http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.892082
MITOGENOME ANNOUNCEMENT
Complete mitochondrial genome sequence of a phytophagous ladybird beetle, Henosepilachna pusillanima (Mulsant) (Coleoptera: Coccinellidae) G. T. Behere1, D. M. Firake1, W. T. Tay2, N. S. Azad Thakur1, and S. V. Ngachan1 1
Division of Crop Improvement (Entomology), ICAR Research Complex for NEH Region, Umroi Road, Umiam (Barapani), Meghalaya, India and Biosecurity Flagship, CSIRO Ecosystem Sciences, Black Mountain Laboratories, Canberra, Australia
Mitochondrial DNA Downloaded from informahealthcare.com by Emory University on 08/04/15 For personal use only.
2
Abstract
Keywords
Ladybird beetles are generally considered as agriculturally beneficial insects, but the ladybird beetles in the coleopteran subfamily Epilachninae are phytophagous and major plant feeding pest species which causes severe economic losses to cucurbitaceous and solanaceous crops. Henosepilachna pusillanima (Mulsant) is one of the important pest species of ladybird beetle. In this report, we sequenced and characterized the complete mitochondrial genome of H. pusillanima. For sequencing of the complete mitochondrial genome, we used the Ion Torrent sequencing platform. The complete circular mitochondrial genome of the H. pusillanima was determined to be 16,216 bp long. There were totally 13 protein coding genes, 22 transfer RNA, 2 ribosomal RNA and a control (A + T-rich) region estimated to be 1690 bp. The gene arrangement and orientations of assembled mitogenome were identical to the reported predatory ladybird beetle Coccinella septempunctata L. This is the first completely sequenced coleopteran mitochondrial genome from the beetle subfamily Epilachninae from India. Data generated in this study will benefit future comparative genomics studies for understanding the evolutionary relationships between predatory and phytophagous coccinellid beetles.
Complete sequence, Henosepilachna pusillanima, mitogenome
The coleopteran sub-family Epilachninae includes plant-eating ladybird beetles that are economically important world-wide because of their capacity to inflict significant crop damages (Li, 1993). Previously, only the genus Epilachna Dejean was recognized. However, the existence of unique morphological features in some species within genus Epilachna led to new genus Henosepilachna being erected (Fu¨rsch, 1990, 1991; Li & Cook, 1961). Both Epilachna and Henosepilachna are now considered as two distinct genera (Li, 1993) within Epilachninae. Henosepilachna species are phytophagous, with H. pusillanima (Mulsant) (previously also known as E. dodecastigma (Wiedemann) (Dharmaretnam, 2002) being one of the most important pests of cucurbitaceous crops in India. Despite the agricultural importance of Coccinellidae beetles which include both phytophagous and predatory species, their evolutionary relationships remained poorly understood. Here, we report the complete mitochondrial genome of the first phytophagous species from the sub-family Epliachninae. Together with the predatory Coccinella septempunctata complete mitogenome (Kim et al., 2012), our research will contribute for understanding evolutionary relationships between these two groups of pest and beneficial predatory ladybird beetles. The complete H. pusillanima mitogenome (16,216 bp) was sequenced (GenBank Accession Number KJ131489) using the Ion Torrent sequencing platform (Xcelris Genomics Ltd., Correspondence: G. T. Behere, Division of Crop Improvement (Entomology), ICAR Research Complex for NEH Region, Umroi Road, Umiam (Barapani) – 793103, Meghalaya, India. Tel: +91-364-2570680. Fax: +91-364-2570355. E-mail: [email protected]
