Article pubs.acs.org/JAFC
Concentration-Dependent Biphasic Effects of Resveratrol on Human Natural Killer Cells in Vitro Qi Li, Ting Huyan, Lin-Jie Ye, Ji Li, Jun-Ling Shi, and Qing-Sheng Huang* Key Laboratory for Space Bioscience and Space Biotechnology, School of Life Sciences, Northwestern Polytechnical University, 127 YouyiXilu, Xi’an, Shaanxi 710072, People’s Republic of China ABSTRACT: Resveratrol (RES) is a polyphenol phytoalexin from plants, which has been reported to possess a variety of biological effects. The properties of RES on human natural killer (NK) cells were assessed in this study. Results showed that RES has concentration-dependent biphasic effects on NK cells. In high concentration (50 μM), RES can inhibit viability and promoted apoptosis of NK cells and human lymphoblastoid T (Jurkat) cells, which may affect the caspase signaling pathway. The Jurkat cells were more sensitive than NK cells on the RES caused cell death. However, when the concentration range reduced from 3.13 to 1.56 μM, RES showed the positive effects on NK cells by increasing the NK cells cytotoxicity via up-regulating the expression of NKG2D and IFN-γ (in mRNA and protein levels). These results indicated that one needs to pay more attention to the dosage and biphasic effects when RES was applied as antitumor drugs or health products. KEYWORDS: resveratrol (RES), human natural killer (NK) cells, apoptosis, cytotoxicity, caspase
■
■
INTRODUCTION
Cell Lines and Primary Culture. The methods for preparing primary human NK cells were described in Huang et al.10 Briefly, peripheral venous blood (10 mL) from healthy donors (n = 12) was collected in heparinized tubes. The procedure of blood sample collecting was conforming to the informed consent guidelines of the Ethic Committees of Northwestern Polytechnical University. The peripheral blood mononuclear cells (PBMCs) were collected by using Lymphocyte Separation Liquid (Haoyang TBD, Tianjin, China) following the instructions. After being washed twice with PBS, the PBMCs were resuspended in RPMI-1640 media (Gibco, Rockville, MD), which was supplemented with 10% fetal bovine serum (FBS) (Gibco, Rockville, MD) containing 100IU IL-21 (Peprotech, Rocky Hill, NJ), 100 μg/mL of penicillin and streptomycin (Genview, Carlsbad, CA). Then, PBMCs were counted and cocultured with equal numbers of stimulating cells (irradiated genetically modified K562 cells, prepared according to Imai et al.11). After 3 weeks cultivation, 1 × 105 ex-vivo-expanded cells were collected and washed by PBS. The CD56-PE and CD3-FITC monoclonal antibodies (mAbs) and its isotype-matched controls (IgG1-FITC/IgG2-PE) (QuantoBio, Beijing) were used to test the purity of NK cells. The percentages of NK cells (CD56+CD3−) in ex-vivo-expanded cells were determined by flow cytometry (BD FACS Calibur, San Jose, CA). Jurkat cells, K562 cells (purchased from American Type Culture Collection, ATCC, Manassas, VA), and stimulating cells were maintained in RPMI-1640 cell media supplemented with 10% FBS containing 100 μg/mL of penicillin and streptomycin and routinely cultured at 37 °C in 5% CO2 incubator. RES Treatment. The RES was prepared in storage solution (100× working solution) (5, 2.5, 1.25, 0.625, 0.313, 0.156, and 0.078 mM) in DMSO. The working concentrations of RES used in this assays were 50, 25, 12.5, 6.25, 3.13, 1.56, and 0.78 μM, respectively. Jurkat cells or NK cells (5 × 105 each) were suspended, respectively, in 990 μL of RPMI-1640 (IL-2 free) and cultured in 24-well plates (Costar, New
Resveratrol (RES, 3,4′,5-trihydroxystilbene) is a polyphenol phytoalexin, which present in many plants. The skin and seeds of grape, wine, berries, and nuts are recognized as a rich source of RES.1 Recently, RES has been an extensively studied natural product due to its many beneficial effects, such as antioxidant, anti-inflammatory, antithrombotic, and anticancer.2−4 RES could modulate various physiological processes like cell proliferation, apoptosis, metastasis, and angiogenesis.5,6 Raffaele et al. reviewed the triggering cell death effect of RES on many lymphoma and leukemia cell lines mainly relying on its antiproliferation and induced apoptosis effects.7 Therefore, RES has received increasing attention as its potential applications in hematologic tumors treatments. Natural killer (NK) cells are lymphocytes with large granular properties, which are defined by the presence of CD56 and absence of CD3 on the cell surface (CD56+CD3−).8 NK cells comprise 5−10% of all