J. Mol. Biol. (1977) 112, 265--277
Completed DNA Sequences and Organization of Repressor-binding Sites in the Operators of Phage Lambda ZAFR: HU1KAYU1%ANDREA JEFFREY AND MARKPTASHNE
Harvard University, The Biological Laboratories Cambridge, Mass. 02138, U.S.A. (Received 23 August 1976, and in revised form 10 January 1977) We complete the determination of the DNA sequences of the bacteriophage ~t operators by presenting two new sequences, one about 38 base-pairs long from the left operator (0~), and another about 42 base-pairs long from the right operator (OR). These were determined by direct DNA sequencing. The results of experiments in which each operator was digested with nuclease in the presence of highly purified ~ repressor are also described. From the new sequence information, as well as other considerations, including the results of the nuclease digestion experiments, we conclude that each operator is smaller than previously reported and consists of three repressor-binding sites. The sequence near OR includes part of the repressor structural gene, cI.
1. Introduction The DNA of bacteriophage ~ has two operators, Or, and OR (Fig. 1), each of which consists of multiple non-identical sites specifically recognized b y the ~ repressor. Or. controls the transcription of an operon which includes gene N, whereas OR controls the transcription of an operon which includes gene tof. In addition, expression of the repressor structural gene (cI) is itself controlled positively and negatively b y the binding ofrepressor to different sites in OR (for reviews, see Herskowitz, 1974; Ptashne et al., 1976). Previous publications have reported parts of the nucleotide sequence of each operator (iKaniatis et al., 1974; Maniatis et al., 1975a; Pirrotta, 1975). We now present new results t h a t complete the sequence determination of both operators. Most of the new sequences presented in this paper were determined b y a new method for direct DNA sequencing (Gilbert et al., 1976; l~Iaxam & Gilbert, 1977), and parts were either determined or confirmed b y techniques previously reported (Sanger et al., 1973; Maniatis et al., 1975a). We also present the results of a series of experiments in which each operator was exposed to DNAase I in the presence of highly purified repressor. The new sequence information, taken with the results of the nuclease digestion experiments, clarifies a number of questions regarding the structure and size of the ~ operators. I n addition, the new sequence near the right operator is of interest because it includes a part of the cI gene. Consideration of this sequence, as well as other information has led us to propose a new model for the control of cI expression (Humayun et el., 1977a; Ptashne et al., 1976; see also Walz e~ al., 1976). 265
266
Z. H U M A Y U N ,
A. J E F F R E Y
A N D M. P T A S H N E
2. M a t e r i a l s a n d M e t h o d s
(a) Reagents, enzymes and restriction fragments All chemicals were reagent grade commercial products. 32P-labelled nucleoside triphosphates ([~-32P]dNTP) as well as inorganic 32p used in the p r e p a r a t i o n of [~-saP]ATP were purchased from New E n g l a n d Nuclear. The labelled A T P was p r e p a r e d b y a slight modification of the m e t h o d described b y Glyrm & Chappell (1964). The restriction enzymes HaeIII (from He~nophilu8 aegyptius), Hin (HindII ~ HindIII) (from H. influenzas) a n d Hph (from Hemophilus parahaemoly$icu~) were prepared as described previously (Maniatis e$ a/., 1975a; K l e i d e~ al., 1976). AluI (from Arthrobae~r luteus) was p r e p a r e d b y a slight modification of the m e t h o d of Roberts et al. (1976). Phage T4 polynucleotide kinase was prepared according to P a n e t e$ a/. (1973). Escheriehia coli D N A polymerase was a gift from W. MeClure. Bacterial akaline phosphatase, DNAase I a n d venom phosphodiesterase were purchased from W o r t h i n g t o n Biochemicals. The restriction fragments Hin 1125 and Hin 375 were prepared as described previously (Maniatis e$ al., 1973,1975a). Ha~ 790 a n d Has 340 were prepared b y digesting whole ~ D N A with H a e I I I a n d fractionation of the products b y gel electrophoresis. Alu 180 was prepared b y digesting Hae 790 with AluI a n d subsequent fractionation of the products on a gel. Hph 85 was p r e p a r e d b y similar procedures b y digesting Hin 1125 with Hph. (b) Buffers Eleetrophoresis buffer: 90 rm~-Tris-borate (pH 8.3) a n d 2.5 m ~ - E D T A . Gel extraction buffer: 0"5 ~-NaC1, 10 m~-Tris-HC1 (pH 7.4) a n d 10 m ~ - E D T A . Phosphatase buffer: 10 mM-Tris "HC1 (pH 7-4) a n d 10 m~-MgC12. Kinase buffer: 40 m ~ - g l y e i n e - N a O H (pH 9.5), 8 m~-MgC12 and 8 m~-dithiothreitol. Binding buffer: 10 mM-Tris.HC1 (pH 7.4), 2.5 mMMgC12, 1 n~-CaCl~, 50 m~-KC1, 0.1 m ~ - E D T A , 0.1 mM-dithiothreitol, 10 ~g chick blood D N A / m l and 50 ~g of bovine serum albumin/ml. W a s h buffer: 10 m~-Tris.HC1 (pH 7-4), 5 m ~ - E D T A , 2 mM-EGTA, 1 m~-dithiothreitol, 50 m~-KC1 and 5% dimethylsttlfoxide. F i l t e r extraction buffer: 10 mM-Tris.HC1 (pH 7.4), 20 mM-NaC1 and 0.2% sodium dodecyl sulfate. Methylation buffer: 50 m ~ - s o d i u m cacodylate ( p i t 8"0) and 10 m ~ MgC12. Neutral phosphate buffer: 20 mM-KsHPO4 (pH 7.5) and 5 m ~ - E D T A . Nuclease buffer: 10 m~-Tris .HC1 (pH 7.4), 10 mM-MgC12, 10 m-~-2-mercaptoethanol and 6 rn~KCI. (c) Labelling of res$rietion fragmen~ 5' ends of duplex D N A fragments were labelled b y dephosphorylation with bacterial alkaline phosphatases followed b y rephosphorylation with 32p b y T4 polynucleotide kinase as follows: 1 to 2 ~g of D N A (approx. 1 to 30 pmol for the various D N A fragments used here) were incubated with 5 ~g of bacterial alkaline phosphatase (30 to 50 units/rag) in phosphatase buffer for 30 rain at 37°C. The reaction was a t terminated and the phosphatase removed b y 3 extractions with phenol followed b y 3 extractions with ether to remove traces of phenol. Residual ether was removed b y a stream of d r y nitrogen. 100 pmol of [y-32P]ATP were a d d e d to the reaction mixture b y directly transferring 10 ~1 of a stock A T P solution (10 ~ in 75~/o ethanol). 10 ~1 of 10 × kinase buffer was a d d e d a n d the t o t a l volume adjusted to 0.1 ml with water. F i n a l l y 10 units of T4 polynucleotide kinase were a d d e d and the reactants incubated a t 37°C for 90 rain. The reaction was t e r m i n a t e d b y an extraction with phenol followed b y 3 extractions with ether. The labelled D N A was purified b y gel electrophoresis except in cases where restriction cleavage subsequent to the kinase reaction was necessary. I n these cases, the labelled D N A was precipitated with ethanol (0.1 vol. of 20% sodium acetate, 3 vol. of 95~o ethanol and 50 ~g carrier t R N A ) , a n d then redissolved in the appropriate restriction enzyme buffer. The cleavage products were finally purified b y gel electrophoresis. The s t r a t e g y for selectively labelling the ends of duplex D N A fragments is summarized in Fig. 2. Restriction fragments were internally labelled b y nick translation (Maniatis et al., 1975a) using all four (~-32P)-labelled deoxyribonueleoside triphosphates. The labelled D N A was purified b y gel filtration on Sephadex G50 and b y gel electrophoresis.
SEQUENCES
AND
STRUCTURE
OF h OPERATORS
267
(d) Gel electrophoresia and rot,every qf D N A from gels Techniques for preparing the restriction fragments Hin 1125, Hin 375, H a , 790 and Ha* 340 were similar to those described b y Maniatis e t a l . (1973). F o r t h e analysis or purification of most of the labelled D N A fragments, either 12% or 15% polyacrylamide slab gels (20 cm × 20 cm × 0"3 era) with an acrylamide/bisacrylamide ratio of 30:1 were used. D N A fragments were recovered from gels after electrophoresis as follows: the portion of the gel containing the specific D N A fragment was cut out a n d crushed to a fine consisteney in a plastic t u b e with a glass rod. A p p r o x i m a t e l y 2 vol. of gel e x t r a c t i o n buffer a n d 1 vol. of phenol were a d d e d a n d the contents incubated for 12 to 24 h a t 37°C with occasional vortexing. The aqueous layer, which contained most of the D N A , was recovered b y centrffugation a n d traces of phenol were removed b y 3 extractions with ether. The D N A was recovered b y precipitation with ethanol.
