http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.961145
MITOGENOME ANNOUNCEMENT
Complete mitochondrial genome of the giant ramshorn snail Marisa cornuarietis (Gastropoda: Ampullariidae) Mingling Wang1,2 and Jian-Wen Qiu2 Mitochondrial DNA Downloaded from informahealthcare.com by QUT Queensland University of Tech on 10/14/14 For personal use only.
1
Key Laboratory of Marine Ecology & Environmental Sciences, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, P. R. China and Department of Biology, Hong Kong Baptist University, Hong Kong, P. R. China
2
Abstract
Keywords
We report the complete mitochondrial genome (mitogenome) of the giant ramshorn snail Marisa cornuarietis, a biocontrol agent of freshwater weeds and snail vectors of schistosomes. The mitogenome is 15,923 bp in length, encoding 13 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs. The mitogenome is A+T biased (70.0%), with 28.9% A, 41.1% T, 16.7% G, and 13.3% C. A comparison with Pomacea canaliculata, the other member in the same family (Ampullariidae) with a sequenced mitogenome, shows that the two species have an identical gene order, but their intergenic regions vary substantially in sequence length. The mitogenome data can be used to understand the population genetics of M. cornuarietis, and resolve the phylogenetic relationship of various genera in Ampullariidae.
Ampullaridae, apple snail, Marisa, mitochondrial genome, ramshorn snail
Freshwater apple snails in the family Ampullariidae have been proposed as a model in studies of evolution, environmental adaptation and biological invasion (Hayes et al., 2009a; Sun et al., 2013). However, there are very few genomic resources in these snails to facilitate such studies at the molecular level (Sun et al., 2012). Of the approximately 150 species of apple snails recognized in nine genera (Hayes et al., 2009b), only Pomacea canaliculata has a sequenced mitochondrial genome (Zhou et al., 2014). Here we report the mitogenome of the giant ramshorn snail Marisa cornuarietis (Linnaeus, 1758), the second in Ampullariidae. This omnivorous snail has been introduced from South America to several regions of the world to control freshwater weeds and snail vectors of schistosomes, but there is concern about its impact on non-target organisms (Cowie, 2001). We adopted the long and accurate PCR approach and primerwalking strategy (Wang et al., 2013) to sequence the mitogenome of M. cornuarietis. We sequenced several short mitochondrial gene segments (cox1, nad1, 16S and cytb; Rawlings et al., 2007). Based on these sequences, we designed three pairs of primers (cox1-nad1-F: CGGGAGCCTTGTTAGGTGATGAT; cox1-nad1R: AAGCTGCTATTGTTCCAAAGTCGC. 16S-cytb -F: TGAAG GCTAGTATGAAAGGTCTGACG; 16S-cytb-R: TAATAGATGT AAAACTCTTAGCGCAGCA. cytb-cox1-F: TAGAATGGGTTT GAGGCGGCTTTG; cytb-cox1-R: TGTCCCAACTCCACTTTC TACAGCAGC) to amplify long mtDNA segments. We then assembled the mitogenome using CAP3, determined proteincoding genes and ribosomal RNAs (rRNA) genes through comparison with the available sequences of Neogastropoda in GenBank, and recognized the transfer RNA (tRNA) genes using ARWEN 1.2 (Laslett & Canba¨ck, 2008).
Correspondence: Dr. Jian-Wen Qiu, Department of Biology, Hong Kong Baptist University, 224 Waterloo Road, Hong Kong, P. R. China. Tel: +852-34117055. Fax: +852-34115995. E-mail: [email protected]
History Received 30 August 2014 Accepted 31 August 2014 Published online 25 September 2014
Table 1. Characteristics of the mitochondrial genome of M. cornuarietis. Position Gene
From
To
cox1 cox2 tRNA-Asp atp8 atp6 tRNA-Met tRNA-Tyr tRNA-Cys tRNA-Trp tRNA-Gln tRNA-Gly tRNA-Glu 12S RNA tRNA-Val 16S RNA tRNA-Leu tRNA-Leu nad1 tRNA-Pro nad6 cytb tRNA-Ser tRNA-Thr nad4L nad4 tRNA-His nad5 tRNA-Phe cox3 tRNA-Lys tRNA-Ala tRNA-Arg tRNA-Asn
1 1562 2271 2340 2528 3254 3359 3450 3523 3594 3721 3817 3883 4860 4928 6287 6501 6570 7519 7586 8092 9238 9328 9407 9697 11,035 11,101 12,826 12,957 13,817 13,914 14,129 14,231
1536 2248 2338 2495 3220 3317 3426 3513 3587 3657 3787 3882 4859 4927 6286 6355 6569 7514 7585 8080 9231 9306 9396 9703 11,010 11,100 12,816 12,893 13,736 13,888 13,983 14,202 14,302
Codon Length Intergenic (bp) Start Stop nucleotides* Strand 1536 687 68 156 693 64 68 64 65 64 67 66 977 68 1359 69 69 945 67 495 1140 69 69 297 1314 66 1716 68 780 72 70 74 72
ATG TAG ATG TAA ATG TAG ATG TAA
25 22 1 32 33 41 23 9 6 63 29
145 ATG TAA
4
ATG TAG ATG TAG
11 6 21 10 7 24
ATG TAA ATG TAA ATG TAG ATG TAA
9 63 80 25 145 28 33
H H H H H L L L L L L L H H H H H H H H H H L H H H H H H H H H H (continued )
2
M. Wang & J.-W. Qiu
Mitochondrial DNA, Early Online: 1–2
Ampullaridae, and the phylogenetic position of Ampullariidae in Gastropoda.