peripheral blood lymphocytes,9 can lyse virally infected cells or oncogenically transformed cells, and secrete many kinds of cytokines without requiring prior immunization. NK cells could exert cytotoxicity on oncogenically transformed cells specifically and efficiently, which make them play an important role in tumor identification and surveillance. However, as a potential antitumor drug, the effects of RES on NK cells should be considered carefully. This study aims to investigate the effect of RES on human primary NK cells. Human lymphoblastoid T (Jurkat) cells were employed to compare the sensitivity of tumor cell line and primary cells to RES. After being treated with RES in concentration gradient, the viability and cytotoxicity of NK cells were analyzed. Furthermore, the underlying mechanism, including the apoptosis level, the expression of three NK cytokines (IFN-γ, perforin and granzyme-B), and four NK cell functional receptors (NKG2A, NKG2D, NKp30 and NKp44) were also delineated. © 2014 American Chemical Society
MATERIALS AND METHODS
Received: Revised: Accepted: Published: 10928
June 25, 2014 October 4, 2014 October 4, 2014 October 4, 2014 dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
York) at 37 °C in a 5% CO2 incubator with 10 μL of the RES storage solutions for 48 h. A 10 μL portion of DMSO was added to each control group to exclude its effect on cells. In addition, caspase inhibitor (z-VAD-FMK, Beyotime Institute of Biotechnology, Haimen, China) and JNK inhibitor (SP600125, Beyotime Institute of Biotechnology, Haimen, China) were used here to assess the relevant RES signaling pathway. Cell Viability and Cytotoxicity Assay. After 48 h RES treatment, Jurkat cells and NK cells in each group were centrifuged at 1000 × g for 5 min, washed with PBS, and resuspended in 600 μL of RPMI1640 media (IL-2 free). A 20 μL portion of CCK-8 (Cell Counting Kit-8, Dojindo, Japan) was added to a 200 μL cell suspension per well in a 96-well plate in triplicate for each group. The cells were then incubated for 2 h at 37 °C in a 5% CO2 incubator. The optical density (OD) values per well were recorded at 450 nm in microplate reader (BioTek Synergy-4). The procedure of NK cell cytotoxicity assay was described by Li et al.12 Briefly, NK cells (8 × 105) were separated from each RES treated group, washed three times with PBS, and resuspended in 400 μL of RPMI-1640 (IL-2 free). A 100 μL portion of NK cells (2 × 105) was plated into each well of a 96-well plate with 100 μL of K562 cells (4 × 104) in triplicate to make the effector-to-target ratio (E:T) at 5:1. The effector control wells contained 100 μL of NK cells (2 × 105 cells) and 100 μL of medium. The target control wells contained 100 μL of K562 cells (4 × 104 cells) and 100 μL of medium. Plates were incubated at 37 °C in a 5% CO2 incubator. After 4 h coculture, 20 μL of CCK-8 was added to each well, and the plate was then incubated for another 2 h with OD values recorded at 450 nm. Cytotoxicity was determined by evaluating the rate at which NK cells killed K562 cells; the killing rate was calculated as following equation:13
Table 1. Primer Pairs Used for RT-qPCR Analysis primer IFN-γ perforin granzyme-B NKG2A NKG2D
NKp30 NKp44 GAPDH
sequence (5′-3′) F: TGCAGGTCATTCAGATGTAGC R: GGACATTCAAGTCAGTTACCG F: GGGACAATAACAACCCCATCT R:GGAATTTTAGGTGGCCATGAT F:AGATCGAAAGTGCGAATCTGA R: TTCGTCCATAGGAGACAATGC F: TCATTGTGGCCATTGTCCTGAGG R: AGCACTGCACAGTTAAGTTCAGC F: ATCGCTGTAGCCATGGGAATCCG R: AGACATACAAGAGACCTGGCTCTC F: TGAGATTCGTACCCTGGAAGG R: CACTCTGCACACGTAGATGCT F: TCCAAGGCTCAGGTACTTCAA R: GATTGTGAATCGAGAGGTCCA F: TCCTGCACCACCAACTGCTTAGC R: ACACGGAAGGCCATGCCAGTGAGC
amplicon size (bp) 248 174 138 291 213
235 163 254
Biotechnology, Haimen, China), cells were centrifuged and washed 3 times with PBS, and then labeled with AnnexinV-FITC and PI following the instructions. NK cells treated by RES were centrifuged and washed with PBS, and then divided into 4 groups (1 × 105 cells each) and labeled with PE-conjugated mouse antihuman NKG2A (R&D Systems, Minnesota), NKG2D, NKp30, and NKp44 (BD Bioscience, California). All the cells were analyzed using flow cytometry. Data Analysis. Statistical analysis was performed using SPSS 16.0 statistical software (IBM, New York). The data were presented as the mean ± SD. The results were analyzed using the analysis of variance (ANOVA). Multiple comparisons used LSD test to evaluate the significance of differences between groups. Statistical significance was defined as p < 0.05.