(e) D1VA sequencing methods The nuclease p a r t i a l digest m e t h o d was a modification of the m e t h o d of Sanger e t a l . (1973) as described b y Maniatis e t a l . (1975a). P a r t i a l products from combined digestion of terminally labelled D N A with DNAaso I a n d venom phosphodiesterase were fractiona~ed electrophoretically in one dimension a n d b y h o m o e h r o m a t o g r a p h y in t h e second dimension. The dimethyl sulfate-hydrazine m e t h o d for direct D N A sequencing is described b y Gilbert etal. (1975) and M a x a m & Gilbert (1977). W e have found t h a t the sequence of the first few base-pairs (up to 5 nucleotides from the labelled end) has usually been difficult to ascertain b y t h e DMS-HZ~f method, a n d we have relied on t h e p a r t i a l nuclease digestion m e t h o d for confirmatory evidence for this p a r t of t h e sequence. (f) l~'ractionation and visualization of D1VA cleavage products The fractionation o f I ) N A cleavage products was carried o u t on polyacrylamide/urea slab gels (20 cm × 40 cm × 0"3 cm) containing 20% acrylamide, 0-67% bisacrylamide and 7 M-urea in half-strength electrophoresis buffer (i.e. 45 m~-Trls-borate (pH 8.3) and 1.25 ml~-EDTA). Electrophoresis was carried out in the same buffer a t 600 to 1000 V for a suitable length of time (usually 10 to 30 h) depending on the e x t e n t of sequence information sought. A f t e r electrophoresis, t h e D N A bands were visualized b y autoradiography, the gels being frozen during prolonged exposure to minimize diffusion o f bands. (g) Nuclease digestion of operators in the presence of represser A sample (0.1 pmol) of the internally labelled restriction fragment (Ha* 790 for Ca or H a , 340 for 0L) was i n c u b a t e d with represser (electrophoretic p u r i t y greater t h a n 99%, a gift from R o b e r t Sauer) in binding buffer for 20 rain a t 20°0 followed b y an additional incubation for 10 rain a t O°C. The represser concentration ranged from approx. 0-02 to 20 picoequivalents (represser concentrations are expressed in equivalents per liter, one equivalent being the a m o u n t of represser which binds one reel of operator; see Chadwick etal., 1970 for t h e m e t h o d of determination). DNAaso I (2000 to 2500 units/rag) was a d d e d to a final conch of 0" 1 m g / m l a n d t h e D N A digested for 3 rain a t 0°C, a t t h e end of which the r e a c t a n t s were filtered through a nitrocellulose m e m b r a n e filter (Schleicher & Schull, B-6, 25 mm). The filter was washed with 2 ml of wash buffer and the D N A t r a p p e d on the filter was e x t r a c t e d with 0-3 rul of filter extraction buffer a n d precipitated with ethanol. The D N A in the pellet was fractionated on a 12% polyacrylamide gel. Pyrimidine t r a c t analyses were carried o u t on t h e various p r o t e c t e d fragments essentially according to t h e methods of Ling (1972a,b). Sizes of fragments were determined b y gel electrophoresis as described b y Maniatis e t a l . (1975b) using as markers D N A duplexes of known sequences 29, 45 and 74 base-pairs long.
t Abbreviation used: DMS-HZ, dimethyl sulfate-hydrazine. 18
268
Z. HUMAYUN, A. J E F F R E Y AND M. PTASHNE
3. Results (a) Restriction fragments used in DNA sequencing Figure 1 shows some relevant restriction endonuclease cleavage sites in and around the A operators as well as the approximate sizes of some restriction fragments. The left end of Hin 1125 is produced by a cut within, and therefore contains a part of, the left operator. The new O~ sequence reported in this paper was derived by sequencing the fragment Alu/Itin 85, produced by a Hin cut within Oa and an Alu cut to the left of Oa. This fragment was conveniently prepared by digesting Hae 790 (a fragment containing the entire Oa) with Hin and AluI by one of the following two methods: Hae 790 was digested with AluI to produce Alu 180, which in turn was isolated and digested with Hin to produce Alu/Hin 85; alternatively, Hae 790 was first digested with Hin to obtain Hin 375, which in turn was isolated and cleaved with Alu to produce Alu/Hin 85.
N
cI OL
tof Os'~-> J
~
l
Hoem
~
H/n'ff
I
I
HphHoe m
Hae Ill
H/r/TR
I
Hoe I~
Hm IT[
A/u I
A/u I
Fro. 1. Diagrammatic representation of p a r t of the genome of phage 4. Sites of some restriction endonuclease cleavages in a n d a r o u n d the operators 0,. a n d Ok are shown. Distances between certain of these cleavage sites are indicated in ba~e-pairs. Directions of transcription of N, cI, a n d Iof are indicated b y w a v y arrows.
(b) DNA sequence of the left operator The restriction fragment Hin 1125 was labelled at both ends and then digested with HaeIII to generate the fragment Hin/Hae 190 in which the Hin end (i.e. the operator end) was labelled (Fig. 2). A sequence of about 50 base-pairs from the labelled end was derived from a number of DMS-HZ gels, two representative examples of which are given in Figure 3(a) and (b). The first 14 base-pairs of this sequence (the bases bracketed by Hin and Hph cleavage sites in Fig. 5) are in perfect agreement with the sequence previously determined by different methods. One part of the new sequence was confirmed by partial nuclease digestion of a fragment obtained by T4 endonuclease IV (see Maniatis et al., 1975a) digestion of an internally labelled restriction fragment Hph 85, which in turn was isolated by Hph digestion of the fragment Hin 1125. Another part of this sequence was confirmed by partial nuclease digestion of terminally labelled r-strand of Hph 85 (D. Kleid & Z. Humayun, unpublished data).
SEQUENCES AND STRUCTURE OF ~ OPERATORS
Hin 1125
P
P
Hin 375 P
Kinase P*
P*.
l Hoe l"t'r ~
Hoe/H/n* 190
.p
Kinase p*
p*.__
Alu 180
P
P
p,
Kinase p*
P~.
~ A/u T p,
269
~ H/'n
P*-
p*
t
A/ulHin*85
~
~
t
Alu*lHin
p*
85
Fro. 2. Diagrammatic representation of the procedure used to label specific ends of restriction fragments used for sequencing. BAP is bacterial alkaline phosphatase, and kinase is T4 polynucleotide kinase. P, unlabelled end; P*, labelled end.
(c) Sequence of the right operator region The restriction fragment Alu/Hin 85 was prepared labelled specifically at one or the other end as outlined in Figure 2. The sequence from the Alu end was determined by a combination of the DMS-HZ (Fig. 3(c)) and partial nuclease digestion methods (Fig. 4). The sequence from the Hin end was determined by the DMS-HZ method (Fig. 3(d)). The first 43 base-pairs from the Hin end confirm a sequence reported previously (Maniatis et al., 1975a; Pirrotta, 1975). The new sequence which lies beyond the Hph cut is amply confirmed by the extensive overlaps between the sequences determined from each end. (d) Protection of Or. and OR from nuclease by repressor The results of experiments in which internally labelled Hae 340 (0~.) or Hae 790 (OR) was exposed to nuclease in the presence of varying concentrations of highly purified ~ repressor are given in Figure 6. At OR, DNA fragments of three sizes, approximately 25 (I), 50 (II), and 80 base-pairs (III) long, were protected depending on the repressor/operator ratio. The width of the band formed by fragment I on polyacrylamide gels indicates that its length varies from the mean of 25 base-pairs by ! 4 base-pairs; in some experiments two or three discrete bands in this size range were observed. Presumably fragments II and I I I also have frayed ends. At low repressor concentrations, predominantly fragment I was protected; with increasing repressor concentration, fragments II and I I I were protected, with I I I being the predominant species at high repressor concentrations. The largest fragment was about 80 base-pairs long even at 200-fold excess of repressor. At 0,., precisely the same results were observed with one exception: at repressor concentrations where fragment I I I was the predominant species protected, fragment II was replaced by a fragment (IIa) about five base-pairs smaller than fragment II. Each of the fragments protected at OL and OR was recovered from gels and further examined by pyrimidine tract analysis and cleavage by Hin. Table 1 lists the characteristic pyrimidine tracts found in the operator sequences (Fig. 5) and shows which of these are present in each protected fragment. At Om each successively larger fragment contains the pyrimidine tracts present in the smaller one plus additional pyrimidine tracts. Fragment I contains the pyrimidine tracts in the region designated OR1 plus a few bases on either side (see Fig. 5). Fragment II has additional pyrimidine tracts characteristic of the region in and around OR2 and fragment I I I contains
FIG. 3
SEQUENCES
AND STRUCTURE
OF A OPERATORS
271
pyrimidine tracts from the whole operator. These results indicate that the represser first binds to a region which includes OR1 and then adds sequentially to cover OR2 and OR3. Analogous results, with one exception, were found at OL. Thus, the pyrimidine tracts indicate that represser first covers a region around 0~.1 and then adds sequentially to cover OT,2 and 0T.3. The anomaly at OT. concerns the fragment IIa. Pyrimidine tract analysis indicates that this fragment includes 0~2 and OL3, but not OL1. As indicated above, the nuclease digestion does not always produce fragments with precisely defined ends. In one experiment, the DNA band representing the smallest protected fragment in OL was excised from the gel in two parts, one part being the fastest migrating segment, and the other the slowest. Both segments contained pyrimidine tracts expected from OL1 (T,TC,C2), but only the slower migrating portion contained Ts and C2T. Digestion of various protected fragments with Hin (not shown) confn'ms their origin deduced on the basis of pyrimidine tract analysis. Thus, considering protected fragments from OR, fragment III was cut into two pieces, about 50 and 30 base-pairs long; fragment II was cut to yield two fragments, about 20 and 30 base-pairs long; and fragment I was apparently not cleaved. Fragments I, II, and III derived from OL gave results analogous to those from OR. Fragment IIa was not cleaved by Hin, a result consistent with the conclusion that it includes DI~A in the region of OL2 and OL3, but not OL1.