Table 1. Continued
Position Gene
From
To
tRNA-Ile nad3 tRNA-Ser nad2
14,336 14,410 14,790 14,858
14,408 14,763 14,857 15,919
Codon Length Intergenic (bp) Start Stop nucleotides* Strand 73 354 68 1062
ATG TAG
1 26
ATG TAA
4
H H H H
Mitochondrial DNA Downloaded from informahealthcare.com by QUT Queensland University of Tech on 10/14/14 For personal use only.
Data represent numbers of nucleotides between adjacent genes. Negative value indicates the number of overlapping nucleotides.
The complete mitogenome of M. cornuarietis (GenBank accession number KM100140) was 15,923 bp in length, consisting of 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes (Table 1). The mitogenome was A+T biased (70.0%), with 28.9% A, 41.1% T, 16.7% G, and 13.3% C. The protein-coding genes began with an ATG start codon and terminated with either TAA or TAG. The 13 protein genes were encoded by 3712 amino acids. The gene identity and gene order were identical to those of the P. canaliculata mitogenome. Most of the genes were encoded on the heavy strand, but eight tRNA genes (Met, Tyr, Cys, Trp, Gln, Gly, Glu and Thr) were encoded on the light strand (Table 1). There were 28 non-coding intergenic regions 1 to 145 bp long (total 919 bp). Among them, six were sizable (440 bp) and especially high in AT-content (71.4 to 88.9%). In addition, there was a 7-bp overlap between the nad4L and nad4 genes. A comparison with P. canaliculata showed that the non-coding spacer regions were much less conserved than the protein-coding regions. For instance, the intergenic region between tRNA-Phe and cox3 in M. cornuarietis was much shorter than that in P. canaliculata (63 bp versus 359 bp). These novel mtDNA data provide genetic markers to study the population genetics of M. cornuarietis, and contribute to resolving the phylogeny of the genus Marisa which was considered paraphyletic (Rawlings et al., 2007), the relationship between Marisa and other genera of
Declaration of interest The authors declare no conflict of interest. The authors alone are responsible for the content and writing of the paper. This study was supported by a grant from Hong Kong Baptist University (FRG2/ 13–14/009).
References Cowie RH. (2001). Can snails ever be effective and safe biocontrol agents? Int J Pest Manage 47:23–40. Hayes KA, Cowie RH, Jørgensen A, Schultheib A, Albrecht C, Thiengo SC. (2009a). Molluscan models in evolutionary biology: Apple snails (Gastropoda: Ampullariidae) as a system for addressing fundamental questions. Amer Malac Bull 27:47–58. Hayes KA, Cowie RH, Thiengo SC. (2009b). A global phylogeny of apple snails: Gondwanan origin, generic relationships and the influence of outgroup choice (Caenogastropoda: Ampullariidae). Biol J Linn Soc 98:61–76. Laslett D, Canba¨ck B. (2008). ARWEN, a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 24:172–5. Rawlings TA, Hayes KA, Cowie RH, Collins TM. (2007). The identity, distribution, and impacts of non-native apple snails in the continental United States. BMC Evol Biol 7:97. Sun J, Mu H, Zhang H, Chandramouli KH, Qian PY, Wong CKC, Qiu JW. (2013). Understanding the regulation of estivation in a freshwater snail through iTRAQ-based comparative proteomics. J Proteome Res 12: 5271–80. Sun J, Wang M, Wang H, Zhang H, Zhang X, Thiyagarajan V, Qian PY, Qiu JW. (2012). De novo assembly of the transcriptome of an invasive snail and its multiple ecological applications. Mol Ecol Res 12: 1133–44. Wang M, Sun J, Li J, Qiu JW. (2013). Complete mitochondrial genome of the brain coral Platygyra carnosus. Mitochondrial DNA 24:194–5. Zhou X, Chen Y, Zhu S, Xu H, Liu Y, Chen L. (2014). The complete mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae). Mitochondrial DNA. [Epub ahead of print]. doi:10.3109/19401736.2014.919488.