killing rate (%) = [1 − (ODe + t − ODe)/ODt ] × 100% The notation is defined as follows: ODe, average OD450 of triplicate wells for NK cell control; ODt, average OD450 of triplicate wells for K562 cells control; ODe+t, average OD450 of triplicate wells for NK cells plus K562 cells. mRNA Expression Analysis. Total RNA was isolated from RES treated NK cells (1 × 107) by using TRIzol reagent (Invitrogen, Carlsbad, CA). The mRNA levels of three cytokines, IFN-γ, perforin, granzyme-B, and four receptors related to the cytotoxicity of NK cell, NKG2A, NKG2D, NKp30, and NKp44, were evaluated by relative quantification PCR (RT-qPCR) with SYBR Green random mixing method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. The 2−ΔΔCt method was used to calculate relative changes in gene expression.14 All primers used here are shown in Table 1. RT-qPCR was performed as the instructions of the TransStart Top Green qPCR SuperMix kit (TransGen Biotech, Beijing, China). The reaction mixtures were incubated for 30 min at 48 °C, followed by 40 cycles of PCR at 94 °C for 5 s, 55 °C for 15 s, and 72 °C for 10 s. At the end of 40 cycles, a melting curve analysis was performed to confirm the presence of only a single amplified product of the expected size. ELISA Assay of IFN-γ, Perforin, and Granzyme-B. The secretions of IFN-γ, perforin, and granzyme-B were assessed by corresponding ELISA Kits (BD Bioscience, CA). After RES treatment, NK cells (8 × 105) were centrifuged and washed with PBS, resuspended in 400 μL RPMI-1640 (IL-2 free), mixed with 1.6 × 105 K562 cells in 100 μL RPMI-1640 (IL-2 free), and then incubated for 4 h at 37 °C in 5% CO2 incubator (K562 cells were used to activate the cytokine secretion of NK cells according the literature).15 In the ELISA assay, each condition was performed twice, and OD values were recorded at 450 nm. Curve Expert 13.0 was employed to create the standard curve according to the OD values of standards. The quantities of these cytokine secreted by NK were calculated from these standard curves. Apoptosis and Receptor Expression Assay. AnnexinV-FITC Apoptosis Detection Kit (Beyotime Institute of Biotechnology, Haimen, China) was used to assess the apoptosis of Jurkat cells and NK cells. After treatment with RES in presence or absence of the zVAD-FMK (caspase inhibitor, 50 μg/mL, Beyotime Institute of
■
RESULTS NK Cell Purity. After 3 weeks of ex vivo expansion, primary human NK cells were harvested, stained with CD56-PE and CD3-FITC mAbs, and analyzed by flow cytometry. The percentage of NK cells (CD56+CD3−) was determined. The mean percentage of NK cells from 12 donors was 91.21 ± 1.78% (n = 12). Cell Viability. RES (12.5−50 μM) shows concentrationdependent effects on the viability of both Jurkat cells and NK cells. In the concentration of 50 μM, RES can inhibit the viability of both cells. Figure 1 shows the OD values were significantly reduced, which were 1.94 ± 0.33, 1.8 ± 0.34, 1.79 ± 0.37 1.74 ± 0.23, 1.85 ± 0.26, 1.47 ± 0.21, 1.41 ± 0.36, and 1.18 ± 0.29 in Jurkat cells, and 0.77 ± 0.05, 0.76 ± 0.03, 0.77 ± 0.04, 0.76 ± 0.03, 0.76 ± 0.04, 0.74 ± 0.02, 0.62 ± 0.03, and 0.48 ± 0.03, respectively, in NK cells with the concentration of RES increased from 0 to 50 μM (Figure 1A). It was noticed that when the concentration of RES reduced to 12.5 μM, there was no obvious inhibited effect on NK cells, but the Jurkat cells still could be affected until it reduced to 6.25 μM. This suggested that Jurkat cells are more sensitive than NK cells in response to RES causing cell death. On the other hand, inhibitors were employed here to assess the relevant signaling pathway RES may act with (Figure 1B). After pretreatment by inhibitors (z-VAD-FMK and SP600125), RES (50 μM) no longer showed the inhibited effect on Jurkat cells and NK cells in z-VAD-FMK group. The OD values in z-VAD-FMK group 10929
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Figure 1. OD values of cells treated with RES and inhibitors (n = 4). (A) Cells treated with RES in concentration gradient (0−50 μM) for 48 h. (B) Cells treated with RES (50 μM) in present or absent of z-VAD-FMK and SP600125 (50 μM each) for 48 h. Data represent the mean ± SD of four independent experiments. One-way ANOVA and LSD tests were performed: * p < 0.05 compared with the control; # p < 0.05 compared with the RES treated group.