FIG. 3. F r a e t i o n a t i o n of products of base-specific degradation of end-labelled restriction fragments. B P B is b r o m p h e n o l blue a n d X C is xylene cyanol. U n d e r the experimental conditions, D N A fragments approximately 10 nucleotides long r u n w i t h b r o m p h e n o l blue a n d fragments a b o u t 30 nucleotides long r u n with xylene eyanol. The n u m b e r s indicate the distance of the nucleotide from the labelled terminus. (a) Hin*/Hae 190 (asterisk denotes labelled end). The labelled f r a g m e n t was subjected to controlled chemical degradation as described in Materials a n d Methods. The p r o d u c t s were fractionated on a gel a t 500 V until the xylene cyanol was 2 in from t h e b o t t o m of the gel. The first vsrtical column ( " G " ) represents a purine-specific reaction (partly G-specific). The darker b a n d s are due to s t r a n d breakage a t the G sites, a n d the lighter b a n d s are due to breakage a t the Asit~s. The second vertical column ( " A " ) is a purine-specific reaction (partly A-specific). I n this case, the darker b a n d s are due to s t r a n d breakage a t the A sites a n d the lighter b a n d s are due to s t r a n d breaks a t G sites. The t h i r d vertical column ("TIC") is a pyrimidine-specific reaction, each b a n d reflecting s t r a n d breakage a t the site of a T or C. A t i g h t i n t e r m e s h i n g between the b a n d p a t t e r n s of t h e purine-specitle reactions a n d t h e pyrimidine-specific reactions is observed. Together, these 3 columns provide three-fourths of all the information necessary for d e t e r m i n a t i o n of the sequence of the D N A segment resolved on the gel (i.e. the sequence between the 27th a n d a b o u t the 55th base-pair). (b) Hin*/Hae 190. This gel shows the sequence of a larger segment of the same D N A as in (a), a n d provides all the information needed to determine the sequence between ~he l l t h a n d the 55th base-pairs from the labelled end. The first vertical column is a G-specific reaction, showing b a n d s produced b y cleavage a t G sites. The second col~mn is purine-specific (partly A-specific). The t h i r d column is pyrimidine-specifie, whereas t h e f o u r t h column indicates only C sites. (e) Alu[Hin* 85. The columns G, A, T, a n d C are, respectively, G-specific, purine-specific (partly A-specific), pyrimidine.specific a n d C-specific. The products of the pyrimidine a n d Cspecific reactions h a v e been slightly r e t a r d e d b y the gel, presumably due to incomplete removal of piperidine a n d reaction by-products, b u t the p u r i n e - p y r i m i d i n e intermeshing can be visualized b y m e n t a l l y m o v i n g the pyrimidine b a n d s f u r t h e r down the gel. The sequence t h a t can be derived from this gel extends from the 23rd nueleotide to the 80th nueleotide from the Hin end. P a r t of this sequence has already been determined b y i n d e p e n d e n t m e t h o d s (Maniatis e$ td., 1975a; P i r r o t t a , 1975). (d) Alu*]Hin 85. This gel shows the sequence of t h e opposite s t r a n d of t h e D N A f r a g m e n t analyzed in (e). Once again, the pyrimidine b a n d s are slightly r e t a r d e d compared to the purine bands, a n d m u s t be m e n t a l l y transposed to read t h e sequence.
272
Z. H U M A Y U N ,
A. J E F F R E Y
A N D M. P T A S H N E
Fig. 4. Sequence determination of the ~IZ~ e n d o f ~l~u*/H~ 85 b y partial nuclease digestion. A p p r o x h n a t e l y 0.01 ~g of the labelled D N A f r a g m e n t a n d 15 ~g o f tRl~TA were incubated w i t h 2 ng of DNAase I a n d 0.5 ~g of v e n o m phosphodiesterase for 15 rain at 37°C in nuelease buffer. A second reaction ~vas carried out exactly as above except t h a t the a m o u n t of DNAase I added was 0.2 ng. The two reaction products were combined and fractionated b y electrophoresis a t p H 3.5 on a cellulose acetate strip followed b y a second fractionation in the second dimension b y homoehroma~ography on a DEAE-cellulose t h i n layer. The homo m i x no. 3 of J a y e~ al. (1974) was used.
i¥
I
i
0.5 .
0.2 w
|
H/nIT
I
Hph
H i n Tr
Hph
t
!
~
I tof
Hph
i
I
I
/
'~
st
FIG. 5o I ) N A sequences o f O:a a n d OL. Note t h a t the orientation of the OL sequence has been reversed from its customary presentation in t h e m a p o f l~he genome. I n each operator, t h e regions between t h e $ vertical broken lines represent new sequences described in this paper. The 17-base-pair repressor binding si~es are boxed within each operator. The solid horizontal lines indicate the segments of D N A whose sequence was determined b y t h e m e t h o d s indicated. "Nuclease partial" stands for partial digestion with nuclease. Sites o f restriction enzyme cuts are indicated b y arrows. The transcription initiation sites for genes N, tof, and cI are indicated. The amino-terminal amino acids of the cI product (~ repressor) as well as the 5' end of the cI mRt~A are from P t a s h n e ¢~ a~. (1976).
DMS-HZ(H/n end)
"
ATTTTTTGTATGTCTA~GACG~CA~T--~TTA~ATAGAGAccG~AcAAc~TGTATTT]ATGGTGAccG~cAcTAT~GACTCGTGTAGTc
EndoI~Z/Nucleasepartial ~ ~ , ;I Nucleasepartialil
t
~CCTCTGGCG~GATAIATG~r~AT~A3
0,I
OL3 ~, OL2 ~ all J, N ~;TAAAAAACATACAGATIAACCATCTGCGGTGATA~ AA~TATCTCTGGCGGTGTTGIACATAAAtTACCACTGGC GGTGATAICTGAGC~CIAT~,'
- Leu-GIn-Glu-GIn-Thr-Leu-Pro-Lys-L~-Lys-Thr-Ser-NH~
.e-.............................. ~UA~
.,AGYcTGCTCTTGTGI"TAATGGTTTCTTTTTTGTGCTC ATACGTTAAATC~AT~CCGC~G~TAI~TA~ITAA~G TGc G T G ~ A ~
~sI
I.[
I Ip
cI
l~/ul
j
Ii IIH, h
end)
i .
DMS-HZ(Alu
I DMS-HZ ( H / n e n d ) i
I I .
I
!
I Nuclease partial
i= ,
i
Z. H U M A Y U N , A. J E F F R E Y AND M. P T A S H N E
274
TABLE 1
Pyrimidine tract analysis of D N A fragments lorotected from nuclease digestion by various concentrations of repressor Characteristic
Band I
Band II
Band IIa
OL TC2
~-
-t-
--
T2C
--
--
-]-
OR T2C3 T4 T3 T2C T3C3
-~ ~----
~ W -+ __
pyrimidine tract
Band III
-t-
~-~ ~~-
DNA fragments bearing OLand ORwere digested, separately, in the presence of varying amounts of repressor as in Fig. 6. The products were subjected to gel electrophoresis as in Fig. 6, and the protected fragments in the various bands were eluted and analyzed for pyrimidine tracts. The composition of a fragment found in a given band was independent of the repressor concentration used to protect the fragment. For example, in the experiment of Fig. 6, OR band I isolated from column 1 was identical to OR band I isolated from the other columns.
