VIRUSES
crossm Complete Genome Sequence of a New Maize-Associated Cytorhabdovirus Kristen Willie,a Lucy R. Stewarta,b
A new 11,877-nucleotide cytorhabdovirus sequence with 6 open reading frames has been identified in a maize sample. It shares 50 and 51% genomewide nucleotide sequence identity with northern cereal mosaic cytorhabdovirus and barley yellow striate mosaic cytorhabdovirus, respectively.
ABSTRACT
T
he family Rhabdoviridae includes viruses with plant, insect, fish, and mammalian hosts. Members of the genera Cytorhabdovirus and Nucleorhabdovirus are plantinfecting viruses that also infect their insect vectors (1). Here, we report the complete genome sequence of a new rhabdovirus we call “maize-associated cytorhabdovirus” discovered through RNA-Seq analysis of maize samples. The virus has a genome of 11,877 nucleotides (nt) with 6 open reading frames (ORFs). It is most similar to cytorhabdoviruses, sharing 51% genome-wide nucleotide sequence identity with the 12,707-nt barley yellow striate mosaic cytorhabdovirus (BYSMV; GenBank accession no. NC028244) genome, and 50% genome-wide nucleotide sequence identity with the 13,223-nt northern cereal mosaic cytorhabdovirus (NCMV; GenBank accession no. NC002251) genome. Total RNA was isolated from lyophilized leaf tissue from two maize plants collected from a field in Lima, Peru, testing positive for infection with maize chlorotic mottle virus (MCMV) (2). Sample RNA was purified using a DirectZol RNA miniprep kit (Zymo Research, Irvine, CA, USA). RNA quantity and quality were determined using the Experion automated electrophoresis system (Bio-Rad, Hercules, CA, USA). After sequencing with the Illumina HiSeq platform (Illumina, San Diego, CA, USA), sequences with similarity to known plant viruses, including near-full-length sequences of MCMV and a unique sequence with highest similarity to grass-infecting cytorhabdoviruses, were identified using protocols outlined previously (2, 3). The cytorhabdovirus sequence was not identified in any other maize samples analyzed in the same study (2). Sanger-sequenced and amplified fragments from nt 3835 to 4308 and nt 4764 to 5591 were identical to the de novo assembled contig. The 5= and 3= end sequences were determined using First Choice RLM-RACE (Invitrogen-Thermo Fisher Scientific, Carlsbad, CA, USA; 5= RACE primers: 5= GCCCAAAACTGGAGACTAAAATGG 3= and 5= TTGAACCAGATGCTAAGAA GAGGG 3=; and 3= RACE primers 5= CACTGAAGAAGGTGGAGTAGCG 3= and 5= CTTCTGGC CCATATTCCTGA 3=). Antisense ORFs 1 to 6 were predicted in the virus genome sequence at nt 7 to 1344, 1449 to 2345, 2462 to 2971, 3093 to 3596, 3663 to 5123, and 5405 to 11605. This is consistent with predicted ORFs of other described plant-infecting rhabdoviruses that contain 6 to 8 ORFs from the antisense RNA encoding the N, P, 3, 4 (variable), M, G, and L proteins. Predicted proteins were aligned to corresponding cytorhabdovirus proteins (MacVector, Apex, NC, USA) using ClustalW, with a Gonnet matrix for similarity calculations. The putative L protein is 60% identical and 76% similar to the L protein of BYSMV, 59% identical and 76% similar to NCMV L, and 70% identical and similar to the aligned portion of partial L protein of maize yellow striate virus (GenBank accession no. JQ715419). Translated ORFs 1 to 5 of the maize-associated rhabdovirus are 29.8 to Volume 5 Issue 31 e00591-17
Received 12 May 2017 Accepted 8 June 2017 Published 3 August 2017 Citation Willie K, Stewart LR. 2017. Complete genome sequence of a new maizeassociated cytorhabdovirus. Genome Announc 5:e00591-17. https://doi.org/10 .1128/genomeA.00591-17. Copyright © 2017 Willie and Stewart. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license. Address correspondence to Lucy R. Stewart, [email protected].
genomea.asm.org 1
Downloaded from http://genomea.asm.org/ on October 21, 2017 by guest
USDA-ARS Corn, Soybean and Wheat Quality Research Unit, Wooster, Ohio, USAa; Department of Plant Pathology, Ohio State University, OARDC, Wooster, Ohio, USAb
Willie and Stewart
42.1% identical (50.2 to 60.2% similar) to corresponding proteins of BYSMV and 30.3 to 43.5% identical (48.4 to 62.1% similar) to NCMV proteins. Previously described maize-infecting rhabdoviruses include maize mosaic virus (4), maize fine streak virus (5), and NCMV (6), which are transmitted by planthoppers or leafhoppers (7). The host range, symptoms, and transmission vector for the maizeassociated cytorhabdovirus have not been identified yet. Accession number(s). The genome sequence of maize-associated cytorhabdovirus has been deposited at GenBank under the accession number KY965147.
