Mol Biol Rep (2014) 41:1713–1721 DOI 10.1007/s11033-014-3020-1

Comparison of different protocols for neural differentiation of human induced pluripotent stem cells Ali Salimi • Samad Nadri • Marzieh Ghollasi Khosro Khajeh • Masoud Soleimani

•

Received: 18 July 2013 / Accepted: 2 January 2014 / Published online: 29 January 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract Although embryonic stem cells (ESCs) have enormous potentials due to their pluripotency, their therapeutic use is limited by ethical, biological and safety issues. Compared to ESCs, induced pluripotent stem cells (iPSCs) can be obtained from mouse or human fibroblasts by reprogramming. Numerous studies have established many protocols for differentiation of human iPSCs (hiPSCs) into neural lineages. However, the low differentiation efficiency of such protocols motivates researchers to design new protocols for high yield differentiation. Herein, we compared neural differentiation potential of three induction media for conversion of hiPSCs into neural lineages. In this study, hiPSCsderived embryoid bodies were plated on laminin coated

Electronic supplementary material The online version of this article (doi:10.1007/s11033-014-3020-1) contains supplementary material, which is available to authorized users. A. Salimi Department of Nanobiotechnology, Faculty of Biological Science, Tarbiat Modares University, Tehran, Iran S. Nadri Stem Cell Biology Department, Nanotechnology and Tissue Engineering Department, Stem Cell Technology Research Center, Tehran, Iran M. Ghollasi Department of Cell and Molecular Biology, Faculty of Biological Science, Kharazmi University, Tehan, Iran K. Khajeh Department of Biochemistry, Faculty of Biological Science, Tarbiat Modares University, Tehran, Iran M. Soleimani (&) Department of Hematology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran e-mail: [email protected]

dishes and were treated with three induction media including (1) bFGF, EGF (2) RA and (3) forskolin, IBMX. Immunofluorescence staining and quantitative real-time PCR (qPCR) analysis were used to detect the expression of neural genes and proteins. qPCR analysis showed that the expression of neural genes in differentiated hiPSCs in forskolin, IBMX supplemented media was significantly higher than undifferentiated cells and those in induction media containing bFGF, EGF or RA. In conclusion, our results indicated a successful establishment protocol with high efficiency for differentiation of hiPSCs into neural lineages. Keywords Induced pluripotent stem cells
Protocol
Neural differentiation
Induction media

Introduction Stem cell therapy, a cellular approach for the repair and regeneration of various tissues and organs, is offering an attractive field of research with potential medical therapies, particularly for specific neural disorders or injuries. To achieve this goal, regenerative medicine requires the use of authentic sources of stem cells and cytokine growth factors [1]. Uniquely, stem cell populations are subject to differentiate into tissue-specific lineages. Naturally derived stem cells, such as embryonic, umbilical cord blood and adult stem cells, participate in organ development in utero and tissue renewal during adulthood [2]. Induced pluripotent stem cells (iPSCs), which are functionally similar to embryonic stem cells (ESCs), can be obtained from mouse or human fibroblasts by activating a combination of a limited number of reprogramming genes such as Oct4, Sox2, Klf4, and c-Myc [3] or Oct4, Sox2, Nanog, and Lin28 [4–7]. Various sources of cells such as

123

1714

Mol Biol Rep (2014) 41:1713–1721

normal fibroblasts [8], keratinocytes [9], hematopoietic lineages [10], or adipose tissue [11] have been successfully reprogrammed. There are no ethical obstacles with using iPSCs since they are produced from somatic cells. Moreover, these cells are capable of self-renewal and differentiation into a wide range of cell types, providing an unlimited, invaluable and promising source of pluripotent stem cells for cell transplantation therapy and overcoming many human diseases [12]. The wide district of therapeutic potentials of the iPSCs has been demonstrated in numerous principle diseases/ailments including sickle cell anemia [13], hemophilia A [14], musculoskeletal [15] and heart diseases [16–18]. In addition, evolving iPS cell models would be advantageous to the treatment of many neurodegenerative and neurodevelopmental disorders [19] such as Parkinson’s [20–22], Huntington’s [23], multiple sclerosis [24] and Sandhoff diseases [25] as well as Fragile X [26], Down’s [6] and Prader-Willi syndromes [27]. In other investigations, iPSCs have been used to treat injuries of the central nervous system, including spinal cord [28, 29]. In producing particular cell types for specific uses, it is crucial to direct the differentiation of iPSCs to the favorable lineages. One of the key components in appropriate guided differentiation are the growth factors that promote differentiation, expansion or survival of specific cell types [30]. A number of investigations have used various treatments containing retinoic acid (RA), sonic hedgehog (SHH), glial cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor, insulin-like growth factor (IGF), epidermal growth factor (EGF), basic fibroblast growth factor (bFGF) and nerve growth factor for neural differentiation of iPSCs in vitro and in vivo [25, 31–37]. Although numerous studies have been performed for induction of neural differentiation in iPSCs, the low differentiation efficiency of such protocols motivates researchers to design other methods for higher neural differentiation yield. In this project, we compared the neural differentiation potential of three induction media for differentiation of hiPSCs into neural cells and consequently attained a new protocol with high efficiency.

with hiPSC medium containing DMEM/F12 culture medium supplemented with 10 % FBS-ESC qualified, 0.1 mmol/l nonessential amino acids, 1 mmol/l L-glutamine, 20 ng/ml bFGF (all from Invitrogen), 0.1 mmol/l b-mercaptoethanol and penicillin (50 U/ml)/streptomycin (50 lg/ml) (all from Sigma-Aldrich, St. Louis, MO), and about 50 % of the medium was replaced every day. Every five to six days hiPS colonies were detached with 0.1 % collagenase IV (Invitrogen), and replated onto inactivated SNL76/7 cells for outspread.