4. D i s c u s s i o n The data presented in this paper complete the nucleotide sequences of the h operators. Each operator spans some 80 base-pairs and includes three sequences t h a t fit the description of repressor binding sites as proposed b y l~aniatis et al. (1975c). These sites, designated OL1, 0,,2, and 0,.3 in the left operator and 0~1, OR2, and Og3 in the right operator, are 17 base-pairs long and are strikingly similar to each other, with an axis of partial rotational s y m m e t r y passing through the ninth base-pair in each site. Within each operator, the three sites are separated from each other b y A-~-T-rich spacers (Fig. 5). For a review of arguments t h a t have led to the identification of these sites, see Ptashne et al. (1976). The nuclease digestion experiments described in this paper are consistent with the conclusion t h a t each operator contains three sites for binding repressor. Thus, when D N A bearing OR was digested in the presence of repressor, three fragments, nominally 25, 50, and 80 base-pairs long, were obtained depending on the ratio of repressor to operator DNA. At the lowest repressor concentrations, mostly the 25 base-pairs fragment was protected, together with traces of the larger fragments. As the repressor concentration was increased, larger fragments were protected up to a point where mostly the largest fragment (80 base-pairs) was protected. Pyrimidine t r a c t analysis reveals t h a t (a) the 25 base-pair fragment contains OR1 plus a few base-pairs on either side, (b) the 50 base-pair fragment contains 0R 1 -~ 0R 2 plus a few base-pairs on either side as well as those in between the two binding sites, and (c) the largest fragment (80 base-pairs) contains the entire right operator. These results indicate t h a t the repressor binds to 0R1 first and then sequentially to 0R2 and 0R3, as indicated b y the results of previous experiments (Maniatis & Ptashne, 1973a,b; Maniatis et al., 1973). The results with 0,. are
SEQUENCES AND STRUCTURE
OF A OPERATORS
275
FIG. 6. Polyacrylamide gel fractionation of DNA fragments protected by various amounts of Arepresser. For each operator, the vertical columns numbered 1 to 6 show the protected fragments obtained when the reaction mixture contained 0.1 pmol of labelled operator-containing DNA (Hae 340 or Hae 790) and, respectively, 0.02, 0.05, 0.1, 0.5, 2, and 10 picoequivalents of represser. The 3 major bands (I, II, and I I I ) were sized by comparison with 2 DNA fragments of known chain length (Alu/Hin 85 and Hin/Hph 45; see Figs 1 and 5) and were found to be about 25 (I), 50 (II), and 80 base-pairs (III) long. Band I I a from Ou was about 45 base-pairs long.
s i m i l a r t o t h o s e w i t h OR in t h a t t h e r e p r e s s e r first b i n d s t o OL1 t o p r o t e c t a 25 basep a i r f r a g m e n t f r o m nuclease digestion, a n d t h e n s e q u e n t i a l l y b i n d s t o 0,.2 a n d Or.3 t o p r o t e c t 50 a n d 80 b a s e - p a i r f r a g m e n t s . One u n e x p e c t e d difference is t h a t a t h i g h r e p r e s s e r c o n c e n t r a t i o n s , a 45 b a s e - p a i r f r a g m e n t c o n t a i n i n g t h e t w o s e c o n d a r y sites, in t h i s ease OL2 a n d 0L3, b u t n o t 0L1, is p r o t e c t e d in a d d i t i o n t o t h e e n t i r e left o p e r a t o r . This f r a g m e n t is, as e x p e c t e d , s m a l l e r t h a n t h a t w h i c h includes 0T1
276
Z. HUMAYUN, A. J E F F R E Y AND M. PTASHNE
OL2, because the spacer between OL2 and OL3 is smaller than the spacer between OT.1 and OT2. The A repressor is an oligomer of identical subunits and the oligomers are in concentration-dependent equilibrium with monomers. I t is possible that at high repressor concentrations, the repressor assumes a configuration that enables it to bind 0T.2 ~- On3 with relatively high af~nlty. Alternatively, it is possible that DNAase can cleave between OT.1 and OT.2, but not between 0~.2 and 0T.3, when the operator is covered with repressor. The results of repressor protection experiments reported here differ somewhat from those reported earlier (Maniatis & Ptashne, I973a; Maniatis et at., 1973). In the earlier experiments, six fragments with sizes varying from 35 to I10 base-pairs were isolated from each operator. The smallest fragment contained OL1 or OR1 as in our present results, although intermediate-sized fragments as well as a fragment larger than the largest reported here were also found. Our present results are more readily explained by the operator sequences. A three-site structure for the ~ operators is also consistent with experiments being published elsewhere (Humayun e~ al., 1977b), in which we show, by studying DNA methylation in the presence of repressor (cf. Gilbert et a/., 1976), that the repressor contacts specific bases within the three binding sites but not beyond them. Another minor disagreement with the earlier work is that, apparently, higher repressor concentrations are required in the current nuclease protection experiment to protect the complete operator. We do not know why the results of our current nuclease protection experiments differ from those obtained previously, but they were performed differently in three ways: first, we now use more highly purified repressor; second, we now use specific operator-containing restriction endonuelease fragments isolated from polyacrylamide gels whereas previously we used a more heterogeneous preparation of operatorcontaining fragments; and third, we now use DNA molecules labelled with 32p by nick translation whereas previously we used DNA labelled with s2p in vivo. The new sequence near the right operator includes a part of the structural gene for the repressor (Fig. 5) and shows some unusual features. Thus, there is an ATG triplet 10 base-pairs beyond OR3, immediately followed by the codons for the 11 amino-terminal amino acids of the rcpressor. The ATG triplet functions both as a transcriptional and translational start-point, a hitherto unknown phenomenon. This and other features of this sequence, as argued elsewhere (Humayun eta/., 1977a; Ptashne et al., 1976; Walz et al., 1976), indicate that the expression ofcI is subject to a form of translational control. Moreover, as described elsewhere (Ptashne et al., 1976; Walz et al., 1976), the interaction of the repressor with the various binding sites in OR controls CI transcription both positively and negatively. We are grateful to A. Maxam and W. Gilbert for communicating their sequencing method prior to publication. REFERENCES Chadwick, P., Pirrotta, V., Steinberg, R., Hopkins, N. & Ptashne, M. (1970). GoldSpring Harbor ~ymp. Quant. Biol. 35, 283-294. Gilbert, W., Maxam, A. & Mirzabekov, A. (1976). In Gontrol o] Ribosome Synthesis (Kjeldgaard, N. & Maaloe, 0., eds), The Alfred Benzon Symposium IX, pp. 139-148, Munksgaard, Copenhagen. Glynn, I. M. & Chappell, J. B. (1964). Biochera. J. 90, 147-149. Herskowitz, I. (1974). Annu. R~v. Genet. 7, 289-324.
SEQUENCES
AND
STRUCTURE
OF A OPERATORS
277
Humayun, Z., Meyer, B., Sauer, R., Backman, K. & Ptashne, M. (1977a). In Molecular Mechanisms in Control of Gene Expression (Nierlich, D. P., Rutter, W. J. & Fox, F., eds), Proe. ICi~-UCLA Symp. Mol. Ceil. Biol., vol, 5, Academic Press, San Francisco, in the press. Humayun, Z., Kleid, D. & Ptashne, M. (19775). Nuel. Acids Re~. in the press. Jay, E., Bambara, 1~., Padmsa~abhan, R. & Wu, R. (1974). Arucl. Ao/d8/~es. 1, 331-353. Kleid, D., Humaytm, Z., Jeffrey, A. & Ptashne, M. (1976). Proc. Nat. Acad. Sci., U.S.A. 73, 293-297. Ling, V. (1972a). Proc. Nat. Acad. Se/., U.S.A. 69, 742-746. Ling, V. (1972b). J. Mol. Biol. 64, 87-102. Maniatis, T. & Ptashne, M. (1973a). Proe. Nat. Lead. Sei., U.S.A. 70, 1531-1535. Maniatis, T. & Ptashne, M. (1973b). Nature (London), 246, 133-136. Maniatis, T., Ptashne, M. & Maurer, R. (1973). Cold Spring Harbor Syrup. Quant. Biol. 38, 857-863. Maniatis, T., Ptashne, M., Barrell, B. G. & Donelson, J. (1974). Nature (London), 250, 394-397. Maniatis, T., Jeffrey, A. & Kleid, D. (1975a). Proc. Nat. Aead. Sci., U.S.A. 72, 1184-1188. Maniatis, T., Jeffrey, A. & van de Sande, H. (1975b). Biochemistry, 14, 3787-3794. Maniatis, T., Ptashne, M., Backman, K., Kleid, D., Flashman, S., Jeffrey, A. & Maurer, R. (1975c). Cell, 5, 109-113. Maxam, A. & Gilbert, W. (1977). Proe. Nat. Acad. Sci., U,S.A. (1977), PNAS, 74, 560-564. Panet, A., van de Sande, J. H., Loewen, P. C., Khorana, H. G., Raa~, A. J., Liilehaug, J. L. & Kleppe, K. (1973). Biochemistry, 12, 5054-5050. Pirrotta, V. (1975), Nature (London), 254, 114-117. Ptashne, M., Backman, K., Humayun, M. Z., Jeffrey, A., Maurer, R., Meyer, B. & Sauer, R. T. (1976). Science, 194, 156-161. Roberts, R. J., Myers, P. A., Morrison, A. & Murray, K. (1976). J. Mol. Biol. 192, 157-165. Sanger, F., Donelson, J. E., Coulson, A. R., Kossel, H. & Fischer, D. (1973). Proe. Nat. Aead. Sei., U.S.A. 70, 1209-1213. Walz, A., Pirrotta, V. & Ineiehen, K. (1976). Nature (London), 262, 665-669.