REFERENCES 1. Hogenhout SA, Redinbaugh MG, Ammar el-D. 2003. Plant and animal rhabdovirus host range: a bug’s view. Trends Microbiol 11:264 –271. https://doi.org/10.1016/S0966-842X(03)00120-3. 2. Mahuku G, Lockhart BE, Wanjala B, Jones MW, Kimunye JN, Stewart LR, Cassone BJ, Sevgan S, Nyasani JO, Kusia E, Kumar PL, Niblett CL, Kiggundu A, Asea G, Pappu HR, Wangai A, Prasanna BM, Redinbaugh MG. 2015. Maize lethal necrosis (MLN), an emerging threat to maize-based food security in sub-Saharan Africa. Phytopathology 105:956 –965. https://doi .org/10.1094/PHYTO-12-14-0367-FI. 3. Stewart LR, Teplier R, Todd JC, Jones MW, Cassone BJ, Wijeratne S, Wijeratne A, Redinbaugh MG. 2014. Viruses in maize and johnsongrass in southern Ohio. Phytopathology 104:1360 –1369. https://doi.org/10.1094/ PHYTO-08-13-0221-R. 4. Barandoc-Alviar K, Ramirez GM, Rotenberg D, Whitfield AE. 2016. Analysis
Volume 5 Issue 31 e00591-17
of acquisition and titer of Maize mosaic rhabdovirus in its vector, Peregrinus maidis (Hemiptera: Delphacidae). J Insect Sci 16:14. https://doi.org/ 10.1093/jisesa/iev154. 5. Redinbaugh MG, Seifers DL, Meulia T, Abt JJ, Anderson RJ, Styer WE, Ackerman J, Salomon R, Houghton W, Creamer R, Gordon DT, Hogenhout SA. 2002. Maize fine streak virus, a new leafhopper-transmitted rhabdovirus. Phytopathology 92:1167–1174. https://doi.org/10.1094/PHYTO .2002.92.11.1167. 6. Ito S, Fukushi T. 1944. Studies on northern cereal mosaic. J Sapporo Soc Agric For 36:62– 89. 7. Redinbaugh MG, Ammar E-D. 2016. Chapter 19: Maize rhabdovirus vector transmission, p 277–287. In Brown JK (ed), Vector-mediated transmission of plant pathogens. American Phytopathological Society, St. Paul, MN.
genomea.asm.org 2
Downloaded from http://genomea.asm.org/ on October 21, 2017 by guest
ACKNOWLEDGMENTS We thank Agdia, Inc. for providing infected maize samples. This research was supported by USDA-ARS at the Corn, Soybean and Wheat Quality Research Unit, Wooster, OH, USA. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.
crossm Complete Genome Sequence of a New Maize-Associated Cytorhabdovirus Kristen Willie,a Lucy R. Stewarta,b
A new 11,877-nucleotide cytorhabdovirus sequence with 6 open reading frames has been identified in a maize sample. It shares 50 and 51% genomewide nucleotide sequence identity with northern cereal mosaic cytorhabdovirus and barley yellow striate mosaic cytorhabdovirus, respectively.
ABSTRACT
T
he family Rhabdoviridae includes viruses with plant, insect, fish, and mammalian hosts. Members of the genera Cytorhabdovirus and Nucleorhabdovirus are plantinfecting viruses that also infect their insect vectors (1). Here, we report the complete genome sequence of a new rhabdovirus we call “maize-associated cytorhabdovirus” discovered through RNA-Seq analysis of maize samples. The virus has a genome of 11,877 nucleotides (nt) with 6 open reading frames (ORFs). It is most similar to cytorhabdoviruses, sharing 51% genome-wide nucleotide sequence identity with the 12,707-nt barley yellow striate mosaic cytorhabdovirus (BYSMV; GenBank accession no. NC028244) genome, and 50% genome-wide nucleotide sequence identity with the 13,223-nt northern cereal mosaic cytorhabdovirus (NCMV; GenBank accession no. NC002251) genome. Total RNA was isolated from lyophilized leaf tissue from two maize plants collected from a field in Lima, Peru, testing positive for infection with maize chlorotic mottle virus (MCMV) (2). Sample RNA was purified using a DirectZol RNA miniprep kit (Zymo Research, Irvine, CA, USA). RNA quantity and quality were determined using the Experion automated electrophoresis system (Bio-Rad, Hercules, CA, USA). After sequencing with the Illumina HiSeq platform (Illumina, San Diego, CA, USA), sequences with similarity to known plant viruses, including near-full-length sequences of MCMV and a unique sequence with highest similarity to grass-infecting cytorhabdoviruses, were identified using protocols outlined previously (2, 3). The cytorhabdovirus sequence was not identified in any other maize samples analyzed in the same study (2). Sanger-sequenced and amplified fragments from nt 3835 to 4308 and nt 4764 to 5591 were identical to the de novo assembled contig. The 5= and 3= end sequences were determined using First Choice RLM-RACE (Invitrogen-Thermo Fisher Scientific, Carlsbad, CA, USA; 5= RACE primers: 5= GCCCAAAACTGGAGACTAAAATGG 3= and 5= TTGAACCAGATGCTAAGAA GAGGG 3=; and 3= RACE primers 5= CACTGAAGAAGGTGGAGTAGCG 3= and 5= CTTCTGGC CCATATTCCTGA 3=). Antisense ORFs 1 to 6 were predicted in the virus genome sequence at nt 7 to 1344, 1449 to 2345, 2462 to 2971, 3093 to 3596, 3663 to 5123, and 5405 to 11605. This is consistent with predicted ORFs of other described plant-infecting rhabdoviruses that contain 6 to 8 ORFs from the antisense RNA encoding the N, P, 3, 4 (variable), M, G, and L proteins. Predicted proteins were aligned to corresponding cytorhabdovirus proteins (MacVector, Apex, NC, USA) using ClustalW, with a Gonnet matrix for similarity calculations. The putative L protein is 60% identical and 76% similar to the L protein of BYSMV, 59% identical and 76% similar to NCMV L, and 70% identical and similar to the aligned portion of partial L protein of maize yellow striate virus (GenBank accession no. JQ715419). Translated ORFs 1 to 5 of the maize-associated rhabdovirus are 29.8 to Volume 5 Issue 31 e00591-17
Received 12 May 2017 Accepted 8 June 2017 Published 3 August 2017 Citation Willie K, Stewart LR. 2017. Complete genome sequence of a new maizeassociated cytorhabdovirus. Genome Announc 5:e00591-17. https://doi.org/10 .1128/genomeA.00591-17. Copyright © 2017 Willie and Stewart. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license. Address correspondence to Lucy R. Stewart, [email protected].