History Received 14 January 2014 Accepted 25 January 2014 Published online 11 March 2014
Ahmedabad, India). For genome annotation, we used MITOS (Bernt et al., 2013) and comparison with the C. septempunctata mitogenome (JQ321839). Tandem Repeat Finder (Benson, 1999) was used to identify repeat sequence patterns in the A + T region. The H. pusillanima mitogenome contained 13 protein coding genes (PCGs), 22 transfer RNA (tRNAs), 2 ribosomal RNA (rRNAs) and a control (A + T) region (Table 1). The overall genelengths were similar to the C. septempunctata mitogenome but with a much shorter A + T region in H. pusillanima (1727 bp) than in C. septempunctata (4469 bp). As with most insect mitogenomes (e.g. Crozier & Crozier, 1993), the H. pusillanima mtDNA is A-T rich with 40.2% Adenine, 38% Thymine, 8.7% Guanine, and 13.1% Cytosine. Two repeat sequences with consensus patterns of AAAATCAAAAATTTTTAAAAATTTAGCCCAA (93% matches, 2 copies, 14,878–14,938) and ATTAATAAATATTA TAAATATATATAG (82% matches, 2.5 copies, 15,900–15,964) were identified in the non-coding A + T region. Conventional coleopteran mtDNA start codons (ATN) were observed for all PCGs (ATC for cox1), with the exception of cox2 and atp6 genes which possessed the unusual TTG start codon (identified only in few Coleoptera thus far, e.g., Sheffield et al., 2008), although the TTG start codon was also identified in the cox2 gene of Philanthus triangulum (Hymenoptera, Crabonidae) (Kaltenpoth et al., 2012). All PCGs have the TAA stop codon except nad1 which has a TAG stop codon. Complete stop codons were observed for cox2 and nad1, while incomplete stop codons ending either in ‘‘T’’ or ‘‘TA’’ plus trn genes were detected in six genes (Table 1). Five PCGs (cox1, atp8, atp6, nad4l, nad6) have stop codons that were completely embedded within adjacent genes. All tRNA genes have the classic ‘‘clover-leaf’’ secondary
2
G. T. Behere et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Henosepilachna pusillanima (Mulsant) mitogenome annotation.
Mitochondrial DNA Downloaded from informahealthcare.com by Emory University on 08/04/15 For personal use only.
Name tRNA-Ile tRNA-Gln tRNA-Met ND2 tRNA-Trp tRNA-Cys tRNA-Tyr COI tRNA-Leu COII tRNA-Lys tRNA-Asp ATP8 ATP6 COIII tRNA-Gly ND3 tRNA-Ala tRNA-Arg tRNA-Asn tRNA-Ser tRNA-Glu tRNA-Phe ND5 tRNA-His ND4 ND4L tRNA-Thr tRNA-Pro ND6 CTYB tRNA-Ser ND1 tRNA-Leu rRNA-L tRNA-Val rRNA-S A + T rich region
Strand
Gene position
Gene length (bp)
Start/anti-codon
+
1–74 75–141 140–208 182–1213 1213–1277 1270–1329 1330–1390 1383–2927 2923–2985 2986–3666 3669–3737 3738–3807 3808–3960 3948–4619 4609–5394 5393–5455 5453–5809 5808–5869 5870–5932 5933–5998 5999–6053 6055–6118 6117–6180 6180–7892 7890–7951 7951–9270 9267–9551 9553–9615 9616–9678 9726–10,217 10,171–11,310 11,309–11,372 11,425–12,351 12,331–12,392 12,419–13,458 13,659–13,725 13,725–14,489 14,490–16,216
74 67 69 1032 65 60 61 1545 63 681 69 70 153 672 786 63 357 62 63 66 55 64 64 1713 62 1320 285 63 63 492 1140 64 927 62 1040 67 765 1727
GAT TTG CAT ATA TCA GCA GTA ATC TAA TTG CTT GTC ATT TTG ATT TCC ATA TGC TCG GTT TCT TTC GAA ATT GTG ATA ATG TGT TGG ATA ATG TGA ATG TAG CTC TAC TAA
+ + + + + + + + + + + + + + + + + +
+ + + +
structures, and the large and small rRNA genes were each 1040 bp and 765 bp long, respectively. No gene rearrangements were observed in the H. pusillanima mitogenome when compared with the C. septempunctata mitogenome.
Declaration of interest This study was funded by the Indian Council of Agricultural Research (ICAR) through ICAR Research Complex for NEH Region, Umiam (Meghalaya), India for the project ID: IXX08646. The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.