Completed DNA Sequences and Organization of Repressor-binding Sites in the Operators of Phage Lambda ZAFR: HU1KAYU1%ANDREA JEFFREY AND MARKPTASHNE
Harvard University, The Biological Laboratories Cambridge, Mass. 02138, U.S.A. (Received 23 August 1976, and in revised form 10 January 1977) We complete the determination of the DNA sequences of the bacteriophage ~t operators by presenting two new sequences, one about 38 base-pairs long from the left operator (0~), and another about 42 base-pairs long from the right operator (OR). These were determined by direct DNA sequencing. The results of experiments in which each operator was digested with nuclease in the presence of highly purified ~ repressor are also described. From the new sequence information, as well as other considerations, including the results of the nuclease digestion experiments, we conclude that each operator is smaller than previously reported and consists of three repressor-binding sites. The sequence near OR includes part of the repressor structural gene, cI.
1. Introduction The DNA of bacteriophage ~ has two operators, Or, and OR (Fig. 1), each of which consists of multiple non-identical sites specifically recognized b y the ~ repressor. Or. controls the transcription of an operon which includes gene N, whereas OR controls the transcription of an operon which includes gene tof. In addition, expression of the repressor structural gene (cI) is itself controlled positively and negatively b y the binding ofrepressor to different sites in OR (for reviews, see Herskowitz, 1974; Ptashne et al., 1976). Previous publications have reported parts of the nucleotide sequence of each operator (iKaniatis et al., 1974; Maniatis et al., 1975a; Pirrotta, 1975). We now present new results t h a t complete the sequence determination of both operators. Most of the new sequences presented in this paper were determined b y a new method for direct DNA sequencing (Gilbert et al., 1976; l~Iaxam & Gilbert, 1977), and parts were either determined or confirmed b y techniques previously reported (Sanger et al., 1973; Maniatis et al., 1975a). We also present the results of a series of experiments in which each operator was exposed to DNAase I in the presence of highly purified repressor. The new sequence information, taken with the results of the nuclease digestion experiments, clarifies a number of questions regarding the structure and size of the ~ operators. I n addition, the new sequence near the right operator is of interest because it includes a part of the cI gene. Consideration of this sequence, as well as other information has led us to propose a new model for the control of cI expression (Humayun et el., 1977a; Ptashne et al., 1976; see also Walz e~ al., 1976). 265
266
Z. H U M A Y U N ,
A. J E F F R E Y
A N D M. P T A S H N E
2. M a t e r i a l s a n d M e t h o d s
(a) Reagents, enzymes and restriction fragments All chemicals were reagent grade commercial products. 32P-labelled nucleoside triphosphates ([~-32P]dNTP) as well as inorganic 32p used in the p r e p a r a t i o n of [~-saP]ATP were purchased from New E n g l a n d Nuclear. The labelled A T P was p r e p a r e d b y a slight modification of the m e t h o d described b y Glyrm & Chappell (1964). The restriction enzymes HaeIII (from He~nophilu8 aegyptius), Hin (HindII ~ HindIII) (from H. influenzas) a n d Hph (from Hemophilus parahaemoly$icu~) were prepared as described previously (Maniatis e$ a/., 1975a; K l e i d e~ al., 1976). AluI (from Arthrobae~r luteus) was p r e p a r e d b y a slight modification of the m e t h o d of Roberts et al. (1976). Phage T4 polynucleotide kinase was prepared according to P a n e t e$ a/. (1973). Escheriehia coli D N A polymerase was a gift from W. MeClure. Bacterial akaline phosphatase, DNAase I a n d venom phosphodiesterase were purchased from W o r t h i n g t o n Biochemicals. The restriction fragments Hin 1125 and Hin 375 were prepared as described previously (Maniatis e$ al., 1973,1975a). Ha~ 790 a n d Has 340 were prepared b y digesting whole ~ D N A with H a e I I I a n d fractionation of the products b y gel electrophoresis. Alu 180 was prepared b y digesting Hae 790 with AluI a n d subsequent fractionation of the products on a gel. Hph 85 was p r e p a r e d b y similar procedures b y digesting Hin 1125 with Hph. (b) Buffers Eleetrophoresis buffer: 90 rm~-Tris-borate (pH 8.3) a n d 2.5 m ~ - E D T A . Gel extraction buffer: 0"5 ~-NaC1, 10 m~-Tris-HC1 (pH 7.4) a n d 10 m ~ - E D T A . Phosphatase buffer: 10 mM-Tris "HC1 (pH 7-4) a n d 10 m~-MgC12. Kinase buffer: 40 m ~ - g l y e i n e - N a O H (pH 9.5), 8 m~-MgC12 and 8 m~-dithiothreitol. Binding buffer: 10 mM-Tris.HC1 (pH 7.4), 2.5 mMMgC12, 1 n~-CaCl~, 50 m~-KC1, 0.1 m ~ - E D T A , 0.1 mM-dithiothreitol, 10 ~g chick blood D N A / m l and 50 ~g of bovine serum albumin/ml. W a s h buffer: 10 m~-Tris.HC1 (pH 7-4), 5 m ~ - E D T A , 2 mM-EGTA, 1 m~-dithiothreitol, 50 m~-KC1 and 5% dimethylsttlfoxide. F i l t e r extraction buffer: 10 mM-Tris.HC1 (pH 7.4), 20 mM-NaC1 and 0.2% sodium dodecyl sulfate. Methylation buffer: 50 m ~ - s o d i u m cacodylate ( p i t 8"0) and 10 m ~ MgC12. Neutral phosphate buffer: 20 mM-KsHPO4 (pH 7.5) and 5 m ~ - E D T A . Nuclease buffer: 10 m~-Tris .HC1 (pH 7.4), 10 mM-MgC12, 10 m-~-2-mercaptoethanol and 6 rn~KCI. (c) Labelling of res$rietion fragmen~ 5' ends of duplex D N A fragments were labelled b y dephosphorylation with bacterial alkaline phosphatases followed b y rephosphorylation with 32p b y T4 polynucleotide kinase as follows: 1 to 2 ~g of D N A (approx. 1 to 30 pmol for the various D N A fragments used here) were incubated with 5 ~g of bacterial alkaline phosphatase (30 to 50 units/rag) in phosphatase buffer for 30 rain at 37°C. The reaction was a t terminated and the phosphatase removed b y 3 extractions with phenol followed b y 3 extractions with ether to remove traces of phenol. Residual ether was removed b y a stream of d r y nitrogen. 100 pmol of [y-32P]ATP were a d d e d to the reaction mixture b y directly transferring 10 ~1 of a stock A T P solution (10 ~ in 75~/o ethanol). 10 ~1 of 10 × kinase buffer was a d d e d a n d the t o t a l volume adjusted to 0.1 ml with water. F i n a l l y 10 units of T4 polynucleotide kinase were a d d e d and the reactants incubated a t 37°C for 90 rain. The reaction was t e r m i n a t e d b y an extraction with phenol followed b y 3 extractions with ether. The labelled D N A was purified b y gel electrophoresis except in cases where restriction cleavage subsequent to the kinase reaction was necessary. I n these cases, the labelled D N A was precipitated with ethanol (0.1 vol. of 20% sodium acetate, 3 vol. of 95~o ethanol and 50 ~g carrier t R N A ) , a n d then redissolved in the appropriate restriction enzyme buffer. The cleavage products were finally purified b y gel electrophoresis. The s t r a t e g y for selectively labelling the ends of duplex D N A fragments is summarized in Fig. 2. Restriction fragments were internally labelled b y nick translation (Maniatis et al., 1975a) using all four (~-32P)-labelled deoxyribonueleoside triphosphates. The labelled D N A was purified b y gel filtration on Sephadex G50 and b y gel electrophoresis.
SEQUENCES
AND
STRUCTURE
OF h OPERATORS
267
(d) Gel electrophoresia and rot,every qf D N A from gels Techniques for preparing the restriction fragments Hin 1125, Hin 375, H a , 790 and Ha* 340 were similar to those described b y Maniatis e t a l . (1973). F o r t h e analysis or purification of most of the labelled D N A fragments, either 12% or 15% polyacrylamide slab gels (20 cm × 20 cm × 0"3 era) with an acrylamide/bisacrylamide ratio of 30:1 were used. D N A fragments were recovered from gels after electrophoresis as follows: the portion of the gel containing the specific D N A fragment was cut out a n d crushed to a fine consisteney in a plastic t u b e with a glass rod. A p p r o x i m a t e l y 2 vol. of gel e x t r a c t i o n buffer a n d 1 vol. of phenol were a d d e d a n d the contents incubated for 12 to 24 h a t 37°C with occasional vortexing. The aqueous layer, which contained most of the D N A , was recovered b y centrffugation a n d traces of phenol were removed b y 3 extractions with ether. The D N A was recovered b y precipitation with ethanol.