Materials and methods

The transcription level of neural key genes including btubulin III, Nestin, neuron specific enolase (NSE), microtubule-associated protein-2 (MAP-2), Olig2, glial fibrillary acidic protein (GFAP) and brain-derived neurotrophic factor (BDNF) was tested in differentiated hiPS cells by RT-PCR assay. The total cellular RNA was extracted using Qiazol (Qiagen) according to the manufacturer’s protocol and random hexamer primed cDNA synthesis was carried out with RevertAid first strand cDNA synthesis kit (Fermentas, Burlington, Canada). PCR amplification was

iPS cell culture The hiPSC line was obtained from the cell bank of Stem Cell Technology Research Center (Tehran, Iran). These cells were cultured on mitotically (Invitrogen Co. USA) inactivated feeder layers of SNL76/7 cells in 6 cm Petri dishes (SPL Life Sciences CO. Korea), covered with 20 lg/ml laminin in PBS (both Invitrogen). The cells were passaged every three days

123

Embryoid body formation For embryoid body (EB) formation, the iPS colonies were first removed from their feeder layers with 0.1 % collagenase IV, then transferred into non-treated six well plates (Jet Biofil, Japan). These colonies grew as EB-like floating cell aggregates in EB medium consisting of hiPS medium without bFGF for 3 days. In vitro differentiation of hiPS cells into neuronal lineages The EBs were plated on laminin (20 lg/ml) coated 6 cm Petri dishes in three different neural induction media consisting of (1) Knockout DMEM/F12, 20 ng/ml bFGF, 20 ng/ml EGF (Pepro Tech INC. CO, USA) and 1 % Lglutamine, (2) Knockout DMEM/F12, 2.5 lM RA (Sigma) and different concentrations of FBS (10, 5 and 2 % during 1–4, 5–10 and 11–14 days of differentiation, respectively) and (3) Knockout DMEM/F12, 2.5 mM forskolin (MP Biomedicals INC. CO, USA), 0.5 mM isobutyl methyl xanthin (IBMX; Sigma) and different concentrations of FBS (10, 5 and 2 % during 1–4, 5–10 and 11–14 days of differentiation, respectively). The EB colonies were incubated in 5 % CO2 at 37 °C for two weeks. The differentiated cells were examined for gene and protein expression. All the procedures were the same for specific and spontaneous differentiation, except the medium was for neuraldifferentiating and hiPSC, respectively. Reverse transcriptase-polymerase chain reaction (RT-PCR) and real-time RT-PCR analysis

Mol Biol Rep (2014) 41:1713–1721

1715

MAP-2

AGTTCCAGCAGCGTGATG CATTCTCTCTTCAGCCTTCTC

97

Olig2

GCTGTGCAAACACTTTGGGT

291

10 min. The fixed cells were blocked for 30 min at 37 °C with 5 % goat serum/PBS-tween-20 and were reacted overnight at 4 °C in a humidity chamber with the respective primary antibodies: b-tubulin III (1:50 Chemicon), MAP-2 (1:300 Santa Cruz biotechnology, INC) and NSE (1:100 Santa Cruz biotechnology). In the end of the incubation time, the cells were rinsed three times with PBStween-20 (0.1 %) and were incubated with the phycoerythrin PE-conjugated anti mouse IgG as the secondary antibody (1:100 Sigma) at room temperature for 1 h. After rinsing with PBS, the nuclei were counterstained with DAPI (Sigma), and the cells were then analyzed with a fluorescent microscope (Nikon, Japan).

127

Statistical analysis

187

The acquired data were analyzed by REST 2009. P-values less than 0.05 were considered as statistically significant. Asterisk (*) shows that the result is significant p B 0.05. Each experiment was repeated independently at least three times.

Table 1 Primers used in RT-PCR and real-time RT-PCR analysis Gene

Primers F (top), R (bottom)

Product size (bp)

b-tubulin III

GATCGGAGCCAAGTTCTG

177

GTCCATCGTCCCAGGTTC Nestin

GAAGGTGAAGGGCAAATCTG

96

CCTCTTCTTCCCATATTTCCTG NSE

GGAGAACAGTGAAGCCTTGG

238

GGTCAAATGGGTCCTCAATG

AAGGGTGTTACACGGCAGAC GFAP

GCAGACCTTCTCCAACCTG ACTCCTTAATGACCTCTCCATC

BDNF

GTGAATTGATAATAAACTGTCCTC TAATTCCAACGCTATCAGAAG

HPRT1

CCTGGCGTCGTGATTAGTG

125

TCAGTCCTGTCCATAATTAGTCC

carried out by standard procedure with Taq DNA Polymerase (Fermentas) with initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 15 s, annealing at 58 °C for 45 s, and extension at 72 °C for 45 s. The PCR products were separated on a 2 % agarose gel and visualized by staining the gel on ethidium bromide. The cDNA was used for 40 cycle PCR in Rotor Gene 6000 (Corbett Research, Australia) with a total volume of 13 ll containing 6.25 ll of SYBR PCR Premix EX TaqTM (Perfect Real Time; Takara), 600 nM of final concentration for each primer, 1 ll template and sufficient distilled water to reach the volume of 13 ll. Real-time PCR was performed in three-step with the following thermal setting: 3 min at 95 °C for initial enzyme activation followed by 40 amplification cycles (each 5 s at 95 °C, 20 s at 58 °C and 30 s at 72 °C with fluorescence detection) and a final step of melting curve analysis. All the samples were analyzed in duplicate, and the average values were used for quantification. The relative quantitative model was performed to calculate the expression of the target gene in comparison to HPRT1 as the endogenous control. For PCR amplification and realtime RT-PCR, genes and the related specific primers are represented in Table 1.

