Journal of Bioscience and Bioengineering VOL. 120 No. 5, 491e497, 2015 www.elsevier.com/locate/jbiosc
Comparison of genetic structures and biochemical properties of tandem cutinasetype polyesterases from Thermobifida alba AHK119 Uschara Thumarat,1 Takeshi Kawabata,2 Maho Nakajima,3 Hajime Nakajima,4 Akifumi Sugiyama,5 Kazufumi Yazaki,5 Tomoko Tada,6 Tomonori Waku,6 Naoki Tanaka,6 and Fusako Kawai4, * Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand,1 Institute for Protein Research, Osaka University, 32 Yamadaoka, Suita, Osaka 565-0871, Japan,2 Department of Materials and Life Science, Graduate School of Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan,3 Center for Fiber and Textile Science, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan,4 Laboratory of Plant Gene Expression, Research Institute for Sustainable Humanosphere, Kyoto University, Gokasho, Uji City, Kyoto Prefecture 611-0011, Japan,5 and Department of Biomolecular Engineering, Graduate School of Science and Technology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan6 Received 8 August 2014; accepted 5 March 2015 Available online 22 April 2015
This study described the genetic map of tandem genes (est1 and est119) encoding cutinase-type polyesterases in Thermobifida alba AHK119 and comparison of wild type and mutant enzymes of Est1 and Est119. Two genes were independently and constitutively expressed. The activity of Est1 was higher by approximately 1.6e1.7-fold than that of Est119 towards p-nitrophenyl butyrate, although both enzymes shared 95% sequence identity and 98% similarity and possessed similar 3D structures except that several amino acids in the probable substrate-docking loops were different from each other. Calcium ion enhanced the activity and the thermostability of both enzymes. Based on conserved sequences among Thermobifida cutinases, valine, proline and lysine were introduced into Est1 at Ala68, Thr253 and Met256, respectively. Among wild and mutant enzymes of Est119 and Est1, Est1 (A68V/T253P) possessed three prolines in the substrate-docking loops and displayed the highest thermostability that spotlighted the important effect of proline numbers in the loops. Est1 (A68V/T253P) was stable for 1 h below 60 C and even at 65 C, more than 70% and 50% activities were maintained after 30 and 60 min, respectively. Est1 (A68V/T253P) degraded various aliphatic and aliphaticco-aromatic polyesters and hydrophilized an amorphous PET film. The enzyme hydrolyzed a PET trimer model compound, indicating its specificity towards an ester bond between terephthalic acid and ethylene glycol. Ó 2015, The Society for Biotechnology, Japan. All rights reserved. [Key words: Thermobifida alba AHK119; Cutinase-type polyesterase; Ca-activated cutinase; Thermostable cutinase; Tandem genes regulation; PET surface hydrolysis]
Plastic materials are indispensable products in modern life and are used in various areas from industries to homes. Conventional plastics have excellent physical properties for many applications, but they have low biodegradability in general and their waste is an increasing threat to our planet (1). Therefore, replacement of conventional plastics with biodegradable plastics is a potential way to reduce solid waste since they can be recycled through microorganisms. Most of biodegradable plastics (mostly aliphatic polyesters) have undesired material properties such as low tensile strength and low melting point. Aromatic polyesters (polyethylene terephthalate (PET) is the representative and typical one) that have excellent physical properties are practically non-biodegradable. Aliphatic-aromatic-co-polyesters were designed to combine the robust material properties and excellent biodegradability. The thermophiles Thermobifida fusca and Thermobifida alba have been isolated from composts and are potent degraders of various polyesters including aliphatic, aliphatic-co-aromatic and aromatic polyesters, although the degradation levels are different with
* Corresponding author. Tel./fax: þ81 75 724 7693. E-mail address: [email protected] (F. Kawai).
regards to the composition of polyesters and strains (2e4). The genes for polyester-hydrolyzing enzymes from T. fusca, T. alba and Thermobifida cellulosilytica have been cloned and determined to encode serine hydrolases (5e11) that belong to the lipase/esterase family (12). The genus Thermobifida possesses two tandem cutinase genes in general (11). T. alba AHK119 possessed est1 and est119 genes, between which est119 was expressed and mutated for characterization (11). Est119 was analyzed by X-ray crystallography as the first crystalline structure of a bacterial cutinase that has the polyester-degrading ability (13). These polyesterases can be used not only for the enzymatic recycling of polyesters to monomers, but also for enzymatic modification of polyester products, for example fibers for textiles, which makes better touch of textiles and improves dyeing of textiles (14). Here we report the genetic map of two cutinase genes (est1 and est119) from T. alba AHK119, which has not been reported thus far through genus Thermobifida. The two cutinases showed different activities and thermostabilities, although they share 95% identity and 98% similarity, resulting in the same topology. Based on 3D structural modeling and conserved sequences among Thermobifida cutinases, mutagenesis of Est1 was carried out and activities of wild and mutant Est1 and Est119 were compared.
1389-1723/$ e see front matter Ó 2015, The Society for Biotechnology, Japan. All rights reserved. http://dx.doi.org/10.1016/j.jbiosc.2015.03.006
492
THUMARAT ET AL. MATERIALS AND METHODS
Chemicals Polyesters used in this paper are the same as those described in the previous paper (11). PET film (amorphous, thickness of 0.25 mm) is a product of Goodfellow Cambridge Ltd. (Huntington, UK). Bis(2-hydroxyethyl) terephthalate is a product of Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). Bis(benozyloxyethyl)terephthalate (3PET) was synthesized as follows. Bis(2hydroxyethyl)terephthalate (1.00 g, 0.004 mol) and pyridine (1.26 g, 0.016 mol) as hydrogen acceptor were dissolved in anhydrous 1,4-dioxane (100 ml). The solution was kept at 0 C in ice bath for 3 h with stirring, and a solution of benzoyl chloride (2.26 g, 0.016 mol) in anhydrous 1,4-dioxane (100 ml) was added to it dropwise at 0 C for a period of 30 min. After the addition, the reaction mixture was stirred at room temperature for 12 h. Then, the solvent was removed by evaporation on a rotary evaporator to obtain solid precipitates. The solid precipitates were recrystallized three times from 1,4dioxane/methanol mixtures to finally give 0.5 g of 3PET. The chemical structure of 3PET was confirmed by 1H NMR: d 4.68 (s, CH2. 4H), d 7.43 (m, C6H2. 2H), d 7.57 (m, C6H1. 1H), d 8.05 (m, C6H2. 2H), d 8.11 (m, C6H2. 2H). 1H NMR spectra (300 MHz) were measured on an AV-300 spectrometer (Bruker Biospin GmbH, Rheinstetten, Germany) in CDCl3 containing 0.03 vol. % tetramethylsilane as the internal standard. All other chemicals were of the highest grade available through commercial routes. Bacterial strains and cultivation T. alba strain AHK119 was used throughout this research (3). Strain AHK119 was cultivated in Luria-Bertani medium (LB) at 50 C under shaking for 3 days. For the routine cloning, Escherichia coli DH5a and E. coli Rosetta-gami B (DE3) were used as hosts. Sequencing of est1 and the intergenic region between est1 and est119 Total DNA from T. alba AHK119 was extracted using a Gentra Puregene Yeast/Bacteria Kit (Qiagen K. K., Tokyo, Japan). The DNA purification, transformation, and electrophoresis were performed following the protocols of Sambrook and Russell (15). The restriction enzymes and other DNA-modifying enzymes were purchased from Toyobo (Osaka, Japan) or Takara Bio, Inc. (Ohtsu, Shiga, Japan) and were used as specified by the manufacturers. The KOD DNA polymerase was used for PCR according to the manufacturer’s instructions (Toyobo). Est119-1Fw-2 (50 ATGTCGGTCACCACCCCCCGCCGGGAGA 30 ) and WR1 (50 TGAACGGGGACGCTCAGCAG 30 ) were used to amplify est1 that is most probably identical to est119. PCR mixtures (25 ml) contained 1 mg total DNA, 0.3 pmol/ml of each primer, 1 mM MgCl2, 0.2 mM of each deoxynucleotide, 1 KOD DNA polymerase buffer, 4% (v/v) dimethylsulfoxide (DMSO) and 0.5 U of KOD DNA polymerase. The amplified fragment was purified and ligated into the pGEM-T easy vector (Promega, Madison, WI, USA). The plasmid (pGEM-est1) was transformed into E. coli DH5a for conventional blue-white selection. Plasmids of white colonies were extracted and both strands of each plasmid were sequenced by SolGent Co. (Daejeon, Korea). Sequence assembly and analysis was performed with GENETYX software version 5.1 (Genetyx Corp., Tokyo, Japan). The primers IEstF1 (50 TGAACAACGCCACCCACTTC 30 ) and WR2 (50 CTTCTCCGTCAGCGAGGAGC 30 ) were used to amplify the intergenic region between the est1 and est119 genes. The sequence encoding the probable mature Est1 protein (260 amino acids without the signal peptide) was amplified using H1F-BamH1 (50 CGCGGATCCAACCCCTACGAACGCGGC 30 ) and H1R-HindIII (50 GCGAAGCTTGAACGGGCAGGTGGAGCGGT 30 ) primers (the BamHI and HindIII restriction sites are underlined, respectively), digested with BamHI and HindIII, purified and ligated into the BamH1 and HindIII sites of the pQE80L (Qiagen K. K., Japan) to clone the Est1 as a 6 His-tagged fusion protein. The plasmid (pQE80Lest1) was transformed into E. coli Rosetta-gami B (DE3) using the heat-shock method (15). Reverse transcriptional PCR (RT-PCR) T. alba AHK119 was grown at 50 C for 3 days on LB or LB containing 0.1% poly(butylene succinate-co-apipate) (PBSA) suspension. Total RNA was isolated