTEAP LNPKANREKM TQIMFETFNT PAMYVAIQAV LSLYASGRTT 151 GIVLDSGDGV SHTVPIYEGY ALPHAILRLD LAGRDLTDYL MKVLTERGYS 201 FTTTAEREIV RDIKEKLCYVALDFENEMTT AASSSSLEKS YELPDGQVIT 251 IGNERFRCPE AMFQPSFLGM EACGIQETTF NSIMKCDVDI RKDLYANTVL 301 SGGSTMFPGI ADRMQKEICA LAPSTMKIKI IAPPERKYSV WIGGSILASL 351 STFQQMWISK QEYDESGPSI VHRKCF

498

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499

B4: Phosphatase-1 protein sequence Match to: gij2245512 Score: 57, protein phosphatase-1 (Herdmania curvata) Nominal mass (Mr): 38268; Calculated pI value: 6.61 NCBI BLAST search of gij2245512 against nr Unformatted sequence string for pasting into other applications Matched peptides shown in Bold 1 MSESDKLNVD KIISRLLEVR GSRPGKNVQL TENEIRGLCL KTREIFLSQP 51 ILLELEAPLK ICGDVHGQYY DLLRLFDYGG FPPESNYLSL GDYVDRGKQS 101 LETICLLLAY KIKYPENFFL LRGNHECASI NRIYGFYDEC KRRYNIKLWK 151 TFTDCFNCLP LAAIIDEKIF CCHGGLSPDL QSMEQIRRIM RPTDVPDQGL 201 LCDLLWSDPD KEVAGWGEND RGVSFTFGAE VVAKFLHKQD LDHICRAHQV 251 VEDGYEFFAK RQLVTLFSAP NYCGEFDNAG AMMSVDETLM CSFQILKPVD 301 KKKFPYGGLN AGRPVTPPRA SAGKGKGAKS GK. References [1] Mydlarz LD, Jones LE, Drew Harvell C. Innate immunity environmental drivers and disease ecology of marine and freshwater invertebrates. Annu Rev Ecol Evol Syst 2006;37:251e88.
ski Z, Jarosz J. Molluscan immune defenses. Arch Immunol Ther Exp [2] Glin (Warsz) 1997;45:149e55. [3] Galloway T, Depledge M. Immunotoxicity in invertebrates: measurement and ecotoxicological relevance. Ecotoxicology 2001;10:5e23. [4] Bettencourt R, Roch P, Stefanni S, Rosa D, Colaço A, Serr~ ao Santos R. Deep sea immunity: unveiling immune constituents from the hydrothermal vent mussel Bathymodiolus azoricus. Mar Environ Res 2007;64:108e27. [5] Bettencourt R, Dando P, Collins P, Costa V, Allam B, Serr~ ao Santos R. Innate immunity in the deep sea hydrothermal vent mussel Bathymodiolus azoricus. Comp Biochem Physiol e A Mol Integr Physiol 2009;152:278e89. [6] Canesi L, Gallo G, Gavioli M, Pruzzo C. Bacteria-hemocyte interactions and phagocytosis in marine bivalves. Microsc Res Tech 2002;57:469e76. [7] Ord
as MC, Novoa B, Figueras A. Modulation of the chemiluminescence response of Mediterranean mussel (Mytilus galloprovincialis) haemocytes. Fish Shellfish Immunol 2000;10:611e22. res D, Biscoito M, Caprais JC, Colaço A, Comtet T, Crassous P, et al. [8] Desbruye Variations in deep-sea hydrothermal vent communities on the Mid-Atlantic Ridge near the Azores plateau. Deep-Sea Res Part I 2001;48:1325e46. [9] Van Dover CL, German CR, Speer KG, Parson LM, Vrijenhoek RC. Evolution and biogeography of deep-sea vent and seep invertebrates. Science 2002;295:1253e7. [10] Gosling EM. Systematics and geographic distribution of Mytilus. Genetics of mytilus. In: The mussel Mytilus: ecology physiology genetics and culture. Amsterdam: Elsevier; 1992. p. 1e20. [11] Hasan NA, Grim CJ, Lipp E, Rivera INB, Chun J, Haley B, et al. Deep sea bacteria related to human pathogenic Vibrio species. In: Vibrios in the environment conference; 2010.
ne s G, Christen R, Guezennec J, Pignet P, Barbier G. Vibrio diabolicus sp. nov., a [12] Rague new polysaccharide-secreting organism isolated from a deep-sea hydrothermal vent polychaete annelid, Alvinella pompejana. Int J Syst Bacteriol 1997;47:989e95. [13] Austin B. Review Vibrios as causal agents of zoonoses. Vet Microbiol 2010;140: 310e7. [14] Goldberg ED, Bertine KK. Beyond the mussel watchenew directions for monitoring marine pollution. Sci Total Environ 2000;247:165e74. [15] Miyazaki JI, de Oliveira Martins L, Fujita Y, Matsumoto H, Fujiwara Y. Evolutionary process of deep-sea Bathymodiolus mussels. PLoS One 2010;5. [16] Boutet I, Ripp R, Lecompte O, Dossat C, Corre E, Tanguy A, et al. Conjugating effects of symbionts and environmental factors on gene expression in deepsea hydrothermal vent mussels. BMC Genomics 2011;12:530. [17] Bustin SA, Beaulieu J-F, Huggett J, Jaggi R, Kibenge FSB, Olsvik PA, et al. The
cis: pratical implementation of minimum standard guidelines for MIQE pre fluorescence-based quantitative real-time PCR experiments. BMC Mol Biol 2010;11:74.
[18] Costa MM, Prado-Alvarez M, Gestal C, Li H, Roch P, Novoa B, et al. Functional and molecular immune response of Mediterranean mussel (Mytilus galloprovincialis) haemocytes against pathogen-associated molecular patterns and bacteria. Fish Shellfish Immunol 2009;26:515e23. [19] Bettencourt R, Pinheiro M, Egas C, Gomes P, Afonso M, Shank T, et al. HighThroughput sequencing and analysis of the gill tissue transcriptome from the deep-sea hydrothermal vent mussel Bathymodiolus azoricus. BMC Genomics 2010;11:559e76.