Figure 2. Apoptosis and necrosis of Jurkat cells after RES treatment (n = 4). (A) A representative flow cytometry plot of Jurkat cells from one donor. The percentages of viable (Annexin V−/PI−), early apoptotic (Annexin V+/PI−), and late apoptotic/necrotic (Annexin V+/PI+) cells are shown. (B) The percentage of apoptosis in these cells is summarized in the bar graph; each column represents the mean ± SD from four independent experiments. Multivariate ANOVA and LSD tests were performed: * p < 0.05 compared with the control; # p < 0.05 compared with the RES treated group.
were 1.82 ± 0.11 and 0.71 ± 0.04, respectively, compared with the 1.29 ± 0.26 (Jurkat cells) and 0.56 ± 0.06 (NK cells) in RES groups. However, the OD values in SP600125 groups of the two cells showed no significant changes compared with the RES groups. It is suggested that RES may inhibit the viability of cells by causing them apoptosis/death via caspase signal pathway.
Cell Apoptosis. Cells stained by AnnexinV and PI after 48 h RES (50 μM) treatment in presence or absence of z-VADFMK were shown in Figures 2 and 3. Apoptosis of both Jurkat cells and NK cells increased comparing with the controls, and the apoptosis of Jurkat cells was more damaged than the latter. Early apoptosis (AnnexinV+/PI−) occurred in 15.9 ± 1.99% in NK cells and 15.59 ± 2.67% in Jurkat cells after RES treated 10930
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Figure 3. Apoptosis and necrosis of NK cells after RES treatment (n = 4). (A) A representative flow cytometry plot of NK cells from one donor. The percentages of viable (Annexin V−/PI−), early apoptotic (Annexin V+/PI−), and late apoptotic/necrotic (Annexin V+/PI+) NK cells are shown. (B) The percentage of apoptosis in these cells is summarized in the bar graph; each column represents the mean ± SD from four independent experiments. Multivariate ANOVA and LSD tests were performed: * p < 0.05 compared with the control; # p < 0.05 compared with the RES treated group.
compared with 4.24 ± 1.57% and 4.29 ± 1.25%, respectively, of the control (p < 0.05). Meanwhile, the late apoptosis/necrosis NK cells were 4.12 ± 1.08%, with no significant difference compared with 3.8 ± 1.79% of the control. However, the late apoptosis/necrosis Jurkat cells were 18.35 ± 3.24%, increased significantly compared with the 4.3 ± 1.82% in the control. Correspondingly, the percentages of viable cells were 78.78 ± 2.06% (NK cells) and 61.06 ± 2.4% (Jurkat cells) in RES treated groups compared with 89.98 ± 1.93% (NK cells) and 88.79 ± 1.5% (Jurkat cells) in control, respectively (p < 0.05). Furthermore, the RES-induced apoptosis and necrosis of cells were blocked by caspase inhibitor (z-VAD-FMK). After pretreatment by z-VAD-FMK, the apoptosis rates of Jurkat cells and NK cell were reduced partially. These results suggested that RES could induce Jurkat cell and NK cell apoptosis in 50 μM, which may be relevant with caspase signaling pathways. NK cells showed more resistance than Jurkat cells on RES induced apoptosis at dose tested. NK Cells Cytotoxicity. In this assay, NK cells were treated with RES in concentration gradient for 48 h. The cytotoxicity of the NK cells was tested. As shown in Figure 4, the cytotoxicity of NK cells was significantly decreased when the concentration of RES was above 25 μM, 61.42 ± 3.93% and 71.28 ± 3.55% in 50 and 25 μM treated groups compared with the 90.22 ± 1.43% in the control (p < 0.05). Unexpectedly, RES in low concentration (3.13 and 1.56 μM) increased the cytotoxicity of NK cells, 95.86 ± 1.56% and 94.73 ± 1.62% compared with control (p < 0.05). Therefore, in the following experiments, the mechanism underlying the increased NK cells cytotoxicity was studied under 3.13 μM treatment of RES.