using a high-purity RNA isolation kit (Roche Diagnostics Japan, Tokyo), and the RNA samples were treated with DNase I (Invitrogen Corp., Carlsbad, CA, USA). RT-PCR was performed with the first strand using a cDNA synthesis kit (Roche), and PCR amplification of the second strand of DNA was performed using KOD plus DNA polymerase. Negative control experiments were performed by omitting the reverse transcription step. Positive control experiments were performed with genomic DNA as a template. The primers used for PCR were designed based on the est119 and est1 sequences. The primers: F2EcoRI (50 GAATTCGCTCCGGCCCAGGCCGCCAA 30 ) and R2HindIII (50 AAGCTTGAACGGGCAGGTGGAGCGGT 30 ) were used to amplify est119 and the primers: H1F-BamHI (50 CGCGGATCCAACCCCTACGAACGCGGC 30 ) and H1R-HindIII (50 GCGAAGCTTGAACGGGCAGGTGGAGCGGT 30 ) were used to amplify est1. The RTPCR product of the intergenic region between est1 and est119 was amplified using primers IEstF1 (50 TGAACAACGCCACCCACTTC 30 ) and WR2 (50 CTTCTCCGTCAGCGAGGAGC 30 ). Enzyme expression, purification and activity assay E. coli Rosetta-gami B (DE3) harboring the pQE80L-est1 plasmid was cultivated to express the recombinant Est1 and IPTG-induced Est1 was purified, as described previously (9). The purity of the enzyme was confirmed by SDS-PAGE (16), and the protein concentration was measured with a Bio-Rad protein assay kit (Bio-Rad Laboratories, Hercules, CA, USA), using bovine serum albumin as a standard. The
J. BIOSCI. BIOENG., molecular mass was determined by SDS-PAGE (16) and gel filtration on a Superdex 200 column (GE Healthcare, Uppsala, Sweden). The enzymatic activity was measured spectrophotometrically using p-nitrophenyl butyrate (pNPB) as a model substrate. Biefly, 50 ml of enzyme solution (approximately 0.001e0.003 mg/ml) was mixed with 930 ml of 50 mM TriseHCl buffer (pH 7.0). The reaction was started by addition of 20 ml of substrate solution (50 mM pNPB dissolved in isopropanol and stored at 20 C until use) at 37 C. Absorbance at 346 nm was recorded over 1 min with respect to a substrate solution without enzyme. One enzyme unit (U) was defined as the amount of enzyme liberating 1 mmole of p-nitrophenol per minute under the assay conditions (the molar extinction coefficient ε ¼ 5.48 mmol1 cm1). Unless specified, pNPBase activity was measured for characterization of the enzyme. The activity of purified Est1 on polyesters was confirmed by halo formation on LB agar plates containing 0.1% each polyester, as described previously (9). The activities were compared with the same amount of the enzyme (approximately 5e10 mg). The activity was also measured at 37 C for 1 h by the decrease of turbidity of PBSA suspension (Bionolle EM-301; final concentration of 0.05% in TriseHCl buffer (pH 7.0), which shows approximately 0.5 of absorbance at 610 nm) (11). The amount of the enzyme used was approximately 0.010e0.020 mg/ml. All the assays were performed in duplicate. Measurement of circular dichroism and differential scanning calorimetry Circular dichroism (CD) measurements were carried out with a Jasco spectropolarimeter model J-720 (Tokyo, Japan) at 25 C, using an optical cell with a path length 0.02 cm. Sample solutions were prepared in 50 mM MES or Tris (pH 7.0). Melting temperature (Tm) was measured with nano-differential scanning calorimeter [model 6100 NanoII differential scanning calorimetry (DSC), Calorimetry Sciences Co. Ltd., USA]. Tm values were measured with and without 50 mM CaCl2, as preliminary experiments indicated that the maximal value was obtained at 50 mM CaCl2. Samples were deaerated in vacuo for 15 min prior to measurements. DSC measurements were carried out under pressure of 3 atm to avoid bubbling of samples and at a heating rate of 1 C/min. Homology modeling of Est1 A 3D structure of Est1 from T. alba AHK119 was modeled with a Viewer Lite 5.0 software, based on Est119 (accession code 3VIS in Protein Data Base) from T. alba AHK119 (13). Site-directed mutagenesis Site-directed mutagenesis was performed to introduce a specific mutation using a KOD plus Mutagenesis Kit (Toyobo) according to the manufacturer’s instructions. PCR products were obtained with pQE80L-est1 as a DNA template using the site-directed mutagenesis specific primers. The parental pQE80L-est1 plasmid was removed by digesting with DpnI and PCR products were transformed directly to E. coli Rosetta-gami B (DE3) cells. The DNA sequences of the plasmids were analyzed by SolGent Co. Enzymatic reaction of Est1 with 3PET and PET and product analysis by hybrid ion trap/time-of-flight mass spectrometry coupled with liquid chromatography (LC-IT-TOF-MS) The reaction mixture (2 ml) contained 3PET(2 mg/ml), 20% dimethylsulfoxide, 100 mM TriseHCl buffer (pH 7.0), 300 mM CaCl2 and approximately 20 mM Est1 (A68V/T253P) was incubated at 50 C for 3 h with shaking. The reaction mixture was extracted with ethyl acetate three times, which was evaporated in vacuo and dehydrated with Na2SO4. The reaction products were filtered through Minisart RC4 0.20 mm filters (Sartorius, Goettingen, Germany). The filtrate was injected into a LC-IT-TOF-MS apparatus (Shimadzu, Kyoto, Japan): column TSKgel ODS-80Ts column 2.0 250 mm (Tosoh Corp., Tokyo, Japan); solvent, acetonitrile: water: formic acid (20:80:0.3); flow rate, 0.15 ml/min; detection, 252 and 280 nm. Standard materials were solved in ethyl acetate, filtered and subjected to the analysis. Terephthalic acid (TPA), benzoic acid (BA) and bis(2-hydroxyethoxy)terephthalate (BHT) were commercially available, but mono(2-hydroxyethoxy)terephthalate (MHET), mono(2-hydroxyethoxy)benzoate (MHEB) and 1,2-ethylene-monoterephthalate-mono(2-hydroxyethyterephthalate) (EMT) were unavailable through commercial routes (Sigma, Aldrich, Tokyo Chem. Ind., Wako, Nacalai). Therefore 3PET, TPA, BA and BHT were used as standard materials. The reaction with PET film (approximately 1 1 cm) was performed by the same conditions except that dimethylsulfoxide was deleted. An S-300N scanning electron microscope (Hitachi, Ltd., Tokyo, Japan) was used for the SEM analysis. Nucleotide sequence and protein accession number The nucleotide sequence of 2339 bp from est1 to the downstream of est119 was deposited in the GenBank under the accession number of AB445476.
RESULTS The genetic map of two polyesterase genes in T. alba AHK119 Both enzymes (without signal peptides) shared 95% sequence identity and 98% sequence similarity. The ORF of Est1 (260 amino acids corresponding to 783 bp including a stop codon) possessed the serine hydrolase sequence (G-H-S-M-G), in which Ser169, His247, and Asp215 were identified as the catalytic triad, as shown in Fig. 1 (Here we designated the position of amino acids in
VOL. 120, 2015
TANDEM POLYESTERASES FROM T. ALBA AHK119
493
FIG. 1. Multiple alignments among homologous cutinase-type polyesterases from Thermobifida genus. The amino acids in the catalytic triad (S169, D215 and H247) and T253P were shown in black arrows. The consensus lipase motif (GHSMG) was underlined. The conserved proline residues were shown in gray background. Est1, Est1 from T. alba AHK119 (BAI99230.2); Est119, Est119 from T. alba AHK119 (BAK48590.1); TfYX_Cut1, triacylglycerol lipase from T. fusca YX (YP 288944.1) (¼BTA-hydrolase 1 from T. fusca DSM 43797 (CAH17553.1)); TfYX_Cut2, triacylglycerol lipase (YP 288943.1) from T. fusca YX; Tc_Cut1, cutinase 1 from T. cellulosilytica (ADV92526.1); Tc_Cut2, cutinase 2 from T. cellulosilytica (ADV92527.1) (11).
Est1 by the same numbers as Est119 for convenience of comparison). The amide groups of Met166 (directly downstream of the nucleophilic Ser 169) and Tyr99 corresponded to the amide groups of Met132 and Phe63, respectively, in M11 lipase from
Streptomyces exfoliatus, which form an oxyanion hole (17). The PCR amplification of the intergenic region between the est1 and est119 showed that est1 was located upstream of est119 (Fig. 2A). The genetic map of two genes (est1 and est119) is shown in
FIG. 2. The gene structures of two polyesterase genes (est1 and est119) in T. alba AHK119. (A), The PCR amplification of the intergenic region between est1 and est119. (B), The map of est1 and est119 in T. alba AHK119. The est1 is located in the upstream of est119 with the distance of 506 bp. Terminators I and II of est1 and est119 contain inverted repeat sequences (horizontal arrows) and stop codons (an asterisk), respectively. IEstF1 and WR2 are the primers used for amplification of the intergenic region.
494
THUMARAT ET AL.
J. BIOSCI. BIOENG., TABLE 1. Comparison of specific activities of wild type and mutant Est119 and Est1. Enzymea
Specific activity of pNPBase at 37 C (U/mg) Ca2þ
Est119 Est119 (A68V/S216P) Est1 Est1 (A68V) Est1 (A68V/T253P) Est1 (A68V/T253P/M259K) a
2.30 115 3.88 132 277 303
0.02 3.5 0.03 4.2 11.0 13.1
þCa2þ (300 mM) 8.29 299 14.5 340 833 910
0.03 10.1 0.07 11.5 22.5 42.0
Purified recombinant enzymes were used.
60 min, but Est119 completely lost the activity in the absence of Ca2þ. In the presence of 300 mM Ca2þ, Est1 maintained 100% of the residual activity after incubation at 50 C for 20 h. The Est1 enzyme was not inhibited by final EDTA concentrations of 5 mM or 10 mM under the standard assay conditions without Ca2þ, which indicated that no metal ions (particularly Ca2þ) was required as a prosthetic group. FIG. 3. RT-PCR analysis of Est1 and the intergenic region between Est1 and Est119. M, DNA marker; lanes 1 and 2, RT-PCR analysis of Est1 with the cells of strain AHK119 grown on LB and LB supplemented with PBSA, respectively; lanes 3 and 4, RT-PCR analysis of the intergenic region with the cells of strain AHK119 grown on LB and LB supplemented with PBSA, respectively; lane 5, negative control; and lane 6, positive control.