References Benson G. (1999). Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res 27:573–80. Bernt M, Donath A, Ju¨hling F, Externbrink F, Florentz C, Fritzsch G, Pu¨tz J, et al. (2013). MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol 69:313–19. Crozier RH, Crozier YC. (1993). The mitochondrial genome of the honeybee Apis mellifera: Complete sequence and genome organization. Genetics 133:97–117.
Stop codon
TA
TAA TAA TAA TAA T T
TA TA TAA TAA T TAG
Intergenic nucleotide 0 2 27 1 8 0 8 5 0 +2 0 0 13 11 2 3 2 0 0 0 +1 2 1 2 1 1 4 0 +47 +47 2 +52 21 +26 +200 1 0
Dharmaretnam M. (2002). A note on the elytral pattern and the bionomics of Epilachna septima in Batticola, Sri Lanka (Coleoptera, Coccinellidae). J Natl Sci Found Sri Lanka 30:23–31. Fu¨rsch H. (1990). Valid and invalid names of the Africa species of Epilachninae. Coccinella 2:45–53. Fu¨rsch H. (1991). Die Epilachnini Africa su¨dlich der Sahara (Coleoptera: Coccinellidae). Entomofauna 12:217–320. Kaltenpoth M, Corneli PS, Dunn DM, Weiss RB, Strohm E, Seger J. (2012). Accelerated evolution of mitochondrial but not nuclear genomes of hymenoptera: New evidence from Crabronid wasps. PLoS One 7:e32826. Kim MJ, Wan X, Kim I. (2012). Complete mitochondrial genome of the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae). Mitochondrial DNA 23:179–81. Li CS. (1993). Review of the Australian Epliachninae (Coleoptera: Coccinellidae). J Aust Entomol Soc 32:209–24. Li CS, Cook EF. (1961). The Epilachninae of Taiwan (Col. Coccinellidae). Pac Insect 3:30–91. Sheffield NC, Song H, Cameron SL, Whiting MF. (2008). A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles. Mol Biol Evol 25: 2499–509.
MITOGENOME ANNOUNCEMENT
Complete mitochondrial genome sequence of a phytophagous ladybird beetle, Henosepilachna pusillanima (Mulsant) (Coleoptera: Coccinellidae) G. T. Behere1, D. M. Firake1, W. T. Tay2, N. S. Azad Thakur1, and S. V. Ngachan1 1
Division of Crop Improvement (Entomology), ICAR Research Complex for NEH Region, Umroi Road, Umiam (Barapani), Meghalaya, India and Biosecurity Flagship, CSIRO Ecosystem Sciences, Black Mountain Laboratories, Canberra, Australia
Mitochondrial DNA Downloaded from informahealthcare.com by Emory University on 08/04/15 For personal use only.
2
Abstract
Keywords
Ladybird beetles are generally considered as agriculturally beneficial insects, but the ladybird beetles in the coleopteran subfamily Epilachninae are phytophagous and major plant feeding pest species which causes severe economic losses to cucurbitaceous and solanaceous crops. Henosepilachna pusillanima (Mulsant) is one of the important pest species of ladybird beetle. In this report, we sequenced and characterized the complete mitochondrial genome of H. pusillanima. For sequencing of the complete mitochondrial genome, we used the Ion Torrent sequencing platform. The complete circular mitochondrial genome of the H. pusillanima was determined to be 16,216 bp long. There were totally 13 protein coding genes, 22 transfer RNA, 2 ribosomal RNA and a control (A + T-rich) region estimated to be 1690 bp. The gene arrangement and orientations of assembled mitogenome were identical to the reported predatory ladybird beetle Coccinella septempunctata L. This is the first completely sequenced coleopteran mitochondrial genome from the beetle subfamily Epilachninae from India. Data generated in this study will benefit future comparative genomics studies for understanding the evolutionary relationships between predatory and phytophagous coccinellid beetles.