Figure 4. Effect of RES on NK cell cytotoxicity (n = 4). Each column represents the mean ± SD from four independent experiments. Oneway ANOVA and LSD tests were performed: * p < 0.05 compared with the control.
RT-qPCR. Table 2 depicted the expression profiles of genes involved in NK cell functions after low concentration RES (3.13 μM) treatment. The mRNA level of IFN-γ increased significantly in the RES-treated group to 4.5-fold compared with the control (p < 0.05). Meanwhile, the mRNA levels of triggering receptors NKG2D were also up-regulated signifi10931
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Table 2. RES in Low Concentration Regulated NK Cell Functional Proteins at the mRNA Level (n = 6)a gene
IFN-γ
perforin
granzyme-B
NKG2A
NKG2D
NKp30
NKp44
compared with control
4.5(fold)b
2.14(fold)
1.77(fold)
0.53(fold)
6.36(fold)b
1.39(fold)
1.71(fold)
a
SYBR green-based RTq-PCR was used to examine the mRNA levels of genes that are important for NK cell functions. The data represent the mean ± SD of six independent experiments. One-way ANOVA and LSD test. bp < 0.05 compared with 1.
treated by RES with concentration gradient. The viability, apoptosis, and cytotoxicity of NK cells were detected. Jurkat cells were used to assess if there was a sensitivity difference for RES between primary cells and tumor cells. When RES was employed as a drug or adjuvant to inhibit viability or induce apoptosis on tumor cells in vitro, the common working concentrations were 25−200 μM.27−30 In the present study we noticed that when the concentration of RES above 12.5 μM, the significant inhibiting effect was observed on Jurkat cells, but the threshold in NK cells was 25 μM. It indicated that tumor cell lines such as Jurkat are more sensitive than NK cells to the toxicity effect of RES. Jazirehi et al. reported that, in 10 μM concentration, RES did not show any toxicity on human PBMCs, but it caused cell death in Roma cell lines.31 Another study reported that RES reduced the viability and DNA synthesis capability of the promyelocytic leukemia (HL-60) cell;32 it also inhibited growth of human colon tumorigenic cells mediated by cell cycle arrest.33 Tumor cells grow more actively than primary cells, the DNA synthesis reduction and cell cycle arrest caused by RES affect the tumor cell proliferation more serious than primary cells, which may explain the sensitivity difference of RES between the two kinds of cells. Many studies have indicated the biphasic effects of RES on cells. It was reported that RES can promote GH3 cells proliferation at low concentrations (1 μM) and inhibit it at high concentrations (>10 μM), and the RES-induced GH3 cell apoptosis was caspase-dependent.25 Suzuki et al. observed cleavage of caspase-3 and poly(ADP-ribose) polymerase in RES-treated cells, which indicated that RES induces caspasedependent apoptosis in MT-2 and HUT-102 cells.34 Our results showed, at the high concentration (50 μM), RES reduces OD values of both Jurkat cells and NK cells, while caspase inhibitor z-VAD-FMK can prevent RES caused cell death. The flow cytometry assay confirmed these results; after pretreatment by z-VAD-FMK, the early and late apoptosis/ necrosis cells caused by RES were reduced significantly, which suggests that RES promotes cell apoptosis via caspase signaling pathway. Kashif et al. reported that RES (4−8 μM) treatment inhibited the caspase activation, and H2O2 induced apoptosis in HL60 cells.35 Another study showed that RES in 2 and 5 μM increased the percentage of CD19+ cell in human PBMCs. However, 10 μM RES inhibited the proliferation of B lymphocyte.36 In our results, RES (in 1.56−6.25 μM) did not show the promote proliferation or antiapoptosis effects (data not shown) on either Jurkat cells or NK cells, but it actually promoted the cytotoxicity of NK cells in 1.56−3.13 μM. The cytotoxicity of NK cells plays a key role in tumor identification and surveillance. NK cells kill malignant cells by secretion of IFN-γ, perforin, and granzyme-B. NKG2D is the most important triggering receptor on NK cells which trigger cytotoxicity and mediate the secretion of IFN-γ.37 RT-qPCR and flow cytometry assays indicated that RES in 3.13 μM can increase the expression of NKG2D both in mRNA and protein level. Results from Lu et al. show that RES pretreatment increases NK cell cytotoxicity in a dose-dependent (1.56−12.5
cantly in the RES treated group, which increased 6.36-fold compared with control (p < 0.05). ELISA. The levels of cytokine and cytolytic proteins in the NK cell supernatants are illustrated in Figure 5. It is noticed
Figure 5. IFN-γ, perforin, and granzyme-B secretion of NK cells after RES treatment. RES (3.125 μM) treated NK cells were stimulated with K562 cells, supernatants were collected, and then the concentrations of IFN-γ, perforin, and granzyme-B were detected. Each column represents mean ± SD of four independent experiments. One-way ANOVA and LSD tests were performed: * p < 0.05 compared with control.