[20] Venier P, De Pitta C, Bernante F, Varotto L, De Nardi B, Bovo G, et al. MytiBase: a knowledgebase of mussel (M. galloprovincialis) transcribed sequences. BMC Genomics 2009;10:72. [21] Rosen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA, editors. Bioinformatics methods and protocols: methods in molecular biology; 2000. [22] Livak KJ, Schmittgen T. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCt method. Methods 2001;25:402e8. [23] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403e10. [24] Zorita I, Apraiz I, Ortiz-Zarragoitia M, Orbea A, Cancio I, Soto M, et al. Assessment of biological effects of environmental pollution along the NW Mediterranean Sea using mussels as sentinel organisms. Environ Pollut 2007;148:236e50. [25] Ciacci C, Citterio B, Betti M, Canonico B, Roch P, Canesi L. Functional differential immune responses of Mytilus galloprovincialis to bacterial challenge. Comp Biochem Physiol e B Biochem Mol Biol 2009;153:365e71. [26] Leffler H, Carlsson S, Hedlund M, Qian Y, Poirier F. Introduction to galectins. Glycoconj J 2004;19:433e40. [27] Yang RY, Rabinovich GA, Liu FT. Galectins: structure, function and therapeutic potential. Expert Rev Mol Med 2008;10:e17. [28] Vasta GR, Ahmed H, Nita-Lazar M, Banerjee A, Pasek M, Shridhar S, et al. Galectins as self/non-self recognition receptors in innate and adaptive immunity: an unresolved paradox. Front Immunol 2012;3(199):1e14. [29] Yu Y, Yuan S, Yu Y, Huang H, Feng K, Pan M, et al. Molecular and biochemical characterization of galectin from amphioxus: primitive galectin of chordates participated in the infection processes. Glycobiology 2007;17:774e83. [30] Li Y, Komai-Koma M, Gilchrist DS, Hsu DK, Liu F-T, Springall T, et al. Galectin-3 is a negative regulator of lipopolysaccharide-mediated inflammation. J Immunol 2008;181:2781e9. [31] Christophides GK, Zdobnov E, Barillas-Mury C, Birney E, Blandin S, Blass C, et al. Immunity-related genes and gene families in Anopheles gambiae. Science 2002;298:159e65. [32] Dziarski R, Gupta D. The peptidoglycan recognition proteins (PGRPs). Protein family review. Genome Biol 2006;7:232. [33] Martins E, Queiroz A, Serr~ ao Santos R, Bettencourt R. Finding immune gene expression differences induced by marine bacterial pathogens in the Deep-sea hydrothermal vent mussel Bathymodiolus azoricus. Biogeosciences 2013;10: 7279e91. [34] Gonzalez M, Gueguen Y, Destoumieux-Garzon D, Romestand B, Fievet J, re M, et al. Evidence of a bactericidal permeability increasing protein in Pugnie an invertebrate, the Crassostrea gigas Cg-BPI. Proc Natl Acad Sci U S A 2007;104:17759e64.
n D, Bache re E. [35] Schmitt P, Lorgeril JD, Gueguen Y, Destoumieux-Garzo Expression, tissue localization and synergy of antimicrobial peptides and proteins in the immune response of the oyster Crassostrea gigas. Dev Comp Immunol 2012;37:363e70. [36] Janssens S, Beyaert R. A universal role for MyD88 in TLR/IL-1R-mediated signaling. Trends Biochem Sci 2002;27(9):474e82. [37] Esko JD, Kimata K, Lindahl U. Proteoglycans and sulfated glycosaminoglycans. Chapter 16. In: Varki A, Cummings RD, Esko JD, et al., editors. Essentials of glycobiology. 2nd ed. Cold Spring Harbor. New York: Cold Spring Harbor Laboratory Press; 2009. [38] Bartlett AH, Park PW. Heparan sulfate proteoglycans in infection Chapter 2. In: ~o MSG, editor. Glycans in diseases and therapeutics. Biology of extraPava cellular matrix. Berlin Heidelberg: Springer-Verlag; 2011. p. 31e62. [39] Lee Y, Whang I, Umasuthan N, De Zoysa M, Oh C, Kang D-H, et al. Characterization of a novel molluscan MyD88 family protein from manila clam, Ruditapes philippinarum. Fish Shellfish Immunol 2011;31:887e93. [40] Wang PH, Liang JP, Gu Z-H, Wan D-H, Weng S-P, Yu X-Q, et al. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and Lv- Toll3) and three putative Spatzle-like Toll ligands (LvSpz1e3) from Litopenaeus vannamei. Dev Comp Immunol 2012;36(2):359e71. [41] Toubiana M, Gerdol M, Rosani U, Pallavicini A, Venier P, Roch P. Toll-like receptors and MyD88 adaptors in Mytilus: complete cds and gene expression levels. Dev Comp Immunol 2013;40:158e66. [42] Wang M, Yang J, Zhou Z, Qiu L, Wang L, Zhang H, et al. A primitive Toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farreri. Dev Comp Immunol 2011;35:511e20. [43] Zhang L, Li L, Zhang G. A Crassostrea gigas. Toll-like receptor and comparative analysis of TLR pathway in invertebrates. Fish Shellfish Immunol 2011;30: 653e60. [44] Toubiana M, Rosani U, Giambelluca S, Cammarata M, Gerdol M, Pallavicini A, et al. Toll signal transduction pathway in bivalves: complete CDS of intermediate elements and related gene transcription levels in hemocytes of immune stimulated Mytilus galloprovincialis. Dev Comp Immunol 2014;45:300e12. [45] Nyholm SV, Song P, Dang J, Bunce C, Girguis PR. Expression and putative function of innate immunity genes under in situ conditions in the symbiotic hydrothermal vent tubeworm Ridgeia piscesae. PLoS One 2012;7(6): e38267. [46] Schep AN, Adryan B. A comparative analysis of transcription factor expression during metazoan embryonic development. PLoS One 2013;8. [47] Hoeffler WK, Levinson AD, Bauer EA. Activation of c-Jun transcription factor by substitution of a charged residue in its N-terminal domain. Nucleic Acids Res 1994;22:1305e12.