Fig. 2B. The est1 gene was located upstream of est119 with the distance of 506 bp (no ORF was found in this region). Direct repeat sequences (CCGTTC and GAACGG before and after the stop codon at the end of est1 and CCCG and CGGG at the end of Est119) existed downstream of est1 and est119, respectively and a putative ribosome-binding site (RBS) (GAAGAGGAA) existed in the -7 upstream region of est119 (Fig. S1). Unfortunately the promoter region of est1 has not been sequenced yet, although we tried repeatedly using primers designed on two genes and their intergenic region. In addition, we tried to amplify the upstream region of est1, using the primers designed on the upstream region of a cutinase 1 gene of T. fusca YX (18), but failed. To confirm whether the production of Est1 is induced by polyester or not, we performed RT-PCR. T. alba AHK119 was cultured in LB medium supplemented with and without 0.1% PBSA suspension as an inducer. RT-PCR for the expression of est1 (Fig. 3, lanes 1 and 2) gave amplified products with the same size and approximately the same amount in the absence and presence of polyesters. Negative controls gave no detectable band, showing no detectable contamination of DNA in the RNA samples. The same result was obtained with Est119 (Fig. S2). Expression, purification and characterization of recombinant Est1 Recombinant Est1 was purified on a NiSepharose 6 Fast Flow column (GE Healthcare) under the same conditions as Est119 (11) (Fig. S3). The pNPB hydrolase activities and halo forming abilities on 0.1% polycaprolactone (PCL) plate of purified Est119 and Est1 were compared (Fig. S4). The haloforming activity on 0.1% PCL plate was parallel to pNPB hydrolyzing activity with both Est1 and Est119. The Est1 showed the approximately 2-fold (1.6e1.7) higher activity on PCL and pNPB, compared with Est119. The pNPB hydrolyzing activiy and PBSA degrading activity of Est1 and Est119 increased in parallel with the increased concentration of Ca2þ, as described previously (11). No difference in the CD spectra of Est1 was found with and without Ca2þ, showing that Ca2þ did not affect the secondary structure of Est1 (data not shown). The optimal pH and temperature of Est1 were found to be approximately 6.0 and 50 C, which were the same as Est119 (11). Est1 exhibited a higher activity than Est119 at higher temperature (60 C and 70 C) and displayed a residual activity of 70% after incubation at 50 C for
Mutational analysis of Est1 based on 3D modeling using an X-ray crystallography of Est119 Est1 had 95% identity and 98% similarity with Est119, the structure of which were determined by X-ray crystallography at 1.76 A (13). Based on the crystalline structure of Est119, a homology model of Est1 was constructed using Viewer Lite 5.0. The predicted Est1 structure displayed the compact tertiary fold that characterized a/b hydrolases (19) with nine stranded parallel beta-sheets at the core of the molecule flanked by eight alpha-helices on both sides that was identical to that of Est119 (Fig. S5). Different amino acids between Est1 and Est119 were mainly found in the loop region surrounding the catalytic triad. Alignment of homologous cutinases from genus Thermobifida indicated that proline at 219 existed in Est1 as well as most of Thermobifida cutinases, but Est119 had serine at this position, as shown in Fig. 1. Proline introduction at 219 in Est119 was requisite for acquisition of the increased thermostability (11). As introduction of valine at 68 was useful for enhancement of activity in Est119, we introduced valine at the same position in Est1, which resulted in the higher activity, compared with the wild type Est1 (Table 1). As shown in Fig. 1, proline was conserved at 253 in other cutinases than Est1 and Est119; proline was introduced at this position of Est1 that was located in the His247 loop. Est1 (A68V/T253P) showed an elevated activity (Table 1). The Tm value of Est1 (A68V) was 60 C without CaCl2 and 74 C with CaCl2 (Fig. S6A). The higher Tm value (79 C) was obtained with Est1 (A68V/T253P) (Fig. S6B). As lysine was conserved at 259 in other cutinases than Est1 and Est119 (Fig. 1), Met259 of Est1 (A68V) was replaced with lysine, but Est1 (A68V/ M259K) maintained the same Tm value as Est1 (A68V). Further mutation of Est1 (A68V/T253P/M256K) had an increased activity compared with Est1 (A68V/T253P), but maintained approximately the same Tm value as Est1 (A68V/T253P). Est1 (A68V/T253P) remained 100% of the residual activity in the presence of 300 mM Ca2þat 50e55 C for 1 h. The residual activity of Est1 (A68V/T253P) decreased to approximately 90% at 60 C for 1 h, but still approximately 70% of the activity was kept at 65 C for 0.5 h (Fig. 4). Est1 (A68V/T253P/M259K) had the lower thermostability than Est1 (A68V/T253P) over 50 C, although the pNPB hydrolysis activity at 37 C was higher than Est1 (A68V/ T253P) (Table 1) and the Tm value was approximately the same as Est1 (A68V/T253P). Taken together, Est1 (A68V/T253P) was the most thermostable enzyme with the improved activity among wild type and mutant enzymes of Est119 and Est1. Degradation of polyesters and a PET trimer model compound Est1 displayed the same degradation pattern as Est119 towards Ecoflex, PBSA, PBS, PCL, PDLA and PLLA in their agar
VOL. 120, 2015
TANDEM POLYESTERASES FROM T. ALBA AHK119
495
fragment of which agreed with those of authentic standard compounds. No peak corresponding to BHT (7.5 min) and other metabolites such as MHEB and EMT was detected at all. A peak appeared at 6.6 min suggested that it was most probably MHET (20) and its mass fragments supported the assumption (mass numbers of 209, 165 and 121 by the negative mode). When Est1 (A68V/T253P) and Est119 (A68V/S219P) were incubated with a PET film at 50 C for 3 h in the presence of 300 mM Ca2þ, neither weight loss nor visible surface change via SEM was found. Films were sunk in the incubation mixture with the mutant Est1 and Est119, whereas films in the control (no enzyme) were floating after the incubation. These results have suggested that the mutant Est1 and Est119 functionalized a hydrophobic film to a hydrophilic one by hydrolyzing surface ester bonds and liberating hydroxyl and carboxyl groups on the film surfaces. TPA was detected in the reaction mixtures of both enzymes by the LC-ITTOF-MS analysis. The control without the enzyme did not produce a detectable TPA peak. FIG. 4. Thermostabilities of Est1 (A68V/T253P) and Est1 (A68V/T253P/M259K). Appropriate amount of each mutant Est1 was incubated in 50 mM TriseHCl buffer (pH 7.0) and 300 mM CaCl2 at indicated temperatures for 1 h (50e60 C) and 30 min (65 C). The residual activities of the enzymes were measured using pNPB under the standard assay conditions. The residual activity of Est1 (A68V/T253P) is shown by filled bars and that of Est1 (A68V/T253P/M259K) is shown by open bars.
plates when incubated at 37 C overnight (11). The ability was PBSA > PBS, PCL > Ecoflex > PDLA >> PLLA. Only the slight activity on PLLA was detected after long incubation for more than 2 days. Ratio of activities of Est1 to Est119 was approximately two-fold. To confirm the recognition ability of Est1 toward aromatic polyesters, 3PET was chemically synthesized as a model compound for PET trimer. 3PET was incubated with Est1 (A68V/ T253P) at 50 C for 3 h and reaction products were analyzed by LC-IT-TOF-MS, as shown in Fig. 5. After incubation, 3PET (around at 4 min) was almost consumed and peaks corresponding to TPA and BA were detected at 6.2 min and 12.5 min, the mass
DISCUSSION As previously described, genus Thermobifida have tandem homologous cutinases-type enzymes through different species (11) suggesting that an ancestor gene was duplicated by chance and tandem genes were distributed widely in genus Thermobifida. However, no genetic structure of tandem genes have been elucidated except that the whole genome of T. fusca YX has been sequenced (18). The presence of a putative RBS in the upstream of est119 and the direct repeat sequences in the downstream of two genes predicted that two genes are independently expressed, which was supported by the fact that no PCR amplification of the intergenic region between est1 and est119 was found. RT-PCR suggested that both of the mature proteins are constitutively expressed. T. alba AHK119 must excrete two cutinases constantly, which may be beneficial to be ready to start degradation of either
FIG. 5. LC-IT-TOF-MS analysis of reaction products from 3PET.
496
THUMARAT ET AL.
cutin (natural and original substrate) or polyesters anytime when necessary. Two polyesterases in T. alba AHK119 showed the different activity and thermostability levels, as found in other Thermobifida tandem genes (10,21). In general, either one enzyme has far higher activity than another one and difference of thermostability is found between two enzymes. Comparison of amino acid sequences between Est1 and Est119 showed most of differences in amino acid sequences in loop regions especially of the Asp215-loop and the His247-loop, not in a-helices and b-sheets, as shown in Fig. S5. As the loop domains surrounding the catalytic triad is considered as a substrate-binding domain, differences in these domains may be relevant to the difference in activity and thermostability. Previously we suggested that Ca2þ is bound to the active site and the protein surface (11), but X-ray analysis of crystalline Est119 in the presence of Ca2þ displayed no Ca2þ in the catalytic site. Ca2þ was found on the protein surface (22). EDTA did not inhibit the enzyme activity of Est1 severely or completely, even if the concentration of EDTA was increased to 5 or 10 mM. Previously we suggested that Ca2þ was probably included as a prosthetic group from the result of atomic absorption analysis of Est119 incubated with Ca2þ (11). However, this has to be denied here, EDTA did not affect at all. As the 3D modeling of Est1 showed the same main structure as Est119, the active site must be the same as that of Est119. Our previous result on Est119 seemed to be erroneous, due to the incomplete removal of Ca2þ from the enzyme preparation incubated with a high concentration of Ca2þ. As CD spectra of Est1 with and without Ca2þ did not change, calcium ion does not affect the secondary structure of Est1. Elucidation on the mechanism that Ca2þ enhances activity and thermostability must await further studies. In general, thermostable proteins are reported to contain a high proportion of proline residues (23e27). Several studies reported that introduction of proline in the polypeptide chain decreases the flexibility and increases the structural rigidity (28,29). Furthermore, proline can make the hydrogen bond with the polar side chains of the residues in the turn and the hydrophobic chain of proline can interact with the adjacent hydrophobic cavity, so that the turn would have a more fixed tertiary