Complete sequence, Henosepilachna pusillanima, mitogenome
The coleopteran sub-family Epilachninae includes plant-eating ladybird beetles that are economically important world-wide because of their capacity to inflict significant crop damages (Li, 1993). Previously, only the genus Epilachna Dejean was recognized. However, the existence of unique morphological features in some species within genus Epilachna led to new genus Henosepilachna being erected (Fu¨rsch, 1990, 1991; Li & Cook, 1961). Both Epilachna and Henosepilachna are now considered as two distinct genera (Li, 1993) within Epilachninae. Henosepilachna species are phytophagous, with H. pusillanima (Mulsant) (previously also known as E. dodecastigma (Wiedemann) (Dharmaretnam, 2002) being one of the most important pests of cucurbitaceous crops in India. Despite the agricultural importance of Coccinellidae beetles which include both phytophagous and predatory species, their evolutionary relationships remained poorly understood. Here, we report the complete mitochondrial genome of the first phytophagous species from the sub-family Epliachninae. Together with the predatory Coccinella septempunctata complete mitogenome (Kim et al., 2012), our research will contribute for understanding evolutionary relationships between these two groups of pest and beneficial predatory ladybird beetles. The complete H. pusillanima mitogenome (16,216 bp) was sequenced (GenBank Accession Number KJ131489) using the Ion Torrent sequencing platform (Xcelris Genomics Ltd., Correspondence: G. T. Behere, Division of Crop Improvement (Entomology), ICAR Research Complex for NEH Region, Umroi Road, Umiam (Barapani) – 793103, Meghalaya, India. Tel: +91-364-2570680. Fax: +91-364-2570355. E-mail: [email protected]
History Received 14 January 2014 Accepted 25 January 2014 Published online 11 March 2014
Ahmedabad, India). For genome annotation, we used MITOS (Bernt et al., 2013) and comparison with the C. septempunctata mitogenome (JQ321839). Tandem Repeat Finder (Benson, 1999) was used to identify repeat sequence patterns in the A + T region. The H. pusillanima mitogenome contained 13 protein coding genes (PCGs), 22 transfer RNA (tRNAs), 2 ribosomal RNA (rRNAs) and a control (A + T) region (Table 1). The overall genelengths were similar to the C. septempunctata mitogenome but with a much shorter A + T region in H. pusillanima (1727 bp) than in C. septempunctata (4469 bp). As with most insect mitogenomes (e.g. Crozier & Crozier, 1993), the H. pusillanima mtDNA is A-T rich with 40.2% Adenine, 38% Thymine, 8.7% Guanine, and 13.1% Cytosine. Two repeat sequences with consensus patterns of AAAATCAAAAATTTTTAAAAATTTAGCCCAA (93% matches, 2 copies, 14,878–14,938) and ATTAATAAATATTA TAAATATATATAG (82% matches, 2.5 copies, 15,900–15,964) were identified in the non-coding A + T region. Conventional coleopteran mtDNA start codons (ATN) were observed for all PCGs (ATC for cox1), with the exception of cox2 and atp6 genes which possessed the unusual TTG start codon (identified only in few Coleoptera thus far, e.g., Sheffield et al., 2008), although the TTG start codon was also identified in the cox2 gene of Philanthus triangulum (Hymenoptera, Crabonidae) (Kaltenpoth et al., 2012). All PCGs have the TAA stop codon except nad1 which has a TAG stop codon. Complete stop codons were observed for cox2 and nad1, while incomplete stop codons ending either in ‘‘T’’ or ‘‘TA’’ plus trn genes were detected in six genes (Table 1). Five PCGs (cox1, atp8, atp6, nad4l, nad6) have stop codons that were completely embedded within adjacent genes. All tRNA genes have the classic ‘‘clover-leaf’’ secondary
2
G. T. Behere et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Henosepilachna pusillanima (Mulsant) mitogenome annotation.
Mitochondrial DNA Downloaded from informahealthcare.com by Emory University on 08/04/15 For personal use only.