Results iPS cell culture and embryoid body formation The hiPS colonies [38, 39] were cultured on laminin coated 6 cm dishes seeded with mitomycin C-treated SNL feeder, and incubate in a 37 °C, 5 % CO2 incubator until they reached 80–90 % confluency (Fig. 1a). For EB formation, the hiPSCs were detached from their feeder layers with collagenase IV and transferred into non-treated six well plates in a defined medium. EBs were detected after 3 days of suspension culture (Fig. 1b). In vitro differentiation of hiPS cells into neural lineages Cellular morphology After 2 weeks of exposure to three distinct neural induction media, the differentiated cells were first morphologically assessed using phase contrast microscope. In vitro differentiation of hiPS cells into neuron-like cells was observed in all three defined media (Fig. 2) however, morphology of the cells treated with the induction medium 3, containing IBMX and forskolin, was the best.

Immunocytochemistry

RT-PCR and real-time RT-PCR analysis

The cells were rinsed twice with PBS and then fixed with 4 % paraformaldehyde (Sigma) for 20 min. The cells were then permeabilized with 0.4 % Triton X100 in PBS for

The expression of neural (oligodendrocyte-, astrocyte- and neuronal-specific) genes was examined in both undifferentiated and differentiated hiPS cells in order to confirm

123

1716

Mol Biol Rep (2014) 41:1713–1721

Fig. 1 Human iPSCs (black arrowheads) (a) seeded on SNL76/7 feeder layer (white arrowheads) and human iPS embryoid bodies (EBs) (b). Scale bars represent 100 lm

Fig. 2 Phase contrast morphology of differentiated neuronal-like iPSCs in different induction media 1, 2 and 3. The scale bar is 100 lm

neural differentiation after applying three defined induction media. RT-PCR analysis indicated the expression of the mentioned genes (Supplementary Fig. 1). In differentiated hiPSCs, mRNA levels encoding for b-tubulin III, Nestin, NSE, MAP-2, Olig2, GFAP and BDNF were higher compared with undifferentiated hiPSCs. As shown in Fig. 3, Nestin (2.4-fold; p B 0.001), MAP-2 (4.55-fold; p B 0.001), Olig2 (2.3-fold; p B 0.001), GFAP (1.3-fold; p B 0.001) and BDNF (4.35-fold; p B 0.001) genes were expressed significantly higher in induction medium 2 compared with induction medium 1. However, no significant differences were detected between the expression of b-tubulin III and NSE genes in both induction media 1 and 2. Our results indicated that in induction medium 3, btubulin III (1.3-fold; p B 0.001), Nestin (3.96- and 1.64folds; p B 0.001), NSE (1.3 and 2.0-folds; p B 0.001), MAP-2 (7.4- and 1.63-folds; p B 0.001), Olig2 (5.25- and 2.3-folds; p B 0.001) and BDNF (9.1- and 2.1-folds; p B 0.001) were significantly expressed higher and GFAP expression was lower than other groups .

123

Immunofluorescence staining for b-tubulin III, MAP-2 and NSE The protein level of neural key genes was increased in the period of differentiation of hiPSCs into neural lineages. Immunofluorescence staining was performed to investigate the cellular localization and expression of neuronal markers. Expression of the transcription factors including btubulin III, MAP-2 and NSE proteins were assayed by immunofluorescence staining which confirmed their presence in differentiated hiPSCs in all induction media (Fig. 4).

Discussion Although ESCs have enormous potentials due to their pluripotency, their therapeutic use is limited by ethical, biological and safety issues. Compared to ESCs, adult stem cells (ASCs) have lower self-renewal capability and

Mol Biol Rep (2014) 41:1713–1721

Fig. 3 Investigation of oligodendrocyte, astrocyte and neuronal gene expression in both undifferentiated and differentiated hiPSCs. Realtime RT-PCR analysis indicates up and down expression of neural markers after applying three defined induction media. REST software was used for gene expression analysis using real-time PCR data from the rotor-gene Q. HPRT1 was used as a control for RNA sample quality. Results are presented as mean ± SD. Significant levels are *p B 0.05

multipotency [1, 40]. Considering the advances in iPSCs technology and their differentiation potentials into any type of cells from the three germ layers, these cells could overcome the limitations of hESCs and ASCs [41]. Promising evidence has been reported for the use of iPSCs in a number of animal models of human diseases, including

Fig. 4 Immunofluorescence staining of differentiated iPSCs in three neural induction media for 2 weeks. The cells were analyzed for the expression of neural markers including b-tubulin III (a, c, e), MAP-2