structure (30). Thermostabilization of several proteins has been engineered by introduction of proline residues into surface loops, b-turns, the first turn of a-helixes and at the N-cap of a-helixes (31e34). Our previous result suggested that the introduction of proline at 219 in a catalytic triad loop (D215 loop) resulted in the enhanced activity and thermostability of Est119 (11). Proline already exists at 219 of Est1. The better thermostability of wild type Est1 must be due to proline at 219, instead of serine in Est119. Est1 (A68V) showed higher activity than Est119 (A68V/S219P), suggesting that any difference in loop regions are related to different activities. Next T253P mutation was selected to engineer thermostabilisation of Est1, because proline is conserved at this position of homologous enzymes except Est1 and Est119, as shown in Fig. 1. Est1 (A68V/T253P) showed the highest thermostability among wild type and mutant enzymes of Est1 and Est119, which must be due to three prolines in the catalytic triad loops (P219 in the D215 loop and P250 & P253 in the H247 loop) (Fig. 1), stabilizing the two loops. Est1, Est1 (A68V), and Est119 (A68V/S219P) have two prolines; Est119 and Est119 (A68V) have only one proline in the corresponding positions. Lower thermostability and higher activity of Est1 (A68V/M259K) and (A68V/ T253P/M259K) than Est1 (A68V) and (A68V/T253P), respectively, may be due to a new salt bridge formation by M259K. As Est1 can hydrolyze an ester bond between ethylene glycol and TPA in 3PET and hydrophilize the surface of PET film, this type of cutinases must recognize the aromatic polyester. However, higher thermostability is required for significant degradation of a PET film, because the glass transition temperature (Tg) value of PET is approximately 80 C and the thermostability above 65 C is
J. BIOSCI. BIOENG., necessary for the degradation of PET in an aqueous solution (35). Surface hydrophilization is one of potential targets for industrial application of cutinases. As Est1 (A68V/T253P) showed the high degradation ability toward various polyesters and the surface hydrophilization ability toward PET, the Est1 has a potential for polyester degradation, depolymerization of polyesters to monomers and surface hydrophilization of polyester products such as fibers and textiles. For further biochemical elucidation of Est1, X-ray crystallographic studies are necessary to compare it with Est119. In addition, further engineering of Est1 to obtain the mutant Est1 with the thermostability higher than 65 C is required for its industrial application. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.jbiosc.2015.03.006. ACKNOWLEDGMENTS We acknowledge Prof. Uwe Bornscheuer, Greifswald University, Germany and his group for their advice in mutation of Est1. The study was partially supported by a fund (2012) from the Institute for Fermentation, Osaka (Japan) to F. K. that does not restrict or influence the result of the research. LC-IT-TOF-MS was provided by Development and Assessment of Sustainable Humanosphere (DASH) system of RISH and CER, Kyoto University, as a collaborative program. This work is linked with the Asia Core Program supported by JSPS (Japan) and NRCT (Thailand). References 1. Shah, A. A., Kato, S., Shintani, N., Kamini, N. R., and Nakajima-Kambe, T.: Microbial degradation of aliphatic and aliphatic-aromatic co-polyesters, Appl. Microbiol. Biotechnol., 98, 3437e3447 (2014). 2. Kleeberg, I., Hetz, C., Kroppenstedt, R. M., Müller, R. J., and Deckwer, W. D.: Biodegradation of aliphatic-aromatic copolyester by Thermomonospora fusca and other thermophillic compost isolates, Appl. Environ. Microbiol., 64, 1731e1735 (1998). 3. Hu, X., Osaki, S., Hayashi, M., Kaku, M., Katuen, S., Kobayashi, H., and Kawai, F.: Degradation of a terephthalate-containing polyester by thermophilic actinomycetes and Bacillus species derived from composts, J. Polym. Environ., 16, 103e108 (2008). 4. Sinsereekul, N., Wangkam, T., Thamchaipenet, A., Srikhirin, T., Eurwilaichitr, L., and Champreda, V.: Recombinant expression of BTA hydrolase in Streptomyces rimosus and catalytic analysis on polyesters by surface plasmone resonance, Appl. Microbiol. Biotechnol., 86, 1775e1784 (2010). 5. Kleeberg, I., Welzel, K., VandenHeuvel, J., Müller, R. J., and Deckwer, W. D.: Characterization of a new extracellular hydrolase from Thermobifida fusca degrading aliphatic-aromatic copolyesters, Biomacromolecules, 6, 262e270 (2005). 6. Dresler, K., Heuvel, J., Müller, R. J., and Deckwer, W. D.: Production of a recombinant polyester-cleaving hydrolase from Thermobifida fusca in Escherichia coli, Bioprocess Biosyst. Eng., 29, 169e183 (2006). 7. Yang, Y., Malten, M., Grote, A., Jahn, D., and Deckwer, W. D.: Codon optimized Thermobifida fusca hydrolase secreted by Bacillus megaterium, Biotechnol. Bioeng., 96, 780e794 (2007). 8. Chen, S., Tong, X., Woodard, R. W., Du, G., Wu, J., and Chen, J.: Identification and characterization of bacterial cutinase, J. Biol. Chem., 283, 25854e25862 (2008). 9. Hu, X., Thumarat, U., Zhang, X., Tang, M., and Kawai, F.: Diversity of polyester-degrading bacteria in compost and molecular analysis of a thermoactive esterase from Thermobifida alba AHK119, Appl. Microbiol. Biotechnol., 87, 771e779 (2010). 10. Herrero-Acero, E., Ribitsch, D., Steinkellner, G., Gruber, K., Greimel, K., Eiteljoerg, I., Trotscha, E., Wei, R., Zimmermann, W., Zinn, M., and other 4 authors: Enzymatic surface hydrolysis of PET: effect of structural diversity on kinetic properties of cutinases from Thermobifida, Macromolecules, 44, 4632e4640 (2011). 11. Thumarat, U., Nakamura, R., Kawabata, T., Suzuki, H., and Kawai, F.: Biochemical and genetic analysis of a cutinase-type polyesterase from a thermophilic Thermobifida alba AHK119, Appl. Microbiol. Biotechnol., 95, 419e430 (2012). 12. Arpigny, J. L. and Jäger, K.: Bacterial lipolytic enzymes: classificationand properties, Biochem. J., 343, 177e183 (1999). 13. Kitadokoro, K., Thumarat, U., Nakamura, R., Nishimura, K., Karatani, H., Suzuki, H., and Kawai, F.: Crystal structure of cutinase Est119 from
VOL. 120, 2015
14. 15. 16. 17.
18.
19.
20.
21.
22.
23.
24.
Thermobifida alba AHK119 that can degrade modified polyethylene terephthalate at 1.76_Å resolution, Polym. Degrad. Stab., 97, 771e775 (2012). Chen, S., Chen, J., and Wu, J.: Cutinase: characteristics, preparation and application, Biotechnol. Adv., 31, 1754e1767 (2013). Sambrook, J. and Russell, D. W.: Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (2001). Laemmli, U. K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature, 227, 680e685 (1970). Wei, Y., Swenson, L., Castro, C., Derewenda, U., Minor, W., Arai, H., Aoki, J., Inoue, K., Servin-Gonzalez, L., and Derewenda, Z. S.: Structure of a microbial homologue of mammalian platelet-activating factor acetylhydrolases: Streptomyces exfoliatus lipase at 1.9 A resolution, Structure, 6, 511e519 (1988). Lykidis, A., Mavromatis, K., Ivanova, N., Anderson, I., Land, M., DiBartolo, G., Martinez, M., Lapidus, A., Lucas, S., Copeland, A., and other 3 authors: Genome sequence and analysis of the soil cellulolytic actinomycete Thermobifida fusca YX, J. Bacteriol., 189, 2477e2486 (2007). Ollis, D. L., Cheahm, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S. M., Harel, M., Remington, S. J., Silman, I., Schrag, J., and other three authors: The a/b hydrolase fold, Protein Eng., 5, 197e211 (1992). Vertommen, M. A. M. E., Nierstrasz, V. A., van der Veer, M., and Warmoeskerken, M. M. C. G.: Enzymatic surface modification of poly(ethylene terephthalate), J. Biotechnol., 120, 376e386 (2005). Chen, S., Su, L., Billig, S., Zimmermann, W., Chen, J., and Wu, J.: Biochemical characterization of the cutinases from Thermobifid fusca, J. Mol. Catal. B Enzym., 63, 121e127 (2010). Kawai, F., Thumarat, U., Kitadokoro, K., Waku, T., Tada, T., Tanaka, N., and Kawabata, T.: Comparison of polyester-degrading cutinases from genus Thermobifida, pp. 111e120, in: Chen, H. N., Gross, R. A., and Smith, P. B. (Eds.), Green polymer chemistry: Biocatalysis and materials II. American Chemical Society, Washington, DC (2013). Acharya, P., Rajakumara, E., Sankaranarayanan, R., and Rao, N. M.: Structural basis of selection and thermostability of laboratory evolved Bacillus subtilis lipase, J. Mol. Biol., 341, 1271e1281 (2004). Bustos-Jaimes, I., Mora-Lugo, R., Calcagno, M., and Farrés, A.: Kinetic studies of Gly28:Ser mutant form of Bacillus pumilus lipase: changes in kcat and thermal dependence, Biochim. Biophys. Acta, 1804, 2222e2227 (2010).
TANDEM POLYESTERASES FROM T. ALBA AHK119
497
25. Kumar, S., Tsai, C. J., and Nussinov, R.: Factors enhancing protein thermostability, Protein Eng., 13, 179e191 (2000). 26. Pack, S. P. and Yoo, Y. J.: Protein thermostability: structure-based difference of amino acid between thermophilic and mesophilic proteins, J. Biotechnol., 111, 269e277 (2004). 27. Sadeghi, M., Nader-Manesh, H., Zarrabi, M., and Ranjbar, B.: Effective factors in thermostability of thermophilic proteins, Biophys. Chem., 119, 256e270 (2006). 28. Xu, J., Baase, W. A., Baldwin, E., and Matthews, B. W.: The response of T4 lysozyme to large-to-small substitutions within the core and its relation to the hydrophobic effect, Protein Sci., 7, 158e177 (1998). 29. Van den Burg, B., Vriend, G., Veltman, O. R., Venema, G., and Eijsink, V. G.: Engineering an enzyme to resist boiling, Proc. Natl. Acad. Sci. USA, 95, 2056e2060 (1998). 30. Zhu, G. P., Xu, C., Teng, M. K., Tao, L. M., Zhu, X. Y., Wu, C. J., Hang, J., Niu, L. W., and Wang, Y. Z.: Increasing the thermostability of D-xylose isomerase by introduction of a proline into the turn of a random coil, Protein Eng., 12, 635e638 (1999). 31. Arnórsdóttir, J., Helgadóttir, S., Thorbjarnardóttir, S. H., Eggertsson, G., and Kristjánsson, M. M.: Effect of selected Ser/Ala and Xaa/Pro mutations on the stability and catalytic properties of a cold adapted subtilisin-like serine proteinase, Biochim. Biophys. Acta, 1774, 749e755 (2007). 32. Bogin, O., Peretz, M., Hacham, Y., Korkhin, Y., Frolow, F., Kalb(Gilboa), A. J., and Burstein, Y.: Enhanced thermal stability of Clostridium beijerinckii alcohol dehydrogenase after strategic substitution of amino acid residues with prolines from the homologous thermophilic Thermoanaerobacter brockii alcohol dehydrogenase, Protein Sci., 7, 1156e1163 (1998). 33. Muslin, E. H., Clark, S. E., and Henson, C. A.: The effect of proline insertions on the thermostability of a barley alpha-glucosidase, Protein Eng., 15, 29e33 (2002). 34. Sakaguchi, M., Matsuzaki, M., Niimiya, K., Seino, J., Sugahara, Y., and Kawakita, M.: Role of proline residues in conferring thermostability on aqualysin I, J. Biochem., 141, 213e220 (2007). 35. Zimmermann, W. and Billig, S.: Enzymes for the biofunctionalization of poly(ethylene terephthalate), Adv. Biochem. Eng. Biotechnol., 125, 97e120 (2010).