Name tRNA-Ile tRNA-Gln tRNA-Met ND2 tRNA-Trp tRNA-Cys tRNA-Tyr COI tRNA-Leu COII tRNA-Lys tRNA-Asp ATP8 ATP6 COIII tRNA-Gly ND3 tRNA-Ala tRNA-Arg tRNA-Asn tRNA-Ser tRNA-Glu tRNA-Phe ND5 tRNA-His ND4 ND4L tRNA-Thr tRNA-Pro ND6 CTYB tRNA-Ser ND1 tRNA-Leu rRNA-L tRNA-Val rRNA-S A + T rich region
Strand
Gene position
Gene length (bp)
Start/anti-codon
+
1–74 75–141 140–208 182–1213 1213–1277 1270–1329 1330–1390 1383–2927 2923–2985 2986–3666 3669–3737 3738–3807 3808–3960 3948–4619 4609–5394 5393–5455 5453–5809 5808–5869 5870–5932 5933–5998 5999–6053 6055–6118 6117–6180 6180–7892 7890–7951 7951–9270 9267–9551 9553–9615 9616–9678 9726–10,217 10,171–11,310 11,309–11,372 11,425–12,351 12,331–12,392 12,419–13,458 13,659–13,725 13,725–14,489 14,490–16,216
74 67 69 1032 65 60 61 1545 63 681 69 70 153 672 786 63 357 62 63 66 55 64 64 1713 62 1320 285 63 63 492 1140 64 927 62 1040 67 765 1727
GAT TTG CAT ATA TCA GCA GTA ATC TAA TTG CTT GTC ATT TTG ATT TCC ATA TGC TCG GTT TCT TTC GAA ATT GTG ATA ATG TGT TGG ATA ATG TGA ATG TAG CTC TAC TAA
+ + + + + + + + + + + + + + + + + +
+ + + +
structures, and the large and small rRNA genes were each 1040 bp and 765 bp long, respectively. No gene rearrangements were observed in the H. pusillanima mitogenome when compared with the C. septempunctata mitogenome.
Declaration of interest This study was funded by the Indian Council of Agricultural Research (ICAR) through ICAR Research Complex for NEH Region, Umiam (Meghalaya), India for the project ID: IXX08646. The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.
References Benson G. (1999). Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res 27:573–80. Bernt M, Donath A, Ju¨hling F, Externbrink F, Florentz C, Fritzsch G, Pu¨tz J, et al. (2013). MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol 69:313–19. Crozier RH, Crozier YC. (1993). The mitochondrial genome of the honeybee Apis mellifera: Complete sequence and genome organization. Genetics 133:97–117.
Stop codon
TA
TAA TAA TAA TAA T T
TA TA TAA TAA T TAG
Intergenic nucleotide 0 2 27 1 8 0 8 5 0 +2 0 0 13 11 2 3 2 0 0 0 +1 2 1 2 1 1 4 0 +47 +47 2 +52 21 +26 +200 1 0
Dharmaretnam M. (2002). A note on the elytral pattern and the bionomics of Epilachna septima in Batticola, Sri Lanka (Coleoptera, Coccinellidae). J Natl Sci Found Sri Lanka 30:23–31. Fu¨rsch H. (1990). Valid and invalid names of the Africa species of Epilachninae. Coccinella 2:45–53. Fu¨rsch H. (1991). Die Epilachnini Africa su¨dlich der Sahara (Coleoptera: Coccinellidae). Entomofauna 12:217–320. Kaltenpoth M, Corneli PS, Dunn DM, Weiss RB, Strohm E, Seger J. (2012). Accelerated evolution of mitochondrial but not nuclear genomes of hymenoptera: New evidence from Crabronid wasps. PLoS One 7:e32826. Kim MJ, Wan X, Kim I. (2012). Complete mitochondrial genome of the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae). Mitochondrial DNA 23:179–81. Li CS. (1993). Review of the Australian Epliachninae (Coleoptera: Coccinellidae). J Aust Entomol Soc 32:209–24. Li CS, Cook EF. (1961). The Epilachninae of Taiwan (Col. Coccinellidae). Pac Insect 3:30–91. Sheffield NC, Song H, Cameron SL, Whiting MF. (2008). A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles. Mol Biol Evol 25: 2499–509.