1717

hematological diseases (Fanconi and sickle cell anemia, hemophilia A), cardiac diseases as well as type I diabetes, familial dysautonomia, amyotrophic lateral sclerosis [42, 43], Alzheimer’s [44–46], Parkinson’s [20–22], Huntington’s disease [23] and many other syndromes (Down’s and Prader-Willi syndromes) [6, 27]. In the present study, differentiation of hiPSCs into neural lineages was assessed in three induction media, and a new protocol with optimum efficiency was introduced. Although various studies have established different protocols for neural differentiation, there are numerous limitations in iPSC differentiation to specific neural lineages including low efficiency, which is a drawback for their application in regenerative medicine and cell therapy [24, 25, 47]. To overcome the technical challenges of generating neuronal cells from iPSC lines, it is vital to organize a more rapid and efficient method of differentiation. In this project, the yield of neural cells was higher than previous reports where three definite media including (1) bFGF and EGF, (2) RA and (3) forskolin and IBMX were used. This protocol revealed a high percentage of neuronal differentiation. Immunocytochemical analysis showed that more than 90 % of total iPSCs expressed specific neuronal proteins such as btubulin III, MAP-2 and NSE. In this study, forskolin and IBMX were indicated to prompt highly efficient differentiation of hiPSCs into specific classes of neurons. iPSCs were differentiated within 2 weeks using DMEM containing FBS, forskolin and IBMX. Previous investigators have differentiated iPSCs

(g, i, k) and NSE (m, o, q). DAPI staining (b, d, f, h, j, l, n, p, r). Scale bars represent 100 lm

123

1718

using a multi-step protocol in a cocktail of neuronal medium consisting of DMEM supplemented with SHH, GDNF and BDNF [35]. According to the results, herein it seems that iPSCs were differentiated into neurons by easier and more feasible protocol compared with other studies. This study demonstrated an induction role of forskolin, IBMX in iPSCs differentiation into neuronal lineages in vitro. Induction of iPSCs using strong factors at an early stage might be the key to a high yield of specific neural lineages. The role of forskolin and IBMX in neurogenesis processing and induction of cells into neuron-like morphology has been reported previously [48, 49]. In other reports it has been shown that low concentration of forskolin (1–2 lM) was necessary for maintaining human embryonic germ (hEG) cells proliferative in the undifferentiated state, but high concentration of forskolin (1 mM) may facilitate its differentiation towards neurons [50, 51]. MacDonald et al. [52] described that the addition of forskolin to the culture medium of mouse multipotent spinal cord precursor cells increased the number of MAP2–expressing neurons. In addition, the neurons obtained in neurotrophic factors treated cultures containing forskolin had longer neurites and more axon terminals than those found in the same cultures without forskolin [52]. IBMX is a competitive nonselective phosphodiesterase inhibitor [53] that similar to forskolin enhances the intracellular levels of cAMP by activating the adenylyl cyclase enzyme. Subsequently, activation of the PKA signaling pathway induces the differentiation of neural precursor cells [54–58]. Many researchers have used these induction agents for neural differentiation of human adipose tissue-derived stem cells and human mesenchymal stem cells into neuronal-like cells [1, 54, 55]. Our study successfully tried IBMX, forskolin to induce differentiating hiPSC cultures to mature neurons. Song et al. [24] showed the differentiation of iPSCs into neuronal cells within 4 weeks using an induction medium including EGF and human bFGF. However, due to a low expression rate of specific neuronal markers such as btubulin III and MAP-2, this protocol was not applicable. Nevertheless, we achieved more than 90 % expression of btubulin III and MAP-2 after treatment of iPSCs with forskolin, IBMX and different concentrations of FBS. b-tubulin III and MAP-2 play important functional roles in neuronal morphogenesis, polymerization and stabilization of microtubules, organelle transport within neurons and synaptic plasticity [59–61]. By treating the hiPSCs with neuronal factors at an early stage of differentiation, b-tubulin III, Nestin, NSE, MAP-2, Olig2, and BDNF genes (neuronal specific markers) were overexpressed while the expression of GFAP was suppressed. Our results suggested that iPSCs differentiated into neuronal lineages with higher efficiency. In addition, our protocol is easier and faster compared to other available iPSCs differentiation protocols.

123

Mol Biol Rep (2014) 41:1713–1721

Previous studies have shown impaired, low and variable differentiation of iPSCs expressing neuronal specific markers after treatment with N2 medium containing vitamin A, bFGF, EGF and another induction medium containing N2 supplement, FGF2, Noggin and SB43152 [25, 47]. Our study, established an effective neural differentiation protocol for iPSCs. However, further research is required to explain the capability of this method or to modify it for differentiating iPSCs for treatment of neuronal degenerations. Several studies have revealed that medium supplements are important in iPSC differentiation capacity [47, 62]. In this study, iPSCs were differentiated in three induction media, and the differentiation rate was examined in the three groups. In the next part of this study, differentiation rate of hiPSCs into neural lineages was assessed using three induction media. It has been proved that using conditioned media plays an important role in the differentiation of stem cells into neural lineages [62]. Neural differentiation efficiency of some but not all the cells could be enhanced by applying extra neural inducers, suggesting that low neural differentiation efficiencies cannot be explained by a single mechanism [47]. With this in mind, we prepared three induction media and investigated their effects on differentiating hiPSCs to obtain an effective neural induction medium. While various protocols have been proposed, no agreement on the most effective protocol has been attained so far. In the present study, we applied three different induction media included (1) bFGF, EGF (2) RA and (3) forskolin and IBMX. iPSCs differentiation was then evaluated by neuronal-like morphology of the cells and expression of neural specific markers by immunofluorescence experiments as well as realtime RT-PCR analysis after two weeks of treatment. When the cells were treated with induction medium 3 containing IBMX and forskolin, their morphology had a higher similarity with neuronal cells. This might imply that the growth factors IBMX and forskolin and reagents in induction medium 3 enriched the highest percentage of differentiated cells. Immunofluorescence staining demonstrated that in induction medium 3 neural specific proteins including btubulin III, MAP-2 and NSE were expressed higher than others. These results are in agreement with qPCR data acquired from the differentiated iPSCs. After exposure to induction media, qPCR analysis indicated that in induction medium 3 neural specific genes including b-tubulin III (neuronal marker), Nestin (neural stem cell marker), NSE (early neuroectoderm marker), MAP-2 (neuronal marker), Olig2 (oligodendrocyte marker) and BDNF (neurogenesis marker) were expressed at higher levels while the level of GFAP (astrocytic marker) was decreased compared to the differentiated cells in other induction media [24]. Taken together, these results indicated that iPSCs in induction medium 3 were more likely to differentiate into neural