MITOGENOME ANNOUNCEMENT
Complete mitochondrial genome of the giant ramshorn snail Marisa cornuarietis (Gastropoda: Ampullariidae) Mingling Wang1,2 and Jian-Wen Qiu2 Mitochondrial DNA Downloaded from informahealthcare.com by QUT Queensland University of Tech on 10/14/14 For personal use only.
1
Key Laboratory of Marine Ecology & Environmental Sciences, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, P. R. China and Department of Biology, Hong Kong Baptist University, Hong Kong, P. R. China
2
Abstract
Keywords
We report the complete mitochondrial genome (mitogenome) of the giant ramshorn snail Marisa cornuarietis, a biocontrol agent of freshwater weeds and snail vectors of schistosomes. The mitogenome is 15,923 bp in length, encoding 13 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs. The mitogenome is A+T biased (70.0%), with 28.9% A, 41.1% T, 16.7% G, and 13.3% C. A comparison with Pomacea canaliculata, the other member in the same family (Ampullariidae) with a sequenced mitogenome, shows that the two species have an identical gene order, but their intergenic regions vary substantially in sequence length. The mitogenome data can be used to understand the population genetics of M. cornuarietis, and resolve the phylogenetic relationship of various genera in Ampullariidae.
Ampullaridae, apple snail, Marisa, mitochondrial genome, ramshorn snail
Freshwater apple snails in the family Ampullariidae have been proposed as a model in studies of evolution, environmental adaptation and biological invasion (Hayes et al., 2009a; Sun et al., 2013). However, there are very few genomic resources in these snails to facilitate such studies at the molecular level (Sun et al., 2012). Of the approximately 150 species of apple snails recognized in nine genera (Hayes et al., 2009b), only Pomacea canaliculata has a sequenced mitochondrial genome (Zhou et al., 2014). Here we report the mitogenome of the giant ramshorn snail Marisa cornuarietis (Linnaeus, 1758), the second in Ampullariidae. This omnivorous snail has been introduced from South America to several regions of the world to control freshwater weeds and snail vectors of schistosomes, but there is concern about its impact on non-target organisms (Cowie, 2001). We adopted the long and accurate PCR approach and primerwalking strategy (Wang et al., 2013) to sequence the mitogenome of M. cornuarietis. We sequenced several short mitochondrial gene segments (cox1, nad1, 16S and cytb; Rawlings et al., 2007). Based on these sequences, we designed three pairs of primers (cox1-nad1-F: CGGGAGCCTTGTTAGGTGATGAT; cox1-nad1R: AAGCTGCTATTGTTCCAAAGTCGC. 16S-cytb -F: TGAAG GCTAGTATGAAAGGTCTGACG; 16S-cytb-R: TAATAGATGT AAAACTCTTAGCGCAGCA. cytb-cox1-F: TAGAATGGGTTT GAGGCGGCTTTG; cytb-cox1-R: TGTCCCAACTCCACTTTC TACAGCAGC) to amplify long mtDNA segments. We then assembled the mitogenome using CAP3, determined proteincoding genes and ribosomal RNAs (rRNA) genes through comparison with the available sequences of Neogastropoda in GenBank, and recognized the transfer RNA (tRNA) genes using ARWEN 1.2 (Laslett & Canba¨ck, 2008).
Correspondence: Dr. Jian-Wen Qiu, Department of Biology, Hong Kong Baptist University, 224 Waterloo Road, Hong Kong, P. R. China. Tel: +852-34117055. Fax: +852-34115995. E-mail: [email protected]
History Received 30 August 2014 Accepted 31 August 2014 Published online 25 September 2014
Table 1. Characteristics of the mitochondrial genome of M. cornuarietis. Position Gene
From
To
cox1 cox2 tRNA-Asp atp8 atp6 tRNA-Met tRNA-Tyr tRNA-Cys tRNA-Trp tRNA-Gln tRNA-Gly tRNA-Glu 12S RNA tRNA-Val 16S RNA tRNA-Leu tRNA-Leu nad1 tRNA-Pro nad6 cytb tRNA-Ser tRNA-Thr nad4L nad4 tRNA-His nad5 tRNA-Phe cox3 tRNA-Lys tRNA-Ala tRNA-Arg tRNA-Asn
1 1562 2271 2340 2528 3254 3359 3450 3523 3594 3721 3817 3883 4860 4928 6287 6501 6570 7519 7586 8092 9238 9328 9407 9697 11,035 11,101 12,826 12,957 13,817 13,914 14,129 14,231
1536 2248 2338 2495 3220 3317 3426 3513 3587 3657 3787 3882 4859 4927 6286 6355 6569 7514 7585 8080 9231 9306 9396 9703 11,010 11,100 12,816 12,893 13,736 13,888 13,983 14,202 14,302
Codon Length Intergenic (bp) Start Stop nucleotides* Strand 1536 687 68 156 693 64 68 64 65 64 67 66 977 68 1359 69 69 945 67 495 1140 69 69 297 1314 66 1716 68 780 72 70 74 72
ATG TAG ATG TAA ATG TAG ATG TAA
25 22 1 32 33 41 23 9 6 63 29
145 ATG TAA
4
ATG TAG ATG TAG
11 6 21 10 7 24
ATG TAA ATG TAA ATG TAG ATG TAA
9 63 80 25 145 28 33
H H H H H L L L L L L L H H H H H H H H H H L H H H H H H H H H H (continued )
2
M. Wang & J.-W. Qiu
Mitochondrial DNA, Early Online: 1–2
Ampullaridae, and the phylogenetic position of Ampullariidae in Gastropoda.