Comparison of genetic structures and biochemical properties of tandem cutinasetype polyesterases from Thermobifida alba AHK119 Uschara Thumarat,1 Takeshi Kawabata,2 Maho Nakajima,3 Hajime Nakajima,4 Akifumi Sugiyama,5 Kazufumi Yazaki,5 Tomoko Tada,6 Tomonori Waku,6 Naoki Tanaka,6 and Fusako Kawai4, * Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand,1 Institute for Protein Research, Osaka University, 32 Yamadaoka, Suita, Osaka 565-0871, Japan,2 Department of Materials and Life Science, Graduate School of Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan,3 Center for Fiber and Textile Science, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan,4 Laboratory of Plant Gene Expression, Research Institute for Sustainable Humanosphere, Kyoto University, Gokasho, Uji City, Kyoto Prefecture 611-0011, Japan,5 and Department of Biomolecular Engineering, Graduate School of Science and Technology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan6 Received 8 August 2014; accepted 5 March 2015 Available online 22 April 2015
This study described the genetic map of tandem genes (est1 and est119) encoding cutinase-type polyesterases in Thermobifida alba AHK119 and comparison of wild type and mutant enzymes of Est1 and Est119. Two genes were independently and constitutively expressed. The activity of Est1 was higher by approximately 1.6e1.7-fold than that of Est119 towards p-nitrophenyl butyrate, although both enzymes shared 95% sequence identity and 98% similarity and possessed similar 3D structures except that several amino acids in the probable substrate-docking loops were different from each other. Calcium ion enhanced the activity and the thermostability of both enzymes. Based on conserved sequences among Thermobifida cutinases, valine, proline and lysine were introduced into Est1 at Ala68, Thr253 and Met256, respectively. Among wild and mutant enzymes of Est119 and Est1, Est1 (A68V/T253P) possessed three prolines in the substrate-docking loops and displayed the highest thermostability that spotlighted the important effect of proline numbers in the loops. Est1 (A68V/T253P) was stable for 1 h below 60 C and even at 65 C, more than 70% and 50% activities were maintained after 30 and 60 min, respectively. Est1 (A68V/T253P) degraded various aliphatic and aliphaticco-aromatic polyesters and hydrophilized an amorphous PET film. The enzyme hydrolyzed a PET trimer model compound, indicating its specificity towards an ester bond between terephthalic acid and ethylene glycol. Ó 2015, The Society for Biotechnology, Japan. All rights reserved. [Key words: Thermobifida alba AHK119; Cutinase-type polyesterase; Ca-activated cutinase; Thermostable cutinase; Tandem genes regulation; PET surface hydrolysis]
Plastic materials are indispensable products in modern life and are used in various areas from industries to homes. Conventional plastics have excellent physical properties for many applications, but they have low biodegradability in general and their waste is an increasing threat to our planet (1). Therefore, replacement of conventional plastics with biodegradable plastics is a potential way to reduce solid waste since they can be recycled through microorganisms. Most of biodegradable plastics (mostly aliphatic polyesters) have undesired material properties such as low tensile strength and low melting point. Aromatic polyesters (polyethylene terephthalate (PET) is the representative and typical one) that have excellent physical properties are practically non-biodegradable. Aliphatic-aromatic-co-polyesters were designed to combine the robust material properties and excellent biodegradability. The thermophiles Thermobifida fusca and Thermobifida alba have been isolated from composts and are potent degraders of various polyesters including aliphatic, aliphatic-co-aromatic and aromatic polyesters, although the degradation levels are different with
* Corresponding author. Tel./fax: þ81 75 724 7693. E-mail address: [email protected] (F. Kawai).
regards to the composition of polyesters and strains (2e4). The genes for polyester-hydrolyzing enzymes from T. fusca, T. alba and Thermobifida cellulosilytica have been cloned and determined to encode serine hydrolases (5e11) that belong to the lipase/esterase family (12). The genus Thermobifida possesses two tandem cutinase genes in general (11). T. alba AHK119 possessed est1 and est119 genes, between which est119 was expressed and mutated for characterization (11). Est119 was analyzed by X-ray crystallography as the first crystalline structure of a bacterial cutinase that has the polyester-degrading ability (13). These polyesterases can be used not only for the enzymatic recycling of polyesters to monomers, but also for enzymatic modification of polyester products, for example fibers for textiles, which makes better touch of textiles and improves dyeing of textiles (14). Here we report the genetic map of two cutinase genes (est1 and est119) from T. alba AHK119, which has not been reported thus far through genus Thermobifida. The two cutinases showed different activities and thermostabilities, although they share 95% identity and 98% similarity, resulting in the same topology. Based on 3D structural modeling and conserved sequences among Thermobifida cutinases, mutagenesis of Est1 was carried out and activities of wild and mutant Est1 and Est119 were compared.
1389-1723/$ e see front matter Ó 2015, The Society for Biotechnology, Japan. All rights reserved. http://dx.doi.org/10.1016/j.jbiosc.2015.03.006
492
THUMARAT ET AL. MATERIALS AND METHODS
Chemicals Polyesters used in this paper are the same as those described in the previous paper (11). PET film (amorphous, thickness of 0.25 mm) is a product of Goodfellow Cambridge Ltd. (Huntington, UK). Bis(2-hydroxyethyl) terephthalate is a product of Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). Bis(benozyloxyethyl)terephthalate (3PET) was synthesized as follows. Bis(2hydroxyethyl)terephthalate (1.00 g, 0.004 mol) and pyridine (1.26 g, 0.016 mol) as hydrogen acceptor were dissolved in anhydrous 1,4-dioxane (100 ml). The solution was kept at 0 C in ice bath for 3 h with stirring, and a solution of benzoyl chloride (2.26 g, 0.016 mol) in anhydrous 1,4-dioxane (100 ml) was added to it dropwise at 0 C for a period of 30 min. After the addition, the reaction mixture was stirred at room temperature for 12 h. Then, the solvent was removed by evaporation on a rotary evaporator to obtain solid precipitates. The solid precipitates were recrystallized three times from 1,4dioxane/methanol mixtures to finally give 0.5 g of 3PET. The chemical structure of 3PET was confirmed by 1H NMR: d 4.68 (s, CH2. 4H), d 7.43 (m, C6H2. 2H), d 7.57 (m, C6H1. 1H), d 8.05 (m, C6H2. 2H), d 8.11 (m, C6H2. 2H). 1H NMR spectra (300 MHz) were measured on an AV-300 spectrometer (Bruker Biospin GmbH, Rheinstetten, Germany) in CDCl3 containing 0.03 vol. % tetramethylsilane as the internal standard. All other chemicals were of the highest grade available through commercial routes. Bacterial strains and cultivation T. alba strain AHK119 was used throughout this research (3). Strain AHK119 was cultivated in Luria-Bertani medium (LB) at 50 C under shaking for 3 days. For the routine cloning, Escherichia coli DH5a and E. coli Rosetta-gami B (DE3) were used as hosts. Sequencing of est1 and the intergenic region between est1 and est119 Total DNA from T. alba AHK119 was extracted using a Gentra Puregene Yeast/Bacteria Kit (Qiagen K. K., Tokyo, Japan). The DNA purification, transformation, and electrophoresis were performed following the protocols of Sambrook and Russell (15). The restriction enzymes and other DNA-modifying enzymes were purchased from Toyobo (Osaka, Japan) or Takara Bio, Inc. (Ohtsu, Shiga, Japan) and were used as specified by the manufacturers. The KOD DNA polymerase was used for PCR according to the manufacturer’s instructions (Toyobo). Est119-1Fw-2 (50 ATGTCGGTCACCACCCCCCGCCGGGAGA 30 ) and WR1 (50 TGAACGGGGACGCTCAGCAG 30 ) were used to amplify est1 that is most probably identical to est119. PCR mixtures (25 ml) contained 1 mg total DNA, 0.3 pmol/ml of each primer, 1 mM MgCl2, 0.2 mM of each deoxynucleotide, 1 KOD DNA polymerase buffer, 4% (v/v) dimethylsulfoxide (DMSO) and 0.5 U of KOD DNA polymerase. The amplified fragment was purified and ligated into the pGEM-T easy vector (Promega, Madison, WI, USA). The plasmid (pGEM-est1) was transformed into E. coli DH5a for conventional blue-white selection. Plasmids of white colonies were extracted and both strands of each plasmid were sequenced by SolGent Co. (Daejeon, Korea). Sequence assembly and analysis was performed with GENETYX software version 5.1 (Genetyx Corp., Tokyo, Japan). The primers IEstF1 (50 TGAACAACGCCACCCACTTC 30 ) and WR2 (50 CTTCTCCGTCAGCGAGGAGC 30 ) were used to amplify the intergenic region between the est1 and est119 genes. The sequence encoding the probable mature Est1 protein (260 amino acids without the signal peptide) was amplified using H1F-BamH1 (50 CGCGGATCCAACCCCTACGAACGCGGC 30 ) and H1R-HindIII (50 GCGAAGCTTGAACGGGCAGGTGGAGCGGT 30 ) primers (the BamHI and HindIII restriction sites are underlined, respectively), digested with BamHI and HindIII, purified and ligated into the BamH1 and HindIII sites of the pQE80L (Qiagen K. K., Japan) to clone the Est1 as a 6 His-tagged fusion protein. The plasmid (pQE80Lest1) was transformed into E. coli Rosetta-gami B (DE3) using the heat-shock method (15). Reverse transcriptional PCR (RT-PCR) T. alba AHK119 was grown at 50 C for 3 days on LB or LB containing 0.1% poly(butylene succinate-co-apipate) (PBSA) suspension. Total RNA was isolated using a high-purity RNA isolation kit (Roche Diagnostics Japan, Tokyo), and the RNA samples were treated with DNase I (Invitrogen Corp., Carlsbad, CA, USA). RT-PCR was performed with the first strand using a cDNA synthesis kit (Roche), and PCR amplification of the second strand of DNA was performed using KOD plus DNA polymerase. Negative control experiments were performed by omitting the reverse transcription step. Positive control experiments were performed with genomic DNA as a template. The primers used for PCR were designed based on the est119 and est1 sequences. The primers: F2EcoRI (50 GAATTCGCTCCGGCCCAGGCCGCCAA 30 ) and R2HindIII (50 AAGCTTGAACGGGCAGGTGGAGCGGT 30 ) were used to amplify est119 and the primers: H1F-BamHI (50 CGCGGATCCAACCCCTACGAACGCGGC 30 ) and H1R-HindIII (50 GCGAAGCTTGAACGGGCAGGTGGAGCGGT 30 ) were used to amplify est1. The RTPCR product of the intergenic region between est1 and est119 was amplified using primers IEstF1 (50 TGAACAACGCCACCCACTTC 30 ) and WR2 (50 CTTCTCCGTCAGCGAGGAGC 30 ). Enzyme expression, purification and activity assay E. coli Rosetta-gami B (DE3) harboring the pQE80L-est1 plasmid was cultivated to express the recombinant Est1 and IPTG-induced Est1 was purified, as described previously (9). The purity of the enzyme was confirmed by SDS-PAGE (16), and the protein concentration was measured with a Bio-Rad protein assay kit (Bio-Rad Laboratories, Hercules, CA, USA), using bovine serum albumin as a standard. The