Mol Biol Rep (2014) 41:1713–1721

cells, while iPSCs in other induction media preferentially differentiated into glial and astrocyte cells. Researchers have reported that forskolin increases the expression of GFAP with a concomitant reduction in the expression of nestin and NF-L in the cells, leading to morphological changes of these cells to astrocyte-like phenotype [56]. It seems that forskolin in combination with IBMX has activated common signaling pathways in neural differentiation of the cells and has had a synergistic influence on these pathways. In this project, Immunofluorescence staining revealed that the expression of neural specific markers including btubulin III, MAP-2 and NSE was higher in induction medium 2 than induction medium 1. qPCR analysis indicated that compared to RA, after treatment with bFGF and EGF, neural specific genes including Nestin, MAP-2, Olig2, GFAP and BDNF were expressed at high levels, while in both induction media 1 and 2 no significant differences were observed between b-tubulin III and NSE gene expression. These results demonstrated that iPSCs in induction medium 2 preferentially differentiated into glial and astrocyte cells, while iPSCs in induction medium 1 were more likely to differentiate into neural cells. In the present study, we differentiated iPSCs in induction medium 1 including bFGF and EGF. Some studies have shown that these growth factors play important modulatory roles in neuronal differentiation, axon growth as well as an inducing production of neural cells [63–65]. In this work, not only was the neural morphology inappropriate among the cells in both induction media 1 and 2, but also the gene and protein expression level was lower in induction medium 1 compared with 2 (including RA). RA has a critical role in neural differentiation, motor axon outgrowth, neural patterning and nerve regeneration. Previous investigations have reported the effect of RA on brain development and function [66]. Taken together, our results showed that forskolin and IBMX (as a new factor) induce upregulation of several genes important for differentiation of hiPSCs into neuronal cells. For the first time, we successfully demonstrated the high yield differentiation of iPSCs into neuronal lineages in vitro. Acknowledgments We are grateful to the manager of Stem Cell Technology Research Center.

References 1. Jang S, Cho HH, Cho YB, Park JS, Jeong HS (2010) Functional neural differentiation of human adipose tissue-derived stem cells using bFGF and forskolin. BMC Cell Biol 11:25. doi:10.1186/ 1471-2121-11-25 2. Nelson TJ, Martinez-Fernandez A, Yamada S, Ikeda Y, PerezTerzic C, Terzic A (2010) Induced pluripotent stem cells: advances to applications. Stem Cells Cloning 3:29–37. doi:10. 2147/SCCAA.S4954

1719 3. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126(4):663–676. doi:S0092-8674(06)00976-7 4. Lowry WE, Richter L, Yachechko R, Pyle AD, Tchieu J, Sridharan R, Clark AT, Plath K (2008) Generation of human induced pluripotent stem cells from dermal fibroblasts. Proc Natl Acad Sci USA 105(8):2883–2888. doi:10.1073/pnas.0711983105 5. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131(5):861–872. doi:S0092-8674(07)01471-7 6. Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, Lerou PH, Lensch MW, Daley GQ (2008) Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451(7175):141–146 7. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318(5858): 1917–1920. doi:1151526 8. Takahashi K, Okita K, Nakagawa M, Yamanaka S (2007) Induction of pluripotent stem cells from fibroblast cultures. Nat Protoc 2(12):3081–3089 nprot.2007.418 9. Aasen T, Raya A, Barrero MJ, Garreta E, Consiglio A, Gonzalez F, Vassena R, Bilic J, Pekarik V, Tiscornia G, Edel M, Boue S, Izpisua Belmonte JC (2008) Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes. Nat Biotechnol 26(11):1276–1284. doi:10.1038/nbt.1503 10. Loh YH, Agarwal S, Park IH, Urbach A, Huo H, Heffner GC, Kim K, Miller JD, Ng K, Daley GQ (2009) Generation of induced pluripotent stem cells from human blood. Blood 113(22):5476–5479. doi:10.1182/blood-2009-02-204800 11. Sun N, Panetta NJ, Gupta DM, Wilson KD, Lee A, Jia F, Hu S, Cherry AM, Robbins RC, Longaker MT, Wu JC (2009) Feederfree derivation of induced pluripotent stem cells from adult human adipose stem cells. Proc Natl Acad Sci USA 106(37):15720–15725. doi:10.1073/pnas.0908450106 12. Okada M, Oka M, Yoneda Y (2010) Effective culture conditions for the induction of pluripotent stem cells. Biochim Biophys Acta 1800(9):956–963. doi:10.1016/j.bbagen.2010.04.004 13. Hanna J, Wernig M, Markoulaki S, Sun CW, Meissner A, Cassady JP, Beard C, Brambrink T, Wu LC, Townes TM, Jaenisch R (2007) Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin. Science 318(5858): 1920–1923 1152092 14. Xu D, Alipio Z, Fink LM, Adcock DM, Yang J, Ward DC, Ma Y (2009) Phenotypic correction of murine hemophilia A using an iPS cell-based therapy. Proc Natl Acad Sci USA 106(3):808–813. doi:10.1073/pnas.0812090106 15. Bilousova G, du Jun H, King KB, De Langhe S, Chick WS, Torchia EC, Chow KS, Klemm DJ, Roop DR, Majka SM (2011) Osteoblasts derived from induced pluripotent stem cells form calcified structures in scaffolds both in vitro and in vivo. Stem Cells 29(2):206–216. doi:10.1002/stem.566 16. Nelson TJ, Martinez-Fernandez A, Yamada S, Perez-Terzic C, Ikeda Y, Terzic A (2009) Repair of acute myocardial infarction by human stemness factors induced pluripotent stem cells. Circulation 120(5): 408–416. doi:10.1161/CIRCULATIONAHA.109.865154 17. Gai H, Leung EL, Costantino PD, Aguila JR, Nguyen DM, Fink LM, Ward DC, Ma Y (2009) Generation and characterization of functional cardiomyocytes using induced pluripotent stem cells derived from human fibroblasts. Cell Biol Int 33(11):1184–1193. doi:10.1016/j.cellbi.2009.08.008 18. So KH, Han YJ, Park HY, Kim JG, Sung DJ, Bae YM, Yang BC, Park SB, Chang SK, Kim EY, Park SP (2011) Generation of functional cardiomyocytes from mouse induced pluripotent stem cells. Int J Cardiol 153(3):277–285. doi:10.1016/j.ijcard.2010.08.052