E. Martins et al. / Fish & Shellfish Immunology 40 (2014) 485e499 [48] Villar D, Flicek P, Odom DT. Evolution of transcription factor binding in metazoans e mechanisms and functional implications. Nat Rev Genet 2014;15:221e33. [49] Mao Y, Zhou C, Zhu L, Huang Y, Yan T, Fang H, et al. Identification and expression analysis on bactericidal permeability-increasing protein (BPI)/ lipopolysaccharide-binding protein (LBP) of ark shell, Scapharca broughtonii. Fish Shellfish Immunol 2013;35(3):642e52. [50] Baojian Z, Wu X. Identification and function of LPS induced tumor necrosis factor-alpha (LITAF) gene from Crassostrea ariakensis stimulated by Rickettsialike organism. Afr J Microbiol Res 2012;6(19):4169e74. [51] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783e801. [52] Chaudhuri K, Chatterjee SN. Cholera toxins. Berlin Heidelberg: Springer-Verlag; 2009. p. 18e323. [53] Morimoto RI, Tissieres A, Georgopoulos C. Stress protein in biology and medicine. New York: Cold Spring Harbour Laboratory Press; 1994. [54] Fabbri E, Valbonesi P, Franzellitti S. Review HSP expression in bivalves. ISJ 2008;5:135e61. [55] Franzellitti S, Fabbri E. Differential HSP70 gene expression in the Mediterranean mussel exposed to various stressors. Biochem Biophys Res Commun 2005;336:1157e63. [56] Hofmann GE. Ecologically relevant variation in induction and function of heat shock proteins in marine organisms. Am Zool 1999;39:889e900. [57] Hofmann G, Somero G. Evidence for protein damage at environmental temperatures: seasonal changes in levels of ubiquitin conjugates and hsp70 in the intertidal mussel Mytilus trossulus. J Exp Biol 1995;198:1509e18.