that the IFN-γ level was increased under 3.13 μM RES treatment, which was increased to 730 ± 41 pg/mL compared with the 400 ± 35 pg/mL in the control (p < 0.05). The concentration of perforin was not changed significantly. They were about 800 ng/mL in RES treated and control groups. However, the granzyme-B was hardly detected in the supernatants of two groups. Receptor Expression. Flow cytometry assays indicate that NK cells display a significant up-regulation of NKG2D (Figure 6). The positive percentage of NKG2D increased from 83.52 ± 5.64% in the control group to 94.2 ± 4.67% in RES treated group (p < 0.05). The positive percentages of NKG2A, NKp30, and NKp44 were not changed obviously.
■
DISCUSSION As a small polyphenol, RES was found in various plant sources,16 and has been demonstrated to have many beneficial effects and received a lot of attention in recent years. RES was well-known for use in various areas including anti-inflammatory, antioxidant, antidiabetic, and antiaging.17−19 Also, it showed the positive effects of triggering cell death in a great variety of human tumor cells, such as colon, prostate, breast, lymphoma, and leukemia.20−24 For these reasons, RES has been recognized as a potential adjuvant in cancer chemotherapy.25,26 NK cells play a pivotal role in innate and adaptive immunity, especially in tumor surveillance. The effect of RES on human NK cells should be assessed carefully if it has been used as antitumor drug. In this study, primary human NK cells were 10932
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Figure 6. Protein expression profiles for the NK cell receptors NKG2A, NKG2D, NKp30, and NKp44 after low concentration RES treatment. (A) NK cells were stained with PE-conjugated mAbs and analyzed by flow cytometry (for example). (B) The bar graph represents the mean ± SD from three independent experiments. One-way ANOVA and LSD test: * p < 0.05 compared with control.
μM) manner by up-regulation of the expression of NKG2D and perforin expression.38 In our results, the change of perforin expression was not obvious, but the IFN-γ expression was upregulated significantly. Increased expression of NKG2D and IFN-γ may be the reason for enhanced cytotoxicity of NK cells. Hu et al. reported that RES treatment also increases the cellsurface expression of NKG2D ligands on human promyeloblastic leukemia KG-1a cells.39 It indicated that RES can enhance the CIK (cytokine-induced killer) via up-regulation of the expression of both NKG2D and NKG2D ligands on effector and target cells, respectively. Thought that the effects of RES on NK cytotoxic activity may be due to partial agonistic activity of RES on aryl hydrocarbon receptor (AhR).40 They speculated that RES is a partial agonist of human AhR and exerts its effect on NK cells by the mechanism involving activation of JNK (c-Jun N-terminal kinase) and ERK (extracellular-regulated kinase).38,40 Unlike caspase inhibitor, JNK inhibitor SP600125 did not show the abolished effects on high concentration RES induced NK cell apoptosis in our study. However, JNK may relate to the positive effect of RES on NK cells. The present study indicated that RES has biphasic effects on human NK cells. Other biphasic effects of RES on tumor cells or several parasitic diseases were also reported (reviewed by Calabrese et al.41). In line with these findings, it indicated that RES acts via multiple target pathways (AhR, JNK, and ERK).42 Due to rapid metabolism in human body, RES may hardly reach the body tissues in sufficient dosage to exert the beneficial
health effects by oral consumption.43 Using RES as one kind of injection may be part of the solution. Therefore, it was very important to confirm and calculate the effective concentration of RES accurately when it was used as a potential antitumor or health product.