123

1720 19. Mattis VB, Svendsen CN (2011) Induced pluripotent stem cells: a new revolution for clinical neurology? Lancet Neurol 10(4):383–394. doi:10.1016/S1474-4422(11)70022-9 20. Wernig M, Zhao JP, Pruszak J, Hedlund E, Fu D, Soldner F, Broccoli V, Constantine-Paton M, Isacson O, Jaenisch R (2008) Neurons derived from reprogrammed fibroblasts functionally integrate into the fetal brain and improve symptoms of rats with Parkinson’s disease. Proc Natl Acad Sci USA 105(15):5856–5861. doi:10.1073/pnas.0801677105 21. Soldner F, Hockemeyer D, Beard C, Gao Q, Bell GW, Cook EG, Hargus G, Blak A, Cooper O, Mitalipova M, Isacson O, Jaenisch R (2009) Parkinson’s disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell 136(5):964–977. doi:10.1016/j.cell.2009.02.013 22. Seibler P, Graziotto J, Jeong H, Simunovic F, Klein C, Krainc D (2011) Mitochondrial Parkin recruitment is impaired in neurons derived from mutant PINK1 induced pluripotent stem cells. J Neurosci 31(16):5970–5976. doi:10.1523/JNEUROSCI.4441-10.2011 23. Zhang N, An MC, Montoro D, Ellerby LM (2010) Characterization of human huntington’s disease cell model from induced pluripotent stem cells. PLoS Curr 2:RRN1193. doi:10.1371/cur rents.RRN1193 24. Song B, Sun G, Herszfeld D, Sylvain A, Campanale NV, Hirst CE, Caine S, Parkington HC, Tonta MA, Coleman HA, Short M, Ricardo SD, Reubinoff B, Bernard CC (2012) Neural differentiation of patient specific iPS cells as a novel approach to study the pathophysiology of multiple sclerosis. Stem Cell Res 8(2):259–273. doi:10.1016/j.scr.2011.12.001 25. Ogawa Y, Tanaka M, Tanabe M, Suzuki T, Togawa T, Fukushige T, Kanekura T, Sakuraba H, Oishi K (2013) Impaired neural differentiation of induced pluripotent stem cells generated from a mouse model of Sandhoff disease. PLoS ONE 8(1):e55856. doi:10.1371/journal.pone.0055856 26. Urbach A, Bar-Nur O, Daley GQ, Benvenisty N (2010) Differential modeling of fragile X syndrome by human embryonic stem cells and induced pluripotent stem cells. Cell Stem Cell 6(5): 407–411. doi:10.1016/j.stem.2010.04.005 27. Yang J, Cai J, Zhang Y, Wang X, Li W, Xu J, Li F, Guo X, Deng K, Zhong M, Chen Y, Lai L, Pei D, Esteban MA (2010) Induced pluripotent stem cells can be used to model the genomic imprinting disorder Prader–Willi syndrome. J Biol Chem 285(51):40303–40311. doi:10.1074/jbc.M110.183392 28. Tsuji O, Miura K, Okada Y, Fujiyoshi K, Mukaino M, Nagoshi N, Kitamura K, Kumagai G, Nishino M, Tomisato S, Higashi H, Nagai T, Katoh H, Kohda K, Matsuzaki Y, Yuzaki M, Ikeda E, Toyama Y, Nakamura M, Yamanaka S, Okano H (2010) Therapeutic potential of appropriately evaluated safe-induced pluripotent stem cells for spinal cord injury. Proc Natl Acad Sci USA 107(28):12704–12709. doi:10.1073/pnas.0910106107 29. Fujimoto Y, Abematsu M, Falk A, Tsujimura K, Sanosaka T, Juliandi B, Semi K, Namihira M, Komiya S, Smith A, Nakashima K (2012) Treatment of a mouse model of spinal cord injury by transplantation of human induced pluripotent stem cell-derived long-term self-renewing neuroepithelial-like stem cells. Stem Cells 30(6):1163–1173. doi:10.1002/stem.1083 30. Ulloa-Montoya F, Verfaillie CM, Hu WS (2005) Culture systems for pluripotent stem cells. J Biosci Bioeng 100(1):12–27. doi:S1389-1723(05)70423-0 31. Karumbayaram S, Novitch BG, Patterson M, Umbach JA, Richter L, Lindgren A, Conway AE, Clark AT, Goldman SA, Plath K, Wiedau-Pazos M, Kornblum HI, Lowry WE (2009) Directed differentiation of human-induced pluripotent stem cells generates active motor neurons. Stem Cells 27(4):806–811. doi:10.1002/ stem.31 32. Zeng H, Guo M, Martins-Taylor K, Wang X, Zhang Z, Park JW, Zhan S, Kronenberg MS, Lichtler A, Liu HX, Chen FP, Yue L, Li