499

[58] Cho E-S, Jeong H-D. Effect of environmental impact to molecular expression of heat-shock protein (HSP70) in oyster Crassostrea gigas from Gamak bay, Korea. J Environ Biol 2012;33:609e15. [59] Arthur JR. The glutathione peroxidases. Cell Mol Life Sci 2000;57:1825e35. [60] Criqui MC, Jamet E, Parmentier Y, Marbach J, Durr A, Fleck J. Isolation and characterization of a plant cDNA showing homology to animal glutathione peroxidases. Plant Mol Biol 1992;18:623e7. [61] Gostyukhina OL. Comparative characteristics of the antioxidant glutathione complex in the black sea molluscs Mytilus galloprovincialis Lam. and Anadara inaequivalvis Br. J Evol Biochem Physiol 2013;49:59e65. [62] Dos Remedios CG, Chhabra D, Kekic M, Dedova IV, Tsubakihara M, Berry DA, et al. Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev 2003;83:433e73. [63] Yang J, Kalhan SC, Hanson RW. What is the metabolic role of phosphoenolpyruvate carboxykinase. J Biol Chem 2009;284(40):27025e9. [64] Laschet JJ, Minier F, Kurcewicz I, Bureau MH, Trottier S, Jeanneteau F, et al. Glyceraldehyde-3-phosphate dehydrogenase is a GABAA receptor kinase linking glycolysis to neuronal inhibition. J Neurosci 2004;24(35):7614e22. [65] Guerrero-Ferreira RC, Nishiguchi MK. Biodiversity among luminescent symbionts from squid of the genera Uroteuthis, Loliolus and Euprymna (Mollusca: Cephalopoda). Cladistics 2007;23:497e506. [66] Peters C, Andrews PD, Stark MJ, Cesaro-Tadic S, Glatz A, Podtelejnikov A, et al. Control of the terminal step of intracellular membrane fusion by protein phosphatase. Science 1999;285:1084e7. [67] Cohen PTW. Protein phosphatase 1- targeted in many directions. J Cell Sci 2002;115:241e56.