(e) D1VA sequencing methods The nuclease p a r t i a l digest m e t h o d was a modification of the m e t h o d of Sanger e t a l . (1973) as described b y Maniatis e t a l . (1975a). P a r t i a l products from combined digestion of terminally labelled D N A with DNAaso I a n d venom phosphodiesterase were fractiona~ed electrophoretically in one dimension a n d b y h o m o e h r o m a t o g r a p h y in t h e second dimension. The dimethyl sulfate-hydrazine m e t h o d for direct D N A sequencing is described b y Gilbert etal. (1975) and M a x a m & Gilbert (1977). W e have found t h a t the sequence of the first few base-pairs (up to 5 nucleotides from the labelled end) has usually been difficult to ascertain b y t h e DMS-HZ~f method, a n d we have relied on t h e p a r t i a l nuclease digestion m e t h o d for confirmatory evidence for this p a r t of t h e sequence. (f) l~'ractionation and visualization of D1VA cleavage products The fractionation o f I ) N A cleavage products was carried o u t on polyacrylamide/urea slab gels (20 cm × 40 cm × 0"3 cm) containing 20% acrylamide, 0-67% bisacrylamide and 7 M-urea in half-strength electrophoresis buffer (i.e. 45 m~-Trls-borate (pH 8.3) and 1.25 ml~-EDTA). Electrophoresis was carried out in the same buffer a t 600 to 1000 V for a suitable length of time (usually 10 to 30 h) depending on the e x t e n t of sequence information sought. A f t e r electrophoresis, t h e D N A bands were visualized b y autoradiography, the gels being frozen during prolonged exposure to minimize diffusion o f bands. (g) Nuclease digestion of operators in the presence of represser A sample (0.1 pmol) of the internally labelled restriction fragment (Ha* 790 for Ca or H a , 340 for 0L) was i n c u b a t e d with represser (electrophoretic p u r i t y greater t h a n 99%, a gift from R o b e r t Sauer) in binding buffer for 20 rain a t 20°0 followed b y an additional incubation for 10 rain a t O°C. The represser concentration ranged from approx. 0-02 to 20 picoequivalents (represser concentrations are expressed in equivalents per liter, one equivalent being the a m o u n t of represser which binds one reel of operator; see Chadwick etal., 1970 for t h e m e t h o d of determination). DNAaso I (2000 to 2500 units/rag) was a d d e d to a final conch of 0" 1 m g / m l a n d t h e D N A digested for 3 rain a t 0°C, a t t h e end of which the r e a c t a n t s were filtered through a nitrocellulose m e m b r a n e filter (Schleicher & Schull, B-6, 25 mm). The filter was washed with 2 ml of wash buffer and the D N A t r a p p e d on the filter was e x t r a c t e d with 0-3 rul of filter extraction buffer a n d precipitated with ethanol. The D N A in the pellet was fractionated on a 12% polyacrylamide gel. Pyrimidine t r a c t analyses were carried o u t on t h e various p r o t e c t e d fragments essentially according to t h e methods of Ling (1972a,b). Sizes of fragments were determined b y gel electrophoresis as described b y Maniatis e t a l . (1975b) using as markers D N A duplexes of known sequences 29, 45 and 74 base-pairs long.
t Abbreviation used: DMS-HZ, dimethyl sulfate-hydrazine. 18
268
Z. HUMAYUN, A. J E F F R E Y AND M. PTASHNE
3. Results (a) Restriction fragments used in DNA sequencing Figure 1 shows some relevant restriction endonuclease cleavage sites in and around the A operators as well as the approximate sizes of some restriction fragments. The left end of Hin 1125 is produced by a cut within, and therefore contains a part of, the left operator. The new O~ sequence reported in this paper was derived by sequencing the fragment Alu/Itin 85, produced by a Hin cut within Oa and an Alu cut to the left of Oa. This fragment was conveniently prepared by digesting Hae 790 (a fragment containing the entire Oa) with Hin and AluI by one of the following two methods: Hae 790 was digested with AluI to produce Alu 180, which in turn was isolated and digested with Hin to produce Alu/Hin 85; alternatively, Hae 790 was first digested with Hin to obtain Hin 375, which in turn was isolated and cleaved with Alu to produce Alu/Hin 85.
N
cI OL
tof Os'~-> J
~
l
Hoem
~
H/n'ff
I
I
HphHoe m
Hae Ill
H/r/TR
I
Hoe I~
Hm IT[
A/u I
A/u I
Fro. 1. Diagrammatic representation of p a r t of the genome of phage 4. Sites of some restriction endonuclease cleavages in a n d a r o u n d the operators 0,. a n d Ok are shown. Distances between certain of these cleavage sites are indicated in ba~e-pairs. Directions of transcription of N, cI, a n d Iof are indicated b y w a v y arrows.
(b) DNA sequence of the left operator The restriction fragment Hin 1125 was labelled at both ends and then digested with HaeIII to generate the fragment Hin/Hae 190 in which the Hin end (i.e. the operator end) was labelled (Fig. 2). A sequence of about 50 base-pairs from the labelled end was derived from a number of DMS-HZ gels, two representative examples of which are given in Figure 3(a) and (b). The first 14 base-pairs of this sequence (the bases bracketed by Hin and Hph cleavage sites in Fig. 5) are in perfect agreement with the sequence previously determined by different methods. One part of the new sequence was confirmed by partial nuclease digestion of a fragment obtained by T4 endonuclease IV (see Maniatis et al., 1975a) digestion of an internally labelled restriction fragment Hph 85, which in turn was isolated by Hph digestion of the fragment Hin 1125. Another part of this sequence was confirmed by partial nuclease digestion of terminally labelled r-strand of Hph 85 (D. Kleid & Z. Humayun, unpublished data).
SEQUENCES AND STRUCTURE OF ~ OPERATORS
Hin 1125
P
P
Hin 375 P
Kinase P*
P*.
l Hoe l"t'r ~
Hoe/H/n* 190
.p
Kinase p*
p*.__
Alu 180
P
P
p,
Kinase p*
P~.
~ A/u T p,
269
~ H/'n
P*-
p*
t
A/ulHin*85
~
~
t
Alu*lHin
p*
85
Fro. 2. Diagrammatic representation of the procedure used to label specific ends of restriction fragments used for sequencing. BAP is bacterial alkaline phosphatase, and kinase is T4 polynucleotide kinase. P, unlabelled end; P*, labelled end.
(c) Sequence of the right operator region The restriction fragment Alu/Hin 85 was prepared labelled specifically at one or the other end as outlined in Figure 2. The sequence from the Alu end was determined by a combination of the DMS-HZ (Fig. 3(c)) and partial nuclease digestion methods (Fig. 4). The sequence from the Hin end was determined by the DMS-HZ method (Fig. 3(d)). The first 43 base-pairs from the Hin end confirm a sequence reported previously (Maniatis et al., 1975a; Pirrotta, 1975). The new sequence which lies beyond the Hph cut is amply confirmed by the extensive overlaps between the sequences determined from each end. (d) Protection of Or. and OR from nuclease by repressor The results of experiments in which internally labelled Hae 340 (0~.) or Hae 790 (OR) was exposed to nuclease in the presence of varying concentrations of highly purified ~ repressor are given in Figure 6. At OR, DNA fragments of three sizes, approximately 25 (I), 50 (II), and 80 base-pairs (III) long, were protected depending on the repressor/operator ratio. The width of the band formed by fragment I on polyacrylamide gels indicates that its length varies from the mean of 25 base-pairs by ! 4 base-pairs; in some experiments two or three discrete bands in this size range were observed. Presumably fragments II and I I I also have frayed ends. At low repressor concentrations, predominantly fragment I was protected; with increasing repressor concentration, fragments II and I I I were protected, with I I I being the predominant species at high repressor concentrations. The largest fragment was about 80 base-pairs long even at 200-fold excess of repressor. At 0,., precisely the same results were observed with one exception: at repressor concentrations where fragment I I I was the predominant species protected, fragment II was replaced by a fragment (IIa) about five base-pairs smaller than fragment II. Each of the fragments protected at OL and OR was recovered from gels and further examined by pyrimidine tract analysis and cleavage by Hin. Table 1 lists the characteristic pyrimidine tracts found in the operator sequences (Fig. 5) and shows which of these are present in each protected fragment. At Om each successively larger fragment contains the pyrimidine tracts present in the smaller one plus additional pyrimidine tracts. Fragment I contains the pyrimidine tracts in the region designated OR1 plus a few bases on either side (see Fig. 5). Fragment II has additional pyrimidine tracts characteristic of the region in and around OR2 and fragment I I I contains
FIG. 3
SEQUENCES
AND STRUCTURE
OF A OPERATORS
271
pyrimidine tracts from the whole operator. These results indicate that the represser first binds to a region which includes OR1 and then adds sequentially to cover OR2 and OR3. Analogous results, with one exception, were found at OL. Thus, the pyrimidine tracts indicate that represser first covers a region around 0~.1 and then adds sequentially to cover OT,2 and 0T.3. The anomaly at OT. concerns the fragment IIa. Pyrimidine tract analysis indicates that this fragment includes 0~2 and OL3, but not OL1. As indicated above, the nuclease digestion does not always produce fragments with precisely defined ends. In one experiment, the DNA band representing the smallest protected fragment in OL was excised from the gel in two parts, one part being the fastest migrating segment, and the other the slowest. Both segments contained pyrimidine tracts expected from OL1 (T,TC,C2), but only the slower migrating portion contained Ts and C2T. Digestion of various protected fragments with Hin (not shown) confn'ms their origin deduced on the basis of pyrimidine tract analysis. Thus, considering protected fragments from OR, fragment III was cut into two pieces, about 50 and 30 base-pairs long; fragment II was cut to yield two fragments, about 20 and 30 base-pairs long; and fragment I was apparently not cleaved. Fragments I, II, and III derived from OL gave results analogous to those from OR. Fragment IIa was not cleaved by Hin, a result consistent with the conclusion that it includes DI~A in the region of OL2 and OL3, but not OL1.
