http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.905836
MITOGENOME ANNOUNCEMENT
Complete mitochondrial genome of freshwater shark Wallago attu (Bloch & Schneider) from Indus River Sindh, Pakistan Muhammad Younis Laghari1,2,3, Punhal Lashari2,3, Peng Xu2, Zixia Zhao2, Li Jiang2, Naeem Tariq Narejo3, Baoping Xin1, Xiaowen Sun2, and Yan Zhang2
Mitochondrial DNA Downloaded from informahealthcare.com by Chulalongkorn University on 12/29/14 For personal use only.
1
School of Chemical Engineering and Environment, Beijing Institute of Technology, Beijing, China, 2Centre for Applied Aquatic Genomics, Chinese Academy of Fishery Sciences, Beijing, China, and 3Department of Fresh Water Biology and Fisheries, University of Sindh Pakistan, Jamshoro, Pakistan Abstract
Keywords
Complete mitochondrial genome of fresh water giant catfish, Wallago attu, was isolated by LA PCR (TakaRa LAtaq, Dalian, China); and sequenced by Sanger’s method to obtain the complete mitochondrial genome. The complete mitogenome was 15,639 bp in length and contains 13 typical vertebrate protein-coding genes, 2 rRNA and 22 tRNA genes. The whole genome base composition was estimated to be 31.17% A, 28.15% C, 15.55% G and 25.12% T. The complete mitochondrial genome of catfish, W. attu, provides the fundamental tools for genetic breeding.
Mitochondrial genome, river Indus, Wallago attu
Fresh water shark, Wallago attu (Family-Siluridae) (Bloch & Schneider, 1801) is one of the large freshwater catfish found in Pakistan, India, Sri Lanka, Nepal, Bangladesh, Burma, Thailand, Vietnam, Kampuchea, Malay Peninsula, Afghanistan, Sumatra and Java (Giri et al., 2002; Jayaram, 2009; Talwar & Jhingran, 1991). The rapid growth (Goswami & Devraj, 1992) and high nutritional quality of its flesh (Lilabati & Viswanath, 1996) encourage investigation into the aquaculture potential of this excellent food fish. In order to maintain this fish population as well as to conserve their biodiversity, it is required to develop suitable techniques for the rearing and culture of W. attu to enhance the aquaculture production. Hence, development of mitochondrial genome of this commercially important food fish is prerequisite to protect it and increase the resource. Therefore, the aims of the present study provide detailed information about the mitochondrial genome of catfish W. attu. In this study, we determined the complete mitochondrial genome of catfish W. attu (Bloch & Schneider, 1801). Total DNA was extracted using QIAGEN DNeasy Blood & Tissue kit (Qiagen, Valencia, CA). The complete mitogenome was generated with 15,639 bp in length. The complete mitogenome of W. attu has been deposited in GenBank with an accession number (KJ410746). Mitogenome was amplified with five universal primers by long PCR (TakaRa LAtaq, Dalian, China), CYTB-L-GACTTGAAAAACCACCGTTC, CYTB-H-CTCCGA TCTCCGGATTAACAAGAC, 16Sar-L-CGCCTGTTTATCAA AAACAT, 16sbr-H-CCGGTCTGAACTCAGATCACGT, 12sH-TGACTGCAGAGGGTGACGGGCGGTGTGT, 12s-L-AAAA AGCTTCAAACTGGGATTAGATACCCCACTAT, ND4-L-CC
Correspondence: Xiaowen Sun and Yan Zhang, Centre for Applied Aquatic Genomics, Chinese Academy of Fishery Sciences, Beijing 1110141, China. E-mail: [email protected] (X. W. Sun); zhangy@ cafs.ac.cn (Y. Zhang).
History Received 3 March 2014 Accepted 15 March 2014 Published online 4 April 2014
AAAAGCACACGTAGAAGC, ND4-H-ACCAAGAGTTTTGG TTCCTA, ND4-5-F-CCTAACCTWATGGGRGAACT, ND4-5R-GATCAGGTTACGTAKAGKGC and CO1-F-TTCTCGACT AATCACAAAGACATYGG, CO1-R-TCAAARAAGGTTGTGT TAGGTTYC. The complete W. attu mitogenome sequence (GenBank No. KJ410746) was 15,639 bp in length. The overall characteristics, including its overall organization and the gene arrangement pattern, were identical to that of the typical vertebrate mitogenome. The complete mitogenome contains 13 proteincoding genes, 2 rRNA, 22 tRNA genes and 1 putative control region (Table 1). The average base composition of the Rita complete mitogenome was 31.17% A, 28.15% C, 15.55% G, and Table 1. Organization and profile of the freshwater shark, W. attu mitochondrial genome.