123

Mol Biol Rep (2014) 41:1713–1721

33.

34.

35.

36.

37.

38.

39.

40.

41. 42.

43.

44.

45.

46.

47.

XJ, Xu RH (2010) Specification of region-specific neurons including forebrain glutamatergic neurons from human induced pluripotent stem cells. PLoS ONE 5(7):e11853. doi:10.1371/ journal.pone.0011853 Cai J, Li W, Su H, Qin D, Yang J, Zhu F, Xu J, He W, Guo X, Labuda K, Peterbauer A, Wolbank S, Zhong M, Li Z, Wu W, So KF, Redl H, Zeng L, Esteban MA, Pei D (2010) Generation of human induced pluripotent stem cells from umbilical cord matrix and amniotic membrane mesenchymal cells. J Biol Chem 285(15): 11227–11234. doi:10.1074/jbc.M109.086389 Dimos JT, Rodolfa KT, Niakan KK, Weisenthal LM, Mitsumoto H, Chung W, Croft GF, Saphier G, Leibel R, Goland R, Wichterle H, Henderson CE, Eggan K (2008) Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science 321(5893):1218–1221. doi:10.1126/science.1158799 Ebert AD, Yu J, Rose FF Jr, Mattis VB, Lorson CL, Thomson JA, Svendsen CN (2009) Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature 457(7227):277–280. doi:10. 1038/nature07677 Wang A, Tang Z, Park IH, Zhu Y, Patel S, Daley GQ, Li S (2011) Induced pluripotent stem cells for neural tissue engineering. Biomaterials 32(22):5023–5032. doi:10.1016/j.bio materials.2011.03.070 Kuo YC, Wang CT (2012) Neuronal differentiation of induced pluripotent stem cells in hybrid polyester scaffolds with heparinized surface. Colloids Surf B Biointerfaces 100:9–15. doi:10. 1016/j.colsurfb.2012.05.014 Ardeshirylajimi A, Hosseinkhani S, Parivar K, Yaghmaie P, Soleimani M (2013) Nanofiber-based polyethersulfone scaffold and efficient differentiation of human induced pluripotent stem cells into osteoblastic lineage. Mol Biol Rep 40(7):4287–4294. doi:10.1007/s11033-013-2515-5 Ardeshirylajimi A, Soleimani M, Hosseinkhani S, Parivar K, Yaghmaie P (2013) A comparative study of osteogenic differentiation of human induced pluripotent stem cells and adipose tissue derived mesenchymal stem cells. Cell J 16(4):1–22 Madonna R (2012) Human-induced pluripotent stem cells: in quest of clinical applications. Mol Biotechnol 52(2):193–203. doi:10.1007/s12033-012-9504-041 Yamanaka S (2009) Ekiden to iPS cells. Nat Med 15(10): 1145–1148. doi:10.1038/nm1009-1145 Stadtfeld M, Hochedlinger K (2010) Induced pluripotency: history, mechanisms, and applications. Genes Dev 24(20):2239–2263. doi:10.1101/gad.1963910 Pfannkuche K, Hannes T, Khalil M, Noghabi MS, Morshedi A, Hescheler J, Droge P (2010) Induced pluripotent stem cells: a new approach for physiological research. Cell Physiol Biochem 26(2):105–124. doi:10.1159/000320514 Israel MA, Yuan SH, Bardy C, Reyna SM, Mu Y, Herrera C, Hefferan MP, Van Gorp S, Nazor KL, Boscolo FS, Carson CT, Laurent LC, Marsala M, Gage FH, Remes AM, Koo EH, Goldstein LS (2012) Probing sporadic and familial Alzheimer’s disease using induced pluripotent stem cells. Nature 482(7384): 216–220. doi:10.1038/nature10821 Yagi T, Ito D, Okada Y, Akamatsu W, Nihei Y, Yoshizaki T, Yamanaka S, Okano H, Suzuki N (2011) Modeling familial Alzheimer’s disease with induced pluripotent stem cells. Hum Mol Genet 20(23):4530–4539. doi:10.1093/hmg/ddr394 Yahata N, Asai M, Kitaoka S, Takahashi K, Asaka I, Hioki H, Kaneko T, Maruyama K, Saido TC, Nakahata T, Asada T, Yamanaka S, Iwata N, Inoue H (2011) Anti-Abeta drug screening platform using human iPS cell-derived neurons for the treatment of Alzheimer’s disease. PLoS ONE 6(9):e25788. doi:10.1371/ journal.pone.0025788 Hu BY, Weick JP, Yu J, Ma LX, Zhang XQ, Thomson JA, Zhang SC (2010) Neural differentiation of human induced pluripotent

Mol Biol Rep (2014) 41:1713–1721

48.