FIG. 3. F r a e t i o n a t i o n of products of base-specific degradation of end-labelled restriction fragments. B P B is b r o m p h e n o l blue a n d X C is xylene cyanol. U n d e r the experimental conditions, D N A fragments approximately 10 nucleotides long r u n w i t h b r o m p h e n o l blue a n d fragments a b o u t 30 nucleotides long r u n with xylene eyanol. The n u m b e r s indicate the distance of the nucleotide from the labelled terminus. (a) Hin*/Hae 190 (asterisk denotes labelled end). The labelled f r a g m e n t was subjected to controlled chemical degradation as described in Materials a n d Methods. The p r o d u c t s were fractionated on a gel a t 500 V until the xylene cyanol was 2 in from t h e b o t t o m of the gel. The first vsrtical column ( " G " ) represents a purine-specific reaction (partly G-specific). The darker b a n d s are due to s t r a n d breakage a t the G sites, a n d the lighter b a n d s are due to breakage a t the Asit~s. The second vertical column ( " A " ) is a purine-specific reaction (partly A-specific). I n this case, the darker b a n d s are due to s t r a n d breakage a t the A sites a n d the lighter b a n d s are due to s t r a n d breaks a t G sites. The t h i r d vertical column ("TIC") is a pyrimidine-specific reaction, each b a n d reflecting s t r a n d breakage a t the site of a T or C. A t i g h t i n t e r m e s h i n g between the b a n d p a t t e r n s of t h e purine-specitle reactions a n d t h e pyrimidine-specific reactions is observed. Together, these 3 columns provide three-fourths of all the information necessary for d e t e r m i n a t i o n of the sequence of the D N A segment resolved on the gel (i.e. the sequence between the 27th a n d a b o u t the 55th base-pair). (b) Hin*/Hae 190. This gel shows the sequence of a larger segment of the same D N A as in (a), a n d provides all the information needed to determine the sequence between ~he l l t h a n d the 55th base-pairs from the labelled end. The first vertical column is a G-specific reaction, showing b a n d s produced b y cleavage a t G sites. The second col~mn is purine-specific (partly A-specific). The t h i r d column is pyrimidine-specifie, whereas t h e f o u r t h column indicates only C sites. (e) Alu[Hin* 85. The columns G, A, T, a n d C are, respectively, G-specific, purine-specific (partly A-specific), pyrimidine.specific a n d C-specific. The products of the pyrimidine a n d Cspecific reactions h a v e been slightly r e t a r d e d b y the gel, presumably due to incomplete removal of piperidine a n d reaction by-products, b u t the p u r i n e - p y r i m i d i n e intermeshing can be visualized b y m e n t a l l y m o v i n g the pyrimidine b a n d s f u r t h e r down the gel. The sequence t h a t can be derived from this gel extends from the 23rd nueleotide to the 80th nueleotide from the Hin end. P a r t of this sequence has already been determined b y i n d e p e n d e n t m e t h o d s (Maniatis e$ td., 1975a; P i r r o t t a , 1975). (d) Alu*]Hin 85. This gel shows the sequence of t h e opposite s t r a n d of t h e D N A f r a g m e n t analyzed in (e). Once again, the pyrimidine b a n d s are slightly r e t a r d e d compared to the purine bands, a n d m u s t be m e n t a l l y transposed to read t h e sequence.
272
Z. H U M A Y U N ,
A. J E F F R E Y
A N D M. P T A S H N E
Fig. 4. Sequence determination of the ~IZ~ e n d o f ~l~u*/H~ 85 b y partial nuclease digestion. A p p r o x h n a t e l y 0.01 ~g of the labelled D N A f r a g m e n t a n d 15 ~g o f tRl~TA were incubated w i t h 2 ng of DNAase I a n d 0.5 ~g of v e n o m phosphodiesterase for 15 rain at 37°C in nuelease buffer. A second reaction ~vas carried out exactly as above except t h a t the a m o u n t of DNAase I added was 0.2 ng. The two reaction products were combined and fractionated b y electrophoresis a t p H 3.5 on a cellulose acetate strip followed b y a second fractionation in the second dimension b y homoehroma~ography on a DEAE-cellulose t h i n layer. The homo m i x no. 3 of J a y e~ al. (1974) was used.
i¥
I
i
0.5 .
0.2 w
|
H/nIT
I
Hph
H i n Tr
Hph
t
!
~
I tof
Hph
i
I
I
/
'~
st
FIG. 5o I ) N A sequences o f O:a a n d OL. Note t h a t the orientation of the OL sequence has been reversed from its customary presentation in t h e m a p o f l~he genome. I n each operator, t h e regions between t h e $ vertical broken lines represent new sequences described in this paper. The 17-base-pair repressor binding si~es are boxed within each operator. The solid horizontal lines indicate the segments of D N A whose sequence was determined b y t h e m e t h o d s indicated. "Nuclease partial" stands for partial digestion with nuclease. Sites o f restriction enzyme cuts are indicated b y arrows. The transcription initiation sites for genes N, tof, and cI are indicated. The amino-terminal amino acids of the cI product (~ repressor) as well as the 5' end of the cI mRt~A are from P t a s h n e ¢~ a~. (1976).
DMS-HZ(H/n end)
"
ATTTTTTGTATGTCTA~GACG~CA~T--~TTA~ATAGAGAccG~AcAAc~TGTATTT]ATGGTGAccG~cAcTAT~GACTCGTGTAGTc
EndoI~Z/Nucleasepartial ~ ~ , ;I Nucleasepartialil
t
~CCTCTGGCG~GATAIATG~r~AT~A3
0,I
OL3 ~, OL2 ~ all J, N ~;TAAAAAACATACAGATIAACCATCTGCGGTGATA~ AA~TATCTCTGGCGGTGTTGIACATAAAtTACCACTGGC GGTGATAICTGAGC~CIAT~,'
- Leu-GIn-Glu-GIn-Thr-Leu-Pro-Lys-L~-Lys-Thr-Ser-NH~
.e-.............................. ~UA~
.,AGYcTGCTCTTGTGI"TAATGGTTTCTTTTTTGTGCTC ATACGTTAAATC~AT~CCGC~G~TAI~TA~ITAA~G TGc G T G ~ A ~
~sI
I.[
I Ip
cI
l~/ul
j
Ii IIH, h
end)
i .
DMS-HZ(Alu
I DMS-HZ ( H / n e n d ) i
I I .
I
!
I Nuclease partial
i= ,
i
Z. H U M A Y U N , A. J E F F R E Y AND M. P T A S H N E
274
TABLE 1
Pyrimidine tract analysis of D N A fragments lorotected from nuclease digestion by various concentrations of repressor Characteristic
Band I
Band II
Band IIa
OL TC2
~-
-t-
--
T2C
--
--
-]-
OR T2C3 T4 T3 T2C T3C3
-~ ~----
~ W -+ __
pyrimidine tract
Band III
-t-
~-~ ~~-
DNA fragments bearing OLand ORwere digested, separately, in the presence of varying amounts of repressor as in Fig. 6. The products were subjected to gel electrophoresis as in Fig. 6, and the protected fragments in the various bands were eluted and analyzed for pyrimidine tracts. The composition of a fragment found in a given band was independent of the repressor concentration used to protect the fragment. For example, in the experiment of Fig. 6, OR band I isolated from column 1 was identical to OR band I isolated from the other columns.