■
AUTHOR INFORMATION
Corresponding Author
*Phone:+86-029-88460332. Fax: +86-029-88460332. E-mail: [email protected]. Funding
We gratefully acknowledge financial support from the Natural Science Foundation of Shaanxi Province (Grant 2014JM4171) and the Fundamental Research Funds for the Central Universities (Grant 3102014JKY15008). Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED CCK-8, cell counting kit-8; E:T, effector versus target; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFN, interferon; IL, interleukin; LSD, least significant difference; mAbs, monoclonal antibodies; NK, natural killer; OD, optical density; PBMC, peripheral blood mononuclear cell; PBS, phosphate-buffered saline; RES, resveratrol 10933
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
■
Article
and chemotherapeutic agent clofarabine against human malignant mesothelioma MSTO-211H cells. Food Chem. Toxicol. 2013, 52, 61−8. (21) Castillo-Pichardo, L.; Dharmawardhane, S. F. Grape polyphenols inhibit Akt/mammalian target of rapamycin signaling and potentiate the effects of gefitinib in breast cancer. Nutr. Cancer 2012, 64, 1058−69. (22) Can, G.; Cakir, Z.; Kartal, M.; Gunduz, U.; Baran, Y. Apoptotic effects of resveratrol, a grape polyphenol, on imatinib-sensitive and resistant K562 chronic myeloid leukemia cells. Anticancer Res. 2012, 32, 2673−8. (23) Iguchi, K.; Toyama, T.; Ito, T.; Shakui, T.; Usui, S.; Oyama, M.; Iinuma, M.; Hirano, K. Antiandrogenic activity of resveratrol analogs in prostate cancer LNCaP cells. J. Androl. 2012, 33, 1208−15. (24) Juan, M. E.; Alfaras, I.; Planas, J. M. Colorectal cancer chemoprevention by trans-resveratrol. Pharmacol. Res. 2012, 65, 584− 91. (25) Chao, W.; Xuexin, Z.; Jun, S.; Ming, C.; Hua, J.; Li, G.; Tan, C.; Xu, W. Effects of resveratrol on cell growth and prolactin synthesis in GH3 cells. Exp. Ther. Med. 2014, 7, 923−928. (26) Yang, X.; Li, X.; Ren, J. From French Paradox to cancer treatment: anti-cancer activities and mechanisms of resveratrol. AntiCancer Agents Med. Chem. 2014, 14, 806−25. (27) Park, D. G. Antichemosensitizing effect of resveratrol in cotreatment with oxaliplatin in HCT116 colon cancer cell. Ann. Surg. Treat. Res. 2014, 86, 68−75. (28) Yan, H. W.; Hu, W. X.; Zhang, J. Y.; Wang, Y.; Xia, K.; Peng, M. Y.; Liu, J. Resveratrol induces human K562 cell apoptosis, erythroid differentiation, and autophagy. Tumor Biol. 2014, 35, 5381−8. (29) Ge, J.; Liu, Y.; Li, Q.; Guo, X.; Gu, L.; Ma, Z. G.; Zhu, Y. P. Resveratrol induces apoptosis and autophagy in T-cell acute lymphoblastic leukemia cells by inhibiting Akt/mTOR and activating p38-MAPK. Biomed. Environ. Sci. 2013, 26, 902−11. (30) Zou, T.; Yang, Y.; Xia, F.; Huang, A.; Gao, X.; Fang, D.; Xiong, S.; Zhang, J. Resveratrol inhibits CD4+ T cell activation by enhancing the expression and activity of Sirt1. PloS One 2013, 8, e75139. (31) Jazirehi, A. R.; Bonavida, B. Resveratrol modifies the expression of apoptotic regulatory proteins and sensitizes non-Hodgkin’s lymphoma and multiple myeloma cell lines to paclitaxel-induced apoptosis. Mol. Cancer Ther. 2004, 3, 71−84. (32) Surh, Y. J.; Hurh, Y. J.; Kang, J. Y.; Lee, E.; Kong, G.; Lee, S. J. Resveratrol, an antioxidant present in red wine, induces apoptosis in human promyelocytic leukemia (HL-60) cells. Cancer Lett. 1999, 140, 1−10. (33) Gonzalez-Sarrias, A.; Gromek, S.; Niesen, D.; Seeram, N. P.; Henry, G. E. Resveratrol oligomers isolated from Carex species inhibit growth of human colon tumorigenic cells