49.

50.

51.

52.

53. 54.

55.

56.

stem cells follows developmental principles but with variable potency. Proc Natl Acad Sci USA 107(9):4335–4340. doi:10. 1073/pnas.0910012107 Tio M, Tan KH, Lee W, Wang TT, Udolph G (2010) Roles of dbcAMP, IBMX and RA in aspects of neural differentiation of cord blood derived mesenchymal-like stem cells. PLoS ONE 5(2): e9398. doi:10.1371/journal.pone.0009398 Zhang L, Seitz LC, Abramczyk AM, Liu L, Chan C (2011) cAMP initiates early phase neuron-like morphology changes and late phase neural differentiation in mesenchymal stem cells. Cell Mol Life Sci 68(5):863–876. doi:10.1007/s00018-010-0497-1 Pan Y, Chen X, Wang S, Yang S, Bai X, Chi X, Li K, Liu B, Li L (2005) In vitro neuronal differentiation of cultured human embryonic germ cells. Biochem Biophys Res Commun 327(2): 548–556. doi:S0006-291X(04)02724-X De Felici M, Dolci S, Pesce M (1993) Proliferation of mouse primordial germ cells in vitro: a key role for cAMP. Dev Biol 157(1):277–280. doi:10.1006/dbio.1993.1132 MacDonald SC, Fleetwood IG, Hochman S, Dodd JG, Cheng GK, Jordan LM, Brownstone RM (2003) Functional motor neurons differentiating from mouse multipotent spinal cord precursor cells in culture and after transplantation into transected sciatic nerve. J Neurosurg 98(5):1094–1103. doi:10.3171/jns.2003.98.5.1094 Essayan DM (2001) Cyclic nucleotide phosphodiesterases. J Allergy Clin Immunol 108(5):671–680. doi:S0091-6749(01)96426-7 Kim SS, Choi JM, Kim JW, Ham DS, Ghil SH, Kim MK, KimKwon Y, Hong SY, Ahn SC, Kim SU, Lee YD, Suh-Kim H (2005) cAMP induces neuronal differentiation of mesenchymal stem cells via activation of extracellular signal-regulated kinase/MAPK. NeuroReport 16(12):1357–1361. doi:00001756200508220-00020 Rooney GE, Howard L, O’Brien T, Windebank AJ, Barry FP (2009) Elevation of cAMP in mesenchymal stem cells transiently upregulates neural markers rather than inducing neural differentiation. Stem Cells Dev 18(3):387–398. doi:10.1089/scd.2008.0080 Kim BJ, Kim SS, Kim YI, Paek SH, Lee YD, Suh-Kim H (2004) Forskolin promotes astroglial differentiation of human central neurocytoma cells. Exp Mol Med 36(1):52–56

1721 57. Mayr B, Montminy M (2001) Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2(8):599–609. doi:10.1038/35085068 58. Kao HT, Song HJ, Porton B, Ming GL, Hoh J, Abraham M, Czernik AJ, Pieribone VA, Poo MM, Greengard P (2002) A protein kinase A-dependent molecular switch in synapsins regulates neurite outgrowth. Nat Neurosci 5(5):431–437. doi:10.1038/nn840 59. Sanchez C, Diaz-Nido J, Avila J (2000) Phosphorylation of microtubule-associated protein 2 (MAP2) and its relevance for the regulation of the neuronal cytoskeleton function. Prog Neurobiol 61(2):133–168. doi:S0301-0082(99)00046-5 60. Haendel MA, Bollinger KE, Baas PW (1996) Cytoskeletal changes during neurogenesis in cultures of avain neural crest cells. J Neurocytol 25(4):289–301 61. Lee MK, Tuttle JB, Rebhun LI, Cleveland DW, Frankfurter A (1990) The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis. Cell Motil Cytoskeleton 17(2):118–132. doi:10.1002/cm.970170207 62. Scintu F, Reali C, Pillai R, Badiali M, Sanna MA, Argiolu F, Ristaldi MS, Sogos V (2006) Differentiation of human bone marrow stem cells into cells with a neural phenotype: diverse effects of two specific treatments. BMC Neurosci 7:14 63. Nagai A, Kim WK, Lee HJ, Jeong HS, Kim KS, Hong SH, Park IH, Kim SU (2007) Multilineage potential of stable human mesenchymal stem cell line derived from fetal marrow. PLoS ONE 2(12):e1272. doi:10.1371/journal.pone.0001272 64. Dezawa M, Kanno H, Hoshino M, Cho H, Matsumoto N, Itokazu Y, Tajima N, Yamada H, Sawada H, Ishikawa H, Mimura T, Kitada M, Suzuki Y, Ide C (2004) Specific induction of neuronal cells from bone marrow stromal cells and application for autologous transplantation. J Clin Invest 113(12):1701–1710. doi:10.1172/JCI20935 65. Lam HJ, Patel S, Wang A, Chu J, Li S (2010) In vitro regulation of neural differentiation and axon growth by growth factors and bioactive nanofibers. Tissue Eng Part A 16(8):2641–2648. doi:10. 1089/ten.TEA.2009.0414 66. Maden M (2007) Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat Rev Neurosci 8(10): 755–765

123