Gene tRNAphe 12S rRNA tRNAVal 16S rRNA tRNALeu(UAA) ND1 tRNAIle tRNAGln tRNAMet ND2 tRNATrp tRNAAla tRNAAsn OL tRNACys
Start 1 71 1020 1092 2769 2845 3561 3632 3702 3772 4817 4890 4960 5032 5065
Stop
Codon Size Intergenic (bp) Start Stop nucleotide Strandy
70 70 1019 948 1091 71 2768 1676 2843 74 3560 715 ATG TAA 3632 71 3702 70 3771 69 4816 1044 ATG T 4887 70 4958 68 5032 72 5065 33 5131 66
– – 0 0 0 +2 0 0 0 0 0 +3 +2 – 0
H H H H H H H L H H H L L – L (continued )
2
L. M. Younis et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Continued
Gene
Mitochondrial DNA Downloaded from informahealthcare.com by Chulalongkorn University on 12/29/14 For personal use only.
Tyr
tRNA COX1 tRNASer(UGA) tRNAAsp COX2 tRNALys ATPase 8 ATPase 6 COX3 tRNAGly ND3 tRNAArg ND4L ND4 tRNAHis tRNASer(UGC) tRNALeu(UAG) ND5 ND6 tRNAGlu Cytb tRNAThr tRNAPro D-loop
Start
Stop
5136 5207 6259 6334 6420 7111 7186 7344 8027 8811 8885 9225 9296 9586 10,967 11,037 11,108 11,181 13,008 13,528 13,599 14,650 14,719 14,789
5205 6232 6329 6405 7110 7184 7354 8026 8810 8883 9224 9295 9592 10,966 11,036 11,103 11,180 13,007 13,523 13,596 14,649 14,720 14,788 15,639
Codon Size Intergenic (bp) Start Stop nucleotide Strandy 69 1025 70 71 690 73 168 682 783 72 339 70 296 1380 69 66 72 1826 515 68 1050 70 69 850
GTG TAG ATG
T
ATG TAA ATG T ATG T GTG
T
ATG TAA ATG T
ATG TAA ATG TAA ATG
T
+5 +2 +27 +5 +15 0 +2 0 0 +2 0 0 6 0 0 +5 0 0 +5 +3 0 1 0 –
L H L H H H H H H H H H H H H H H H L L H H H –
Numbers correspond to the nucleotides separating different genes. Negative numbers indicate overlapping nucleotides between adjacent genes; yH and L denote heavy and light strands, respectively.
25.12% T. All protein-coding genes except (NADH6) were encoded on heavy strand (H strand). Fourteen tRNA were encoded on heavy strand and remainder were encoded on light strand (L strand). The organization of W. attu mitochondrial
genome conforms to the consensus of gene order of other fish mitochondrial genome (Table 1). Eleven protein-coding genes used ATG as start codon (NADH1, NADH2, COX2, ATPase 8, ATPase 6, COX3, NADH4L, NADH4, NADH5, NADH6 and CYTB) while two genes used GTG (COX1 and ND3) as start codon. Seven open reading frames used incomplete stop codon T** (NADH2, COX2, ATPase 6, COX3, NAHD3, NADH4 and CYTB); five genes use stop codon as TAA (COX2, ATPase 8, NADH4L, NADH5 and NADH6). One gene (COX1) used TAG as stop codon, respectively. The control region D-loop was located between tRNApro and tRNAphe with 850 bp in length.
Declaration of interest The authors report no conflict of interest. The authors alone are responsible for the content and writing of the manuscript. This work was supported by the introduction of advanced agricultural science and technology key projects (2011-G12) and Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences (2012C013).
References Giri SS, Sahoo SK, Sahu BB, Mohanty SN, Mukhopadhyay PK, Ayyappan S. (2002). Larval survival and growth in Wallago attu (Bloch & Schneider); effects of light, photoperiod and feeding regimes. Aquaculture 213:151–61. Goswami PK, Devraj M. (1992). Breeding, age and growth of the freshwater shark Wallago attu (Bloch and Schneider) from the Dhir Beel of the Brahmaputra basin, Assam, India. J Indian Fish Assoc 22: 13–20. Jayaram KC. (2009). The freshwater fishes of the Indian Region. Delhi, India: Narendra Publication House. Lilabati H, Viswanath W. (1996). Nutritional quality of freshwater catfish (Wallago attu) available in India. Food Chem 57:197–9. Talwar PK, Jhingran AG. (1991). Inland fishes of India and adjacent, countries. New Delhi: Oxford & IBH (I: 1158).