genomea.asm.org 1
Downloaded from http://genomea.asm.org/ on October 21, 2017 by guest
USDA-ARS Corn, Soybean and Wheat Quality Research Unit, Wooster, Ohio, USAa; Department of Plant Pathology, Ohio State University, OARDC, Wooster, Ohio, USAb
Willie and Stewart
42.1% identical (50.2 to 60.2% similar) to corresponding proteins of BYSMV and 30.3 to 43.5% identical (48.4 to 62.1% similar) to NCMV proteins. Previously described maize-infecting rhabdoviruses include maize mosaic virus (4), maize fine streak virus (5), and NCMV (6), which are transmitted by planthoppers or leafhoppers (7). The host range, symptoms, and transmission vector for the maizeassociated cytorhabdovirus have not been identified yet. Accession number(s). The genome sequence of maize-associated cytorhabdovirus has been deposited at GenBank under the accession number KY965147.
REFERENCES 1. Hogenhout SA, Redinbaugh MG, Ammar el-D. 2003. Plant and animal rhabdovirus host range: a bug’s view. Trends Microbiol 11:264 –271. https://doi.org/10.1016/S0966-842X(03)00120-3. 2. Mahuku G, Lockhart BE, Wanjala B, Jones MW, Kimunye JN, Stewart LR, Cassone BJ, Sevgan S, Nyasani JO, Kusia E, Kumar PL, Niblett CL, Kiggundu A, Asea G, Pappu HR, Wangai A, Prasanna BM, Redinbaugh MG. 2015. Maize lethal necrosis (MLN), an emerging threat to maize-based food security in sub-Saharan Africa. Phytopathology 105:956 –965. https://doi .org/10.1094/PHYTO-12-14-0367-FI. 3. Stewart LR, Teplier R, Todd JC, Jones MW, Cassone BJ, Wijeratne S, Wijeratne A, Redinbaugh MG. 2014. Viruses in maize and johnsongrass in southern Ohio. Phytopathology 104:1360 –1369. https://doi.org/10.1094/ PHYTO-08-13-0221-R. 4. Barandoc-Alviar K, Ramirez GM, Rotenberg D, Whitfield AE. 2016. Analysis
Volume 5 Issue 31 e00591-17
of acquisition and titer of Maize mosaic rhabdovirus in its vector, Peregrinus maidis (Hemiptera: Delphacidae). J Insect Sci 16:14. https://doi.org/ 10.1093/jisesa/iev154. 5. Redinbaugh MG, Seifers DL, Meulia T, Abt JJ, Anderson RJ, Styer WE, Ackerman J, Salomon R, Houghton W, Creamer R, Gordon DT, Hogenhout SA. 2002. Maize fine streak virus, a new leafhopper-transmitted rhabdovirus. Phytopathology 92:1167–1174. https://doi.org/10.1094/PHYTO .2002.92.11.1167. 6. Ito S, Fukushi T. 1944. Studies on northern cereal mosaic. J Sapporo Soc Agric For 36:62– 89. 7. Redinbaugh MG, Ammar E-D. 2016. Chapter 19: Maize rhabdovirus vector transmission, p 277–287. In Brown JK (ed), Vector-mediated transmission of plant pathogens. American Phytopathological Society, St. Paul, MN.
genomea.asm.org 2
Downloaded from http://genomea.asm.org/ on October 21, 2017 by guest
ACKNOWLEDGMENTS We thank Agdia, Inc. for providing infected maize samples. This research was supported by USDA-ARS at the Corn, Soybean and Wheat Quality Research Unit, Wooster, OH, USA. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.