4. D i s c u s s i o n The data presented in this paper complete the nucleotide sequences of the h operators. Each operator spans some 80 base-pairs and includes three sequences t h a t fit the description of repressor binding sites as proposed b y l~aniatis et al. (1975c). These sites, designated OL1, 0,,2, and 0,.3 in the left operator and 0~1, OR2, and Og3 in the right operator, are 17 base-pairs long and are strikingly similar to each other, with an axis of partial rotational s y m m e t r y passing through the ninth base-pair in each site. Within each operator, the three sites are separated from each other b y A-~-T-rich spacers (Fig. 5). For a review of arguments t h a t have led to the identification of these sites, see Ptashne et al. (1976). The nuclease digestion experiments described in this paper are consistent with the conclusion t h a t each operator contains three sites for binding repressor. Thus, when D N A bearing OR was digested in the presence of repressor, three fragments, nominally 25, 50, and 80 base-pairs long, were obtained depending on the ratio of repressor to operator DNA. At the lowest repressor concentrations, mostly the 25 base-pairs fragment was protected, together with traces of the larger fragments. As the repressor concentration was increased, larger fragments were protected up to a point where mostly the largest fragment (80 base-pairs) was protected. Pyrimidine t r a c t analysis reveals t h a t (a) the 25 base-pair fragment contains OR1 plus a few base-pairs on either side, (b) the 50 base-pair fragment contains 0R 1 -~ 0R 2 plus a few base-pairs on either side as well as those in between the two binding sites, and (c) the largest fragment (80 base-pairs) contains the entire right operator. These results indicate t h a t the repressor binds to 0R1 first and then sequentially to 0R2 and 0R3, as indicated b y the results of previous experiments (Maniatis & Ptashne, 1973a,b; Maniatis et al., 1973). The results with 0,. are
SEQUENCES AND STRUCTURE
OF A OPERATORS
275
FIG. 6. Polyacrylamide gel fractionation of DNA fragments protected by various amounts of Arepresser. For each operator, the vertical columns numbered 1 to 6 show the protected fragments obtained when the reaction mixture contained 0.1 pmol of labelled operator-containing DNA (Hae 340 or Hae 790) and, respectively, 0.02, 0.05, 0.1, 0.5, 2, and 10 picoequivalents of represser. The 3 major bands (I, II, and I I I ) were sized by comparison with 2 DNA fragments of known chain length (Alu/Hin 85 and Hin/Hph 45; see Figs 1 and 5) and were found to be about 25 (I), 50 (II), and 80 base-pairs (III) long. Band I I a from Ou was about 45 base-pairs long.
s i m i l a r t o t h o s e w i t h OR in t h a t t h e r e p r e s s e r first b i n d s t o OL1 t o p r o t e c t a 25 basep a i r f r a g m e n t f r o m nuclease digestion, a n d t h e n s e q u e n t i a l l y b i n d s t o 0,.2 a n d Or.3 t o p r o t e c t 50 a n d 80 b a s e - p a i r f r a g m e n t s . One u n e x p e c t e d difference is t h a t a t h i g h r e p r e s s e r c o n c e n t r a t i o n s , a 45 b a s e - p a i r f r a g m e n t c o n t a i n i n g t h e t w o s e c o n d a r y sites, in t h i s ease OL2 a n d 0L3, b u t n o t 0L1, is p r o t e c t e d in a d d i t i o n t o t h e e n t i r e left o p e r a t o r . This f r a g m e n t is, as e x p e c t e d , s m a l l e r t h a n t h a t w h i c h includes 0T1
276
Z. HUMAYUN, A. J E F F R E Y AND M. PTASHNE
OL2, because the spacer between OL2 and OL3 is smaller than the spacer between OT.1 and OT2. The A repressor is an oligomer of identical subunits and the oligomers are in concentration-dependent equilibrium with monomers. I t is possible that at high repressor concentrations, the repressor assumes a configuration that enables it to bind 0T.2 ~- On3 with relatively high af~nlty. Alternatively, it is possible that DNAase can cleave between OT.1 and OT.2, but not between 0~.2 and 0T.3, when the operator is covered with repressor. The results of repressor protection experiments reported here differ somewhat from those reported earlier (Maniatis & Ptashne, I973a; Maniatis et at., 1973). In the earlier experiments, six fragments with sizes varying from 35 to I10 base-pairs were isolated from each operator. The smallest fragment contained OL1 or OR1 as in our present results, although intermediate-sized fragments as well as a fragment larger than the largest reported here were also found. Our present results are more readily explained by the operator sequences. A three-site structure for the ~ operators is also consistent with experiments being published elsewhere (Humayun e~ al., 1977b), in which we show, by studying DNA methylation in the presence of repressor (cf. Gilbert et a/., 1976), that the repressor contacts specific bases within the three binding sites but not beyond them. Another minor disagreement with the earlier work is that, apparently, higher repressor concentrations are required in the current nuclease protection experiment to protect the complete operator. We do not know why the results of our current nuclease protection experiments differ from those obtained previously, but they were performed differently in three ways: first, we now use more highly purified repressor; second, we now use specific operator-containing restriction endonuelease fragments isolated from polyacrylamide gels whereas previously we used a more heterogeneous preparation of operatorcontaining fragments; and third, we now use DNA molecules labelled with 32p by nick translation whereas previously we used DNA labelled with s2p in vivo. The new sequence near the right operator includes a part of the structural gene for the repressor (Fig. 5) and shows some unusual features. Thus, there is an ATG triplet 10 base-pairs beyond OR3, immediately followed by the codons for the 11 amino-terminal amino acids of the rcpressor. The ATG triplet functions both as a transcriptional and translational start-point, a hitherto unknown phenomenon. This and other features of this sequence, as argued elsewhere (Humayun eta/., 1977a; Ptashne et al., 1976; Walz et al., 1976), indicate that the expression ofcI is subject to a form of translational control. Moreover, as described elsewhere (Ptashne et al., 1976; Walz et al., 1976), the interaction of the repressor with the various binding sites in OR controls CI transcription both positively and negatively. We are grateful to A. Maxam and W. Gilbert for communicating their sequencing method prior to publication. REFERENCES Chadwick, P., Pirrotta, V., Steinberg, R., Hopkins, N. & Ptashne, M. (1970). GoldSpring Harbor ~ymp. Quant. Biol. 35, 283-294. Gilbert, W., Maxam, A. & Mirzabekov, A. (1976). In Gontrol o] Ribosome Synthesis (Kjeldgaard, N. & Maaloe, 0., eds), The Alfred Benzon Symposium IX, pp. 139-148, Munksgaard, Copenhagen. Glynn, I. M. & Chappell, J. B. (1964). Biochera. J. 90, 147-149. Herskowitz, I. (1974). Annu. R~v. Genet. 7, 289-324.
SEQUENCES
AND
STRUCTURE
OF A OPERATORS
277
Humayun, Z., Meyer, B., Sauer, R., Backman, K. & Ptashne, M. (1977a). In Molecular Mechanisms in Control of Gene Expression (Nierlich, D. P., Rutter, W. J. & Fox, F., eds), Proe. ICi~-UCLA Symp. Mol. Ceil. Biol., vol, 5, Academic Press, San Francisco, in the press. Humayun, Z., Kleid, D. & Ptashne, M. (19775). Nuel. Acids Re~. in the press. Jay, E., Bambara, 1~., Padmsa~abhan, R. & Wu, R. (1974). Arucl. Ao/d8/~es. 1, 331-353. Kleid, D., Humaytm, Z., Jeffrey, A. & Ptashne, M. (1976). Proc. Nat. Acad. Sci., U.S.A. 73, 293-297. Ling, V. (1972a). Proc. Nat. Acad. Se/., U.S.A. 69, 742-746. Ling, V. (1972b). J. Mol. Biol. 64, 87-102. Maniatis, T. & Ptashne, M. (1973a). Proe. Nat. Lead. Sei., U.S.A. 70, 1531-1535. Maniatis, T. & Ptashne, M. (1973b). Nature (London), 246, 133-136. Maniatis, T., Ptashne, M. & Maurer, R. (1973). Cold Spring Harbor Syrup. Quant. Biol. 38, 857-863. Maniatis, T., Ptashne, M., Barrell, B. G. & Donelson, J. (1974). Nature (London), 250, 394-397. Maniatis, T., Jeffrey, A. & Kleid, D. (1975a). Proc. Nat. Aead. Sci., U.S.A. 72, 1184-1188. Maniatis, T., Jeffrey, A. & van de Sande, H. (1975b). Biochemistry, 14, 3787-3794. Maniatis, T., Ptashne, M., Backman, K., Kleid, D., Flashman, S., Jeffrey, A. & Maurer, R. (1975c). Cell, 5, 109-113. Maxam, A. & Gilbert, W. (1977). Proe. Nat. Acad. Sci., U,S.A. (1977), PNAS, 74, 560-564. Panet, A., van de Sande, J. H., Loewen, P. C., Khorana, H. G., Raa~, A. J., Liilehaug, J. L. & Kleppe, K. (1973). Biochemistry, 12, 5054-5050. Pirrotta, V. (1975), Nature (London), 254, 114-117. Ptashne, M., Backman, K., Humayun, M. Z., Jeffrey, A., Maurer, R., Meyer, B. & Sauer, R. T. (1976). Science, 194, 156-161. Roberts, R. J., Myers, P. A., Morrison, A. & Murray, K. (1976). J. Mol. Biol. 192, 157-165. Sanger, F., Donelson, J. E., Coulson, A. R., Kossel, H. & Fischer, D. (1973). Proe. Nat. Aead. Sei., U.S.A. 70, 1209-1213. Walz, A., Pirrotta, V. & Ineiehen, K. (1976). Nature (London), 262, 665-669.