MITOGENOME ANNOUNCEMENT
Complete mitochondrial genome of freshwater shark Wallago attu (Bloch & Schneider) from Indus River Sindh, Pakistan Muhammad Younis Laghari1,2,3, Punhal Lashari2,3, Peng Xu2, Zixia Zhao2, Li Jiang2, Naeem Tariq Narejo3, Baoping Xin1, Xiaowen Sun2, and Yan Zhang2
Mitochondrial DNA Downloaded from informahealthcare.com by Chulalongkorn University on 12/29/14 For personal use only.
1
School of Chemical Engineering and Environment, Beijing Institute of Technology, Beijing, China, 2Centre for Applied Aquatic Genomics, Chinese Academy of Fishery Sciences, Beijing, China, and 3Department of Fresh Water Biology and Fisheries, University of Sindh Pakistan, Jamshoro, Pakistan Abstract
Keywords
Complete mitochondrial genome of fresh water giant catfish, Wallago attu, was isolated by LA PCR (TakaRa LAtaq, Dalian, China); and sequenced by Sanger’s method to obtain the complete mitochondrial genome. The complete mitogenome was 15,639 bp in length and contains 13 typical vertebrate protein-coding genes, 2 rRNA and 22 tRNA genes. The whole genome base composition was estimated to be 31.17% A, 28.15% C, 15.55% G and 25.12% T. The complete mitochondrial genome of catfish, W. attu, provides the fundamental tools for genetic breeding.
Mitochondrial genome, river Indus, Wallago attu
Fresh water shark, Wallago attu (Family-Siluridae) (Bloch & Schneider, 1801) is one of the large freshwater catfish found in Pakistan, India, Sri Lanka, Nepal, Bangladesh, Burma, Thailand, Vietnam, Kampuchea, Malay Peninsula, Afghanistan, Sumatra and Java (Giri et al., 2002; Jayaram, 2009; Talwar & Jhingran, 1991). The rapid growth (Goswami & Devraj, 1992) and high nutritional quality of its flesh (Lilabati & Viswanath, 1996) encourage investigation into the aquaculture potential of this excellent food fish. In order to maintain this fish population as well as to conserve their biodiversity, it is required to develop suitable techniques for the rearing and culture of W. attu to enhance the aquaculture production. Hence, development of mitochondrial genome of this commercially important food fish is prerequisite to protect it and increase the resource. Therefore, the aims of the present study provide detailed information about the mitochondrial genome of catfish W. attu. In this study, we determined the complete mitochondrial genome of catfish W. attu (Bloch & Schneider, 1801). Total DNA was extracted using QIAGEN DNeasy Blood & Tissue kit (Qiagen, Valencia, CA). The complete mitogenome was generated with 15,639 bp in length. The complete mitogenome of W. attu has been deposited in GenBank with an accession number (KJ410746). Mitogenome was amplified with five universal primers by long PCR (TakaRa LAtaq, Dalian, China), CYTB-L-GACTTGAAAAACCACCGTTC, CYTB-H-CTCCGA TCTCCGGATTAACAAGAC, 16Sar-L-CGCCTGTTTATCAA AAACAT, 16sbr-H-CCGGTCTGAACTCAGATCACGT, 12sH-TGACTGCAGAGGGTGACGGGCGGTGTGT, 12s-L-AAAA AGCTTCAAACTGGGATTAGATACCCCACTAT, ND4-L-CC
Correspondence: Xiaowen Sun and Yan Zhang, Centre for Applied Aquatic Genomics, Chinese Academy of Fishery Sciences, Beijing 1110141, China. E-mail: [email protected] (X. W. Sun); zhangy@ cafs.ac.cn (Y. Zhang).
History Received 3 March 2014 Accepted 15 March 2014 Published online 4 April 2014
AAAAGCACACGTAGAAGC, ND4-H-ACCAAGAGTTTTGG TTCCTA, ND4-5-F-CCTAACCTWATGGGRGAACT, ND4-5R-GATCAGGTTACGTAKAGKGC and CO1-F-TTCTCGACT AATCACAAAGACATYGG, CO1-R-TCAAARAAGGTTGTGT TAGGTTYC. The complete W. attu mitogenome sequence (GenBank No. KJ410746) was 15,639 bp in length. The overall characteristics, including its overall organization and the gene arrangement pattern, were identical to that of the typical vertebrate mitogenome. The complete mitogenome contains 13 proteincoding genes, 2 rRNA, 22 tRNA genes and 1 putative control region (Table 1). The average base composition of the Rita complete mitogenome was 31.17% A, 28.15% C, 15.55% G, and Table 1. Organization and profile of the freshwater shark, W. attu mitochondrial genome.