J. BIOSCI. BIOENG., molecular mass was determined by SDS-PAGE (16) and gel filtration on a Superdex 200 column (GE Healthcare, Uppsala, Sweden). The enzymatic activity was measured spectrophotometrically using p-nitrophenyl butyrate (pNPB) as a model substrate. Biefly, 50 ml of enzyme solution (approximately 0.001e0.003 mg/ml) was mixed with 930 ml of 50 mM TriseHCl buffer (pH 7.0). The reaction was started by addition of 20 ml of substrate solution (50 mM pNPB dissolved in isopropanol and stored at 20 C until use) at 37 C. Absorbance at 346 nm was recorded over 1 min with respect to a substrate solution without enzyme. One enzyme unit (U) was defined as the amount of enzyme liberating 1 mmole of p-nitrophenol per minute under the assay conditions (the molar extinction coefficient ε ¼ 5.48 mmol1 cm1). Unless specified, pNPBase activity was measured for characterization of the enzyme. The activity of purified Est1 on polyesters was confirmed by halo formation on LB agar plates containing 0.1% each polyester, as described previously (9). The activities were compared with the same amount of the enzyme (approximately 5e10 mg). The activity was also measured at 37 C for 1 h by the decrease of turbidity of PBSA suspension (Bionolle EM-301; final concentration of 0.05% in TriseHCl buffer (pH 7.0), which shows approximately 0.5 of absorbance at 610 nm) (11). The amount of the enzyme used was approximately 0.010e0.020 mg/ml. All the assays were performed in duplicate. Measurement of circular dichroism and differential scanning calorimetry Circular dichroism (CD) measurements were carried out with a Jasco spectropolarimeter model J-720 (Tokyo, Japan) at 25 C, using an optical cell with a path length 0.02 cm. Sample solutions were prepared in 50 mM MES or Tris (pH 7.0). Melting temperature (Tm) was measured with nano-differential scanning calorimeter [model 6100 NanoII differential scanning calorimetry (DSC), Calorimetry Sciences Co. Ltd., USA]. Tm values were measured with and without 50 mM CaCl2, as preliminary experiments indicated that the maximal value was obtained at 50 mM CaCl2. Samples were deaerated in vacuo for 15 min prior to measurements. DSC measurements were carried out under pressure of 3 atm to avoid bubbling of samples and at a heating rate of 1 C/min. Homology modeling of Est1 A 3D structure of Est1 from T. alba AHK119 was modeled with a Viewer Lite 5.0 software, based on Est119 (accession code 3VIS in Protein Data Base) from T. alba AHK119 (13). Site-directed mutagenesis Site-directed mutagenesis was performed to introduce a specific mutation using a KOD plus Mutagenesis Kit (Toyobo) according to the manufacturer’s instructions. PCR products were obtained with pQE80L-est1 as a DNA template using the site-directed mutagenesis specific primers. The parental pQE80L-est1 plasmid was removed by digesting with DpnI and PCR products were transformed directly to E. coli Rosetta-gami B (DE3) cells. The DNA sequences of the plasmids were analyzed by SolGent Co. Enzymatic reaction of Est1 with 3PET and PET and product analysis by hybrid ion trap/time-of-flight mass spectrometry coupled with liquid chromatography (LC-IT-TOF-MS) The reaction mixture (2 ml) contained 3PET(2 mg/ml), 20% dimethylsulfoxide, 100 mM TriseHCl buffer (pH 7.0), 300 mM CaCl2 and approximately 20 mM Est1 (A68V/T253P) was incubated at 50 C for 3 h with shaking. The reaction mixture was extracted with ethyl acetate three times, which was evaporated in vacuo and dehydrated with Na2SO4. The reaction products were filtered through Minisart RC4 0.20 mm filters (Sartorius, Goettingen, Germany). The filtrate was injected into a LC-IT-TOF-MS apparatus (Shimadzu, Kyoto, Japan): column TSKgel ODS-80Ts column 2.0 250 mm (Tosoh Corp., Tokyo, Japan); solvent, acetonitrile: water: formic acid (20:80:0.3); flow rate, 0.15 ml/min; detection, 252 and 280 nm. Standard materials were solved in ethyl acetate, filtered and subjected to the analysis. Terephthalic acid (TPA), benzoic acid (BA) and bis(2-hydroxyethoxy)terephthalate (BHT) were commercially available, but mono(2-hydroxyethoxy)terephthalate (MHET), mono(2-hydroxyethoxy)benzoate (MHEB) and 1,2-ethylene-monoterephthalate-mono(2-hydroxyethyterephthalate) (EMT) were unavailable through commercial routes (Sigma, Aldrich, Tokyo Chem. Ind., Wako, Nacalai). Therefore 3PET, TPA, BA and BHT were used as standard materials. The reaction with PET film (approximately 1 1 cm) was performed by the same conditions except that dimethylsulfoxide was deleted. An S-300N scanning electron microscope (Hitachi, Ltd., Tokyo, Japan) was used for the SEM analysis. Nucleotide sequence and protein accession number The nucleotide sequence of 2339 bp from est1 to the downstream of est119 was deposited in the GenBank under the accession number of AB445476.
RESULTS The genetic map of two polyesterase genes in T. alba AHK119 Both enzymes (without signal peptides) shared 95% sequence identity and 98% sequence similarity. The ORF of Est1 (260 amino acids corresponding to 783 bp including a stop codon) possessed the serine hydrolase sequence (G-H-S-M-G), in which Ser169, His247, and Asp215 were identified as the catalytic triad, as shown in Fig. 1 (Here we designated the position of amino acids in
VOL. 120, 2015
TANDEM POLYESTERASES FROM T. ALBA AHK119
493
FIG. 1. Multiple alignments among homologous cutinase-type polyesterases from Thermobifida genus. The amino acids in the catalytic triad (S169, D215 and H247) and T253P were shown in black arrows. The consensus lipase motif (GHSMG) was underlined. The conserved proline residues were shown in gray background. Est1, Est1 from T. alba AHK119 (BAI99230.2); Est119, Est119 from T. alba AHK119 (BAK48590.1); TfYX_Cut1, triacylglycerol lipase from T. fusca YX (YP 288944.1) (¼BTA-hydrolase 1 from T. fusca DSM 43797 (CAH17553.1)); TfYX_Cut2, triacylglycerol lipase (YP 288943.1) from T. fusca YX; Tc_Cut1, cutinase 1 from T. cellulosilytica (ADV92526.1); Tc_Cut2, cutinase 2 from T. cellulosilytica (ADV92527.1) (11).
Est1 by the same numbers as Est119 for convenience of comparison). The amide groups of Met166 (directly downstream of the nucleophilic Ser 169) and Tyr99 corresponded to the amide groups of Met132 and Phe63, respectively, in M11 lipase from
Streptomyces exfoliatus, which form an oxyanion hole (17). The PCR amplification of the intergenic region between the est1 and est119 showed that est1 was located upstream of est119 (Fig. 2A). The genetic map of two genes (est1 and est119) is shown in
FIG. 2. The gene structures of two polyesterase genes (est1 and est119) in T. alba AHK119. (A), The PCR amplification of the intergenic region between est1 and est119. (B), The map of est1 and est119 in T. alba AHK119. The est1 is located in the upstream of est119 with the distance of 506 bp. Terminators I and II of est1 and est119 contain inverted repeat sequences (horizontal arrows) and stop codons (an asterisk), respectively. IEstF1 and WR2 are the primers used for amplification of the intergenic region.
494
THUMARAT ET AL.
J. BIOSCI. BIOENG., TABLE 1. Comparison of specific activities of wild type and mutant Est119 and Est1. Enzymea
Specific activity of pNPBase at 37 C (U/mg) Ca2þ
Est119 Est119 (A68V/S216P) Est1 Est1 (A68V) Est1 (A68V/T253P) Est1 (A68V/T253P/M259K) a
2.30 115 3.88 132 277 303
0.02 3.5 0.03 4.2 11.0 13.1
þCa2þ (300 mM) 8.29 299 14.5 340 833 910
0.03 10.1 0.07 11.5 22.5 42.0
Purified recombinant enzymes were used.
60 min, but Est119 completely lost the activity in the absence of Ca2þ. In the presence of 300 mM Ca2þ, Est1 maintained 100% of the residual activity after incubation at 50 C for 20 h. The Est1 enzyme was not inhibited by final EDTA concentrations of 5 mM or 10 mM under the standard assay conditions without Ca2þ, which indicated that no metal ions (particularly Ca2þ) was required as a prosthetic group. FIG. 3. RT-PCR analysis of Est1 and the intergenic region between Est1 and Est119. M, DNA marker; lanes 1 and 2, RT-PCR analysis of Est1 with the cells of strain AHK119 grown on LB and LB supplemented with PBSA, respectively; lanes 3 and 4, RT-PCR analysis of the intergenic region with the cells of strain AHK119 grown on LB and LB supplemented with PBSA, respectively; lane 5, negative control; and lane 6, positive control.