Table 1. Continued
Position Gene
From
To
tRNA-Ile nad3 tRNA-Ser nad2
14,336 14,410 14,790 14,858
14,408 14,763 14,857 15,919
Codon Length Intergenic (bp) Start Stop nucleotides* Strand 73 354 68 1062
ATG TAG
1 26
ATG TAA
4
H H H H
Mitochondrial DNA Downloaded from informahealthcare.com by QUT Queensland University of Tech on 10/14/14 For personal use only.
Data represent numbers of nucleotides between adjacent genes. Negative value indicates the number of overlapping nucleotides.
The complete mitogenome of M. cornuarietis (GenBank accession number KM100140) was 15,923 bp in length, consisting of 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes (Table 1). The mitogenome was A+T biased (70.0%), with 28.9% A, 41.1% T, 16.7% G, and 13.3% C. The protein-coding genes began with an ATG start codon and terminated with either TAA or TAG. The 13 protein genes were encoded by 3712 amino acids. The gene identity and gene order were identical to those of the P. canaliculata mitogenome. Most of the genes were encoded on the heavy strand, but eight tRNA genes (Met, Tyr, Cys, Trp, Gln, Gly, Glu and Thr) were encoded on the light strand (Table 1). There were 28 non-coding intergenic regions 1 to 145 bp long (total 919 bp). Among them, six were sizable (440 bp) and especially high in AT-content (71.4 to 88.9%). In addition, there was a 7-bp overlap between the nad4L and nad4 genes. A comparison with P. canaliculata showed that the non-coding spacer regions were much less conserved than the protein-coding regions. For instance, the intergenic region between tRNA-Phe and cox3 in M. cornuarietis was much shorter than that in P. canaliculata (63 bp versus 359 bp). These novel mtDNA data provide genetic markers to study the population genetics of M. cornuarietis, and contribute to resolving the phylogeny of the genus Marisa which was considered paraphyletic (Rawlings et al., 2007), the relationship between Marisa and other genera of
Declaration of interest The authors declare no conflict of interest. The authors alone are responsible for the content and writing of the paper. This study was supported by a grant from Hong Kong Baptist University (FRG2/ 13–14/009).
References Cowie RH. (2001). Can snails ever be effective and safe biocontrol agents? Int J Pest Manage 47:23–40. Hayes KA, Cowie RH, Jørgensen A, Schultheib A, Albrecht C, Thiengo SC. (2009a). Molluscan models in evolutionary biology: Apple snails (Gastropoda: Ampullariidae) as a system for addressing fundamental questions. Amer Malac Bull 27:47–58. Hayes KA, Cowie RH, Thiengo SC. (2009b). A global phylogeny of apple snails: Gondwanan origin, generic relationships and the influence of outgroup choice (Caenogastropoda: Ampullariidae). Biol J Linn Soc 98:61–76. Laslett D, Canba¨ck B. (2008). ARWEN, a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 24:172–5. Rawlings TA, Hayes KA, Cowie RH, Collins TM. (2007). The identity, distribution, and impacts of non-native apple snails in the continental United States. BMC Evol Biol 7:97. Sun J, Mu H, Zhang H, Chandramouli KH, Qian PY, Wong CKC, Qiu JW. (2013). Understanding the regulation of estivation in a freshwater snail through iTRAQ-based comparative proteomics. J Proteome Res 12: 5271–80. Sun J, Wang M, Wang H, Zhang H, Zhang X, Thiyagarajan V, Qian PY, Qiu JW. (2012). De novo assembly of the transcriptome of an invasive snail and its multiple ecological applications. Mol Ecol Res 12: 1133–44. Wang M, Sun J, Li J, Qiu JW. (2013). Complete mitochondrial genome of the brain coral Platygyra carnosus. Mitochondrial DNA 24:194–5. Zhou X, Chen Y, Zhu S, Xu H, Liu Y, Chen L. (2014). The complete mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae). Mitochondrial DNA. [Epub ahead of print]. doi:10.3109/19401736.2014.919488.