Gene tRNAphe 12S rRNA tRNAVal 16S rRNA tRNALeu(UAA) ND1 tRNAIle tRNAGln tRNAMet ND2 tRNATrp tRNAAla tRNAAsn OL tRNACys
Start 1 71 1020 1092 2769 2845 3561 3632 3702 3772 4817 4890 4960 5032 5065
Stop
Codon Size Intergenic (bp) Start Stop nucleotide Strandy
70 70 1019 948 1091 71 2768 1676 2843 74 3560 715 ATG TAA 3632 71 3702 70 3771 69 4816 1044 ATG T 4887 70 4958 68 5032 72 5065 33 5131 66
– – 0 0 0 +2 0 0 0 0 0 +3 +2 – 0
H H H H H H H L H H H L L – L (continued )
2
L. M. Younis et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Continued
Gene
Mitochondrial DNA Downloaded from informahealthcare.com by Chulalongkorn University on 12/29/14 For personal use only.
Tyr
tRNA COX1 tRNASer(UGA) tRNAAsp COX2 tRNALys ATPase 8 ATPase 6 COX3 tRNAGly ND3 tRNAArg ND4L ND4 tRNAHis tRNASer(UGC) tRNALeu(UAG) ND5 ND6 tRNAGlu Cytb tRNAThr tRNAPro D-loop
Start
Stop
5136 5207 6259 6334 6420 7111 7186 7344 8027 8811 8885 9225 9296 9586 10,967 11,037 11,108 11,181 13,008 13,528 13,599 14,650 14,719 14,789
5205 6232 6329 6405 7110 7184 7354 8026 8810 8883 9224 9295 9592 10,966 11,036 11,103 11,180 13,007 13,523 13,596 14,649 14,720 14,788 15,639
Codon Size Intergenic (bp) Start Stop nucleotide Strandy 69 1025 70 71 690 73 168 682 783 72 339 70 296 1380 69 66 72 1826 515 68 1050 70 69 850
GTG TAG ATG
T
ATG TAA ATG T ATG T GTG
T
ATG TAA ATG T
ATG TAA ATG TAA ATG
T
+5 +2 +27 +5 +15 0 +2 0 0 +2 0 0 6 0 0 +5 0 0 +5 +3 0 1 0 –
L H L H H H H H H H H H H H H H H H L L H H H –
Numbers correspond to the nucleotides separating different genes. Negative numbers indicate overlapping nucleotides between adjacent genes; yH and L denote heavy and light strands, respectively.
25.12% T. All protein-coding genes except (NADH6) were encoded on heavy strand (H strand). Fourteen tRNA were encoded on heavy strand and remainder were encoded on light strand (L strand). The organization of W. attu mitochondrial
genome conforms to the consensus of gene order of other fish mitochondrial genome (Table 1). Eleven protein-coding genes used ATG as start codon (NADH1, NADH2, COX2, ATPase 8, ATPase 6, COX3, NADH4L, NADH4, NADH5, NADH6 and CYTB) while two genes used GTG (COX1 and ND3) as start codon. Seven open reading frames used incomplete stop codon T** (NADH2, COX2, ATPase 6, COX3, NAHD3, NADH4 and CYTB); five genes use stop codon as TAA (COX2, ATPase 8, NADH4L, NADH5 and NADH6). One gene (COX1) used TAG as stop codon, respectively. The control region D-loop was located between tRNApro and tRNAphe with 850 bp in length.
Declaration of interest The authors report no conflict of interest. The authors alone are responsible for the content and writing of the manuscript. This work was supported by the introduction of advanced agricultural science and technology key projects (2011-G12) and Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences (2012C013).
References Giri SS, Sahoo SK, Sahu BB, Mohanty SN, Mukhopadhyay PK, Ayyappan S. (2002). Larval survival and growth in Wallago attu (Bloch & Schneider); effects of light, photoperiod and feeding regimes. Aquaculture 213:151–61. Goswami PK, Devraj M. (1992). Breeding, age and growth of the freshwater shark Wallago attu (Bloch and Schneider) from the Dhir Beel of the Brahmaputra basin, Assam, India. J Indian Fish Assoc 22: 13–20. Jayaram KC. (2009). The freshwater fishes of the Indian Region. Delhi, India: Narendra Publication House. Lilabati H, Viswanath W. (1996). Nutritional quality of freshwater catfish (Wallago attu) available in India. Food Chem 57:197–9. Talwar PK, Jhingran AG. (1991). Inland fishes of India and adjacent, countries. New Delhi: Oxford & IBH (I: 1158).