Fig. 2B. The est1 gene was located upstream of est119 with the distance of 506 bp (no ORF was found in this region). Direct repeat sequences (CCGTTC and GAACGG before and after the stop codon at the end of est1 and CCCG and CGGG at the end of Est119) existed downstream of est1 and est119, respectively and a putative ribosome-binding site (RBS) (GAAGAGGAA) existed in the -7 upstream region of est119 (Fig. S1). Unfortunately the promoter region of est1 has not been sequenced yet, although we tried repeatedly using primers designed on two genes and their intergenic region. In addition, we tried to amplify the upstream region of est1, using the primers designed on the upstream region of a cutinase 1 gene of T. fusca YX (18), but failed. To confirm whether the production of Est1 is induced by polyester or not, we performed RT-PCR. T. alba AHK119 was cultured in LB medium supplemented with and without 0.1% PBSA suspension as an inducer. RT-PCR for the expression of est1 (Fig. 3, lanes 1 and 2) gave amplified products with the same size and approximately the same amount in the absence and presence of polyesters. Negative controls gave no detectable band, showing no detectable contamination of DNA in the RNA samples. The same result was obtained with Est119 (Fig. S2). Expression, purification and characterization of recombinant Est1 Recombinant Est1 was purified on a NiSepharose 6 Fast Flow column (GE Healthcare) under the same conditions as Est119 (11) (Fig. S3). The pNPB hydrolase activities and halo forming abilities on 0.1% polycaprolactone (PCL) plate of purified Est119 and Est1 were compared (Fig. S4). The haloforming activity on 0.1% PCL plate was parallel to pNPB hydrolyzing activity with both Est1 and Est119. The Est1 showed the approximately 2-fold (1.6e1.7) higher activity on PCL and pNPB, compared with Est119. The pNPB hydrolyzing activiy and PBSA degrading activity of Est1 and Est119 increased in parallel with the increased concentration of Ca2þ, as described previously (11). No difference in the CD spectra of Est1 was found with and without Ca2þ, showing that Ca2þ did not affect the secondary structure of Est1 (data not shown). The optimal pH and temperature of Est1 were found to be approximately 6.0 and 50 C, which were the same as Est119 (11). Est1 exhibited a higher activity than Est119 at higher temperature (60 C and 70 C) and displayed a residual activity of 70% after incubation at 50 C for
Mutational analysis of Est1 based on 3D modeling using an X-ray crystallography of Est119 Est1 had 95% identity and 98% similarity with Est119, the structure of which were determined by X-ray crystallography at 1.76 A (13). Based on the crystalline structure of Est119, a homology model of Est1 was constructed using Viewer Lite 5.0. The predicted Est1 structure displayed the compact tertiary fold that characterized a/b hydrolases (19) with nine stranded parallel beta-sheets at the core of the molecule flanked by eight alpha-helices on both sides that was identical to that of Est119 (Fig. S5). Different amino acids between Est1 and Est119 were mainly found in the loop region surrounding the catalytic triad. Alignment of homologous cutinases from genus Thermobifida indicated that proline at 219 existed in Est1 as well as most of Thermobifida cutinases, but Est119 had serine at this position, as shown in Fig. 1. Proline introduction at 219 in Est119 was requisite for acquisition of the increased thermostability (11). As introduction of valine at 68 was useful for enhancement of activity in Est119, we introduced valine at the same position in Est1, which resulted in the higher activity, compared with the wild type Est1 (Table 1). As shown in Fig. 1, proline was conserved at 253 in other cutinases than Est1 and Est119; proline was introduced at this position of Est1 that was located in the His247 loop. Est1 (A68V/T253P) showed an elevated activity (Table 1). The Tm value of Est1 (A68V) was 60 C without CaCl2 and 74 C with CaCl2 (Fig. S6A). The higher Tm value (79 C) was obtained with Est1 (A68V/T253P) (Fig. S6B). As lysine was conserved at 259 in other cutinases than Est1 and Est119 (Fig. 1), Met259 of Est1 (A68V) was replaced with lysine, but Est1 (A68V/ M259K) maintained the same Tm value as Est1 (A68V). Further mutation of Est1 (A68V/T253P/M256K) had an increased activity compared with Est1 (A68V/T253P), but maintained approximately the same Tm value as Est1 (A68V/T253P). Est1 (A68V/T253P) remained 100% of the residual activity in the presence of 300 mM Ca2þat 50e55 C for 1 h. The residual activity of Est1 (A68V/T253P) decreased to approximately 90% at 60 C for 1 h, but still approximately 70% of the activity was kept at 65 C for 0.5 h (Fig. 4). Est1 (A68V/T253P/M259K) had the lower thermostability than Est1 (A68V/T253P) over 50 C, although the pNPB hydrolysis activity at 37 C was higher than Est1 (A68V/ T253P) (Table 1) and the Tm value was approximately the same as Est1 (A68V/T253P). Taken together, Est1 (A68V/T253P) was the most thermostable enzyme with the improved activity among wild type and mutant enzymes of Est119 and Est1. Degradation of polyesters and a PET trimer model compound Est1 displayed the same degradation pattern as Est119 towards Ecoflex, PBSA, PBS, PCL, PDLA and PLLA in their agar
VOL. 120, 2015
TANDEM POLYESTERASES FROM T. ALBA AHK119
495
fragment of which agreed with those of authentic standard compounds. No peak corresponding to BHT (7.5 min) and other metabolites such as MHEB and EMT was detected at all. A peak appeared at 6.6 min suggested that it was most probably MHET (20) and its mass fragments supported the assumption (mass numbers of 209, 165 and 121 by the negative mode). When Est1 (A68V/T253P) and Est119 (A68V/S219P) were incubated with a PET film at 50 C for 3 h in the presence of 300 mM Ca2þ, neither weight loss nor visible surface change via SEM was found. Films were sunk in the incubation mixture with the mutant Est1 and Est119, whereas films in the control (no enzyme) were floating after the incubation. These results have suggested that the mutant Est1 and Est119 functionalized a hydrophobic film to a hydrophilic one by hydrolyzing surface ester bonds and liberating hydroxyl and carboxyl groups on the film surfaces. TPA was detected in the reaction mixtures of both enzymes by the LC-ITTOF-MS analysis. The control without the enzyme did not produce a detectable TPA peak. FIG. 4. Thermostabilities of Est1 (A68V/T253P) and Est1 (A68V/T253P/M259K). Appropriate amount of each mutant Est1 was incubated in 50 mM TriseHCl buffer (pH 7.0) and 300 mM CaCl2 at indicated temperatures for 1 h (50e60 C) and 30 min (65 C). The residual activities of the enzymes were measured using pNPB under the standard assay conditions. The residual activity of Est1 (A68V/T253P) is shown by filled bars and that of Est1 (A68V/T253P/M259K) is shown by open bars.
plates when incubated at 37 C overnight (11). The ability was PBSA > PBS, PCL > Ecoflex > PDLA >> PLLA. Only the slight activity on PLLA was detected after long incubation for more than 2 days. Ratio of activities of Est1 to Est119 was approximately two-fold. To confirm the recognition ability of Est1 toward aromatic polyesters, 3PET was chemically synthesized as a model compound for PET trimer. 3PET was incubated with Est1 (A68V/ T253P) at 50 C for 3 h and reaction products were analyzed by LC-IT-TOF-MS, as shown in Fig. 5. After incubation, 3PET (around at 4 min) was almost consumed and peaks corresponding to TPA and BA were detected at 6.2 min and 12.5 min, the mass
DISCUSSION As previously described, genus Thermobifida have tandem homologous cutinases-type enzymes through different species (11) suggesting that an ancestor gene was duplicated by chance and tandem genes were distributed widely in genus Thermobifida. However, no genetic structure of tandem genes have been elucidated except that the whole genome of T. fusca YX has been sequenced (18). The presence of a putative RBS in the upstream of est119 and the direct repeat sequences in the downstream of two genes predicted that two genes are independently expressed, which was supported by the fact that no PCR amplification of the intergenic region between est1 and est119 was found. RT-PCR suggested that both of the mature proteins are constitutively expressed. T. alba AHK119 must excrete two cutinases constantly, which may be beneficial to be ready to start degradation of either
FIG. 5. LC-IT-TOF-MS analysis of reaction products from 3PET.
496
THUMARAT ET AL.
cutin (natural and original substrate) or polyesters anytime when necessary. Two polyesterases in T. alba AHK119 showed the different activity and thermostability levels, as found in other Thermobifida tandem genes (10,21). In general, either one enzyme has far higher activity than another one and difference of thermostability is found between two enzymes. Comparison of amino acid sequences between Est1 and Est119 showed most of differences in amino acid sequences in loop regions especially of the Asp215-loop and the His247-loop, not in a-helices and b-sheets, as shown in Fig. S5. As the loop domains surrounding the catalytic triad is considered as a substrate-binding domain, differences in these domains may be relevant to the difference in activity and thermostability. Previously we suggested that Ca2þ is bound to the active site and the protein surface (11), but X-ray analysis of crystalline Est119 in the presence of Ca2þ displayed no Ca2þ in the catalytic site. Ca2þ was found on the protein surface (22). EDTA did not inhibit the enzyme activity of Est1 severely or completely, even if the concentration of EDTA was increased to 5 or 10 mM. Previously we suggested that Ca2þ was probably included as a prosthetic group from the result of atomic absorption analysis of Est119 incubated with Ca2þ (11). However, this has to be denied here, EDTA did not affect at all. As the 3D modeling of Est1 showed the same main structure as Est119, the active site must be the same as that of Est119. Our previous result on Est119 seemed to be erroneous, due to the incomplete removal of Ca2þ from the enzyme preparation incubated with a high concentration of Ca2þ. As CD spectra of Est1 with and without Ca2þ did not change, calcium ion does not affect the secondary structure of Est1. Elucidation on the mechanism that Ca2þ enhances activity and thermostability must await further studies. In general, thermostable proteins are reported to contain a high proportion of proline residues (23e27). Several studies reported that introduction of proline in the polypeptide chain decreases the flexibility and increases the structural rigidity (28,29). Furthermore, proline can make the hydrogen bond with the polar side chains of the residues in the turn and the hydrophobic chain of proline can interact with the adjacent hydrophobic cavity, so that the turn would have a more fixed tertiary structure (30). Thermostabilization of several proteins has been engineered by introduction of proline residues into surface loops, b-turns, the first turn of a-helixes and at the N-cap of a-helixes (31e34). Our previous result suggested that the introduction of proline at 219 in a catalytic triad loop (D215 loop) resulted in the enhanced activity and thermostability of Est119 (11). Proline already exists at 219 of Est1. The better thermostability of wild type Est1 must be due to proline at 219, instead of serine in Est119. Est1 (A68V) showed higher activity than Est119 (A68V/S219P), suggesting that any difference in loop regions are related to different activities. Next T253P mutation was selected to engineer thermostabilisation of Est1, because proline is conserved at this position of homologous enzymes except Est1 and Est119, as shown in Fig. 1. Est1 (A68V/T253P) showed the highest thermostability among wild type and mutant enzymes of Est1 and Est119, which must be due to three prolines in the catalytic triad loops (P219 in the D215 loop and P250 & P253 in the H247 loop) (Fig. 1), stabilizing the two loops. Est1, Est1 (A68V), and Est119 (A68V/S219P) have two prolines; Est119 and Est119 (A68V) have only one proline in the corresponding positions. Lower thermostability and higher activity of Est1 (A68V/M259K) and (A68V/ T253P/M259K) than Est1 (A68V) and (A68V/T253P), respectively, may be due to a new salt bridge formation by M259K. As Est1 can hydrolyze an ester bond between ethylene glycol and TPA in 3PET and hydrophilize the surface of PET film, this type of cutinases must recognize the aromatic polyester. However, higher thermostability is required for significant degradation of a PET film, because the glass transition temperature (Tg) value of PET is approximately 80 C and the thermostability above 65 C is
J. BIOSCI. BIOENG., necessary for the degradation of PET in an aqueous solution (35). Surface hydrophilization is one of potential targets for industrial application of cutinases. As Est1 (A68V/T253P) showed the high degradation ability toward various polyesters and the surface hydrophilization ability toward PET, the Est1 has a potential for polyester degradation, depolymerization of polyesters to monomers and surface hydrophilization of polyester products such as fibers and textiles. For further biochemical elucidation of Est1, X-ray crystallographic studies are necessary to compare it with Est119. In addition, further engineering of Est1 to obtain the mutant Est1 with the thermostability higher than 65 C is required for its industrial application. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.jbiosc.2015.03.006. ACKNOWLEDGMENTS We acknowledge Prof. Uwe Bornscheuer, Greifswald University, Germany and his group for their advice in mutation of Est1. The study was partially supported by a fund (2012) from the Institute for Fermentation, Osaka (Japan) to F. K. that does not restrict or influence the result of the research. LC-IT-TOF-MS was provided by Development and Assessment of Sustainable Humanosphere (DASH) system of RISH and CER, Kyoto University, as a collaborative program. This work is linked with the Asia Core Program supported by JSPS (Japan) and NRCT (Thailand). References 1. Shah, A. A., Kato, S., Shintani, N., Kamini, N. R., and Nakajima-Kambe, T.: Microbial degradation of aliphatic and aliphatic-aromatic co-polyesters, Appl. Microbiol. Biotechnol., 98, 3437e3447 (2014). 2. Kleeberg, I., Hetz, C., Kroppenstedt, R. M., Müller, R. J., and Deckwer, W. D.: Biodegradation of aliphatic-aromatic copolyester by Thermomonospora fusca and other thermophillic compost isolates, Appl. Environ. Microbiol., 64, 1731e1735 (1998). 3. Hu, X., Osaki, S., Hayashi, M., Kaku, M., Katuen, S., Kobayashi, H., and Kawai, F.: Degradation of a terephthalate-containing polyester by thermophilic actinomycetes and Bacillus species derived from composts, J. Polym. Environ., 16, 103e108 (2008). 4. Sinsereekul, N., Wangkam, T., Thamchaipenet, A., Srikhirin, T., Eurwilaichitr, L., and Champreda, V.: Recombinant expression of BTA hydrolase in Streptomyces rimosus and catalytic analysis on polyesters by surface plasmone resonance, Appl. Microbiol. Biotechnol., 86, 1775e1784 (2010). 5. Kleeberg, I., Welzel, K., VandenHeuvel, J., Müller, R. J., and Deckwer, W. D.: Characterization of a new extracellular hydrolase from Thermobifida fusca degrading aliphatic-aromatic copolyesters, Biomacromolecules, 6, 262e270 (2005). 6. Dresler, K., Heuvel, J., Müller, R. J., and Deckwer, W. D.: Production of a recombinant polyester-cleaving hydrolase from Thermobifida fusca in Escherichia coli, Bioprocess Biosyst. Eng., 29, 169e183 (2006). 7. Yang, Y., Malten, M., Grote, A., Jahn, D., and Deckwer, W. D.: Codon optimized Thermobifida fusca hydrolase secreted by Bacillus megaterium, Biotechnol. Bioeng., 96, 780e794 (2007). 8. Chen, S., Tong, X., Woodard, R. W., Du, G., Wu, J., and Chen, J.: Identification and characterization of bacterial cutinase, J. Biol. Chem., 283, 25854e25862 (2008). 9. Hu, X., Thumarat, U., Zhang, X., Tang, M., and Kawai, F.: Diversity of polyester-degrading bacteria in compost and molecular analysis of a thermoactive esterase from Thermobifida alba AHK119, Appl. Microbiol. Biotechnol., 87, 771e779 (2010). 10. Herrero-Acero, E., Ribitsch, D., Steinkellner, G., Gruber, K., Greimel, K., Eiteljoerg, I., Trotscha, E., Wei, R., Zimmermann, W., Zinn, M., and other 4 authors: Enzymatic surface hydrolysis of PET: effect of structural diversity on kinetic properties of cutinases from Thermobifida, Macromolecules, 44, 4632e4640 (2011). 11. Thumarat, U., Nakamura, R., Kawabata, T., Suzuki, H., and Kawai, F.: Biochemical and genetic analysis of a cutinase-type polyesterase from a thermophilic Thermobifida alba AHK119, Appl. Microbiol. Biotechnol., 95, 419e430 (2012). 12. Arpigny, J. L. and Jäger, K.: Bacterial lipolytic enzymes: classificationand properties, Biochem. J., 343, 177e183 (1999). 13. Kitadokoro, K., Thumarat, U., Nakamura, R., Nishimura, K., Karatani, H., Suzuki, H., and Kawai, F.: Crystal structure of cutinase Est119 from
VOL. 120, 2015
14. 15. 16. 17.
18.
19.
20.
21.
22.
23.
24.
Thermobifida alba AHK119 that can degrade modified polyethylene terephthalate at 1.76_Å resolution, Polym. Degrad. Stab., 97, 771e775 (2012). Chen, S., Chen, J., and Wu, J.: Cutinase: characteristics, preparation and application, Biotechnol. Adv., 31, 1754e1767 (2013). Sambrook, J. and Russell, D. W.: Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (2001). Laemmli, U. K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature, 227, 680e685 (1970). Wei, Y., Swenson, L., Castro, C., Derewenda, U., Minor, W., Arai, H., Aoki, J., Inoue, K., Servin-Gonzalez, L., and Derewenda, Z. S.: Structure of a microbial homologue of mammalian platelet-activating factor acetylhydrolases: Streptomyces exfoliatus lipase at 1.9 A resolution, Structure, 6, 511e519 (1988). Lykidis, A., Mavromatis, K., Ivanova, N., Anderson, I., Land, M., DiBartolo, G., Martinez, M., Lapidus, A., Lucas, S., Copeland, A., and other 3 authors: Genome sequence and analysis of the soil cellulolytic actinomycete Thermobifida fusca YX, J. Bacteriol., 189, 2477e2486 (2007). Ollis, D. L., Cheahm, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S. M., Harel, M., Remington, S. J., Silman, I., Schrag, J., and other three authors: The a/b hydrolase fold, Protein Eng., 5, 197e211 (1992). Vertommen, M. A. M. E., Nierstrasz, V. A., van der Veer, M., and Warmoeskerken, M. M. C. G.: Enzymatic surface modification of poly(ethylene terephthalate), J. Biotechnol., 120, 376e386 (2005). Chen, S., Su, L., Billig, S., Zimmermann, W., Chen, J., and Wu, J.: Biochemical characterization of the cutinases from Thermobifid fusca, J. Mol. Catal. B Enzym., 63, 121e127 (2010). Kawai, F., Thumarat, U., Kitadokoro, K., Waku, T., Tada, T., Tanaka, N., and Kawabata, T.: Comparison of polyester-degrading cutinases from genus Thermobifida, pp. 111e120, in: Chen, H. N., Gross, R. A., and Smith, P. B. (Eds.), Green polymer chemistry: Biocatalysis and materials II. American Chemical Society, Washington, DC (2013). Acharya, P., Rajakumara, E., Sankaranarayanan, R., and Rao, N. M.: Structural basis of selection and thermostability of laboratory evolved Bacillus subtilis lipase, J. Mol. Biol., 341, 1271e1281 (2004). Bustos-Jaimes, I., Mora-Lugo, R., Calcagno, M., and Farrés, A.: Kinetic studies of Gly28:Ser mutant form of Bacillus pumilus lipase: changes in kcat and thermal dependence, Biochim. Biophys. Acta, 1804, 2222e2227 (2010).
TANDEM POLYESTERASES FROM T. ALBA AHK119
497
25. Kumar, S., Tsai, C. J., and Nussinov, R.: Factors enhancing protein thermostability, Protein Eng., 13, 179e191 (2000). 26. Pack, S. P. and Yoo, Y. J.: Protein thermostability: structure-based difference of amino acid between thermophilic and mesophilic proteins, J. Biotechnol., 111, 269e277 (2004). 27. Sadeghi, M., Nader-Manesh, H., Zarrabi, M., and Ranjbar, B.: Effective factors in thermostability of thermophilic proteins, Biophys. Chem., 119, 256e270 (2006). 28. Xu, J., Baase, W. A., Baldwin, E., and Matthews, B. W.: The response of T4 lysozyme to large-to-small substitutions within the core and its relation to the hydrophobic effect, Protein Sci., 7, 158e177 (1998). 29. Van den Burg, B., Vriend, G., Veltman, O. R., Venema, G., and Eijsink, V. G.: Engineering an enzyme to resist boiling, Proc. Natl. Acad. Sci. USA, 95, 2056e2060 (1998). 30. Zhu, G. P., Xu, C., Teng, M. K., Tao, L. M., Zhu, X. Y., Wu, C. J., Hang, J., Niu, L. W., and Wang, Y. Z.: Increasing the thermostability of D-xylose isomerase by introduction of a proline into the turn of a random coil, Protein Eng., 12, 635e638 (1999). 31. Arnórsdóttir, J., Helgadóttir, S., Thorbjarnardóttir, S. H., Eggertsson, G., and Kristjánsson, M. M.: Effect of selected Ser/Ala and Xaa/Pro mutations on the stability and catalytic properties of a cold adapted subtilisin-like serine proteinase, Biochim. Biophys. Acta, 1774, 749e755 (2007). 32. Bogin, O., Peretz, M., Hacham, Y., Korkhin, Y., Frolow, F., Kalb(Gilboa), A. J., and Burstein, Y.: Enhanced thermal stability of Clostridium beijerinckii alcohol dehydrogenase after strategic substitution of amino acid residues with prolines from the homologous thermophilic Thermoanaerobacter brockii alcohol dehydrogenase, Protein Sci., 7, 1156e1163 (1998). 33. Muslin, E. H., Clark, S. E., and Henson, C. A.: The effect of proline insertions on the thermostability of a barley alpha-glucosidase, Protein Eng., 15, 29e33 (2002). 34. Sakaguchi, M., Matsuzaki, M., Niimiya, K., Seino, J., Sugahara, Y., and Kawakita, M.: Role of proline residues in conferring thermostability on aqualysin I, J. Biochem., 141, 213e220 (2007). 35. Zimmermann, W. and Billig, S.: Enzymes for the biofunctionalization of poly(ethylene terephthalate), Adv. Biochem. Eng. Biotechnol., 125, 97e120 (2010).