mediated by cell cycle arrest. J. Agric. Food Chem. 2011, 59, 8632−8. (34) Suzuki, Y.; Ito, S.; Sasaki, R.; Asahi, M.; Ishida, Y. Resveratrol suppresses cell proliferation via inhibition of STAT3 phosphorylation and Mcl-1 and cIAP-2 expression in HTLV-1-infected T cells. Leuk. Res. 2013, 37, 1674−9. (35) Ahmad, K. A.; Clement, M. V.; Hanif, I. M.; Pervaiz, S. Resveratrol inhibits drug-induced apoptosis in human leukemia cells by creating an intracellular milieu nonpermissive for death execution. Cancer Res. 2004, 64, 1452−9. (36) Zunino, S. J.; Storms, D. H. Resveratrol alters proliferative responses and apoptosis in human activated B lymphocytes in vitro. J. Nutr. 2009, 139, 1603−8. (37) Krzewski, K.; Strominger, J. L. The killer’s kiss: The many functions of NK cell immunological synapses. Curr. Opin. Cell Biol. 2008, 20, 597−605. (38) Lu, C. C.; Chen, J. K. Resveratrol enhances perforin expression and NK cell cytotoxicity through NKG2D-dependent pathways. J. Cell. Physiol. 2010, 223, 343−51. (39) Hu, L.; Cao, D.; Li, Y.; He, Y.; Guo, K. Resveratrol sensitized leukemia stem cell-like KG-1a cells to cytokine-induced killer cellsmediated cytolysis through NKG2D ligands and TRAIL receptors. Cancer Biol. Ther. 2012, 13, 516−26.
REFERENCES
(1) Dudka, J.; Gieroba, R.; Korga, A.; Burdan, F.; Matysiak, W.; Jodlowska-Jedrych, B.; Mandziuk, S.; Korobowicz, E.; Murias, M. Different effects of resveratrol on dose-related Doxorubicin-induced heart and liver toxicity. Evidence-Based Complementary Altern. Med.: eCAM 2012, 2012, 606183. (2) Sadruddin, S.; Arora, R. Resveratrol: Biologic and therapeutic implications. J. CardioMetab. Syndr. 2009, 4, 102−6. (3) Tome-Carneiro, J.; Larrosa, M.; Gonzalez-Sarrias, A.; TomasBarberan, F. A.; Garcia-Conesa, M. T.; Espin, J. C. Resveratrol and clinical trials: The crossroad from in vitro studies to human evidence. Curr. Pharm. Des. 2013, 19, 6064−93. (4) Pangeni, R.; Sahni, J. K.; Ali, J.; Sharma, S.; Baboota, S. Resveratrol: Review on therapeutic potential and recent advances in drug delivery. Expert Opin. Drug Deliv. 2014, 11, 1285−98. (5) Liu, Y. Z.; Wu, K.; Huang, J.; Liu, Y.; Wang, X.; Meng, Z. J.; Yuan, S. X.; Wang, D. X.; Luo, J. Y.; Zuo, G. W.; Yin, L. J.; Chen, L.; Deng, Z. L.; Yang, J. Q.; Sun, W. J.; He, B. C. The PTEN/PI3K/Akt and Wnt/ beta-catenin signaling pathways are involved in the inhibitory effect of resveratrol on human colon cancer cell proliferation. Int. J. Oncol. 2014, 45, 104−12. (6) Ferruelo, A.; Romero, I.; Cabrera, P. M.; Arance, I.; Andres, G.; Angulo, J. C. Effects of resveratrol and other wine polyphenols on the proliferation, apoptosis and androgen receptor expression in LNCaP cells. Actas Urol. Esp. 2014, 38, 397−404. (7) Frazzi, R.; Tigano, M. The multiple mechanisms of cell death triggered by resveratrol in lymphoma and leukemia. Int. J. Mol. Sci. 2014, 15, 4977−93. (8) Cooper, M. A.; Fehniger, T. A.; Caligiuri, M. A. The biology of human natural killer-cell subsets. Trends Immunol. 2001, 22, 633−40. (9) Trinchieri, G. Biology of natural killer cells. Adv. Immunol. 1989, 47, 187−376. (10) Huang, Q. S.; Li, Q.; Huang, Y.; Shang, P.; Zhang, M. J. Expansion of human natural killer cells ex vivo. Xibao yu Fenzi Mianyixue Zazhi 2008, 24, 1167−9. (11) Imai, C.; Iwamoto, S.; Campana, D. Genetic modification of primary natural killer cells overcomes inhibitory signals and induces specific killing of leukemic cells. Blood 2005, 106, 376−83. (12) Li, Q.; Mei, Q.; Huyan, T.; Xie, L.; Che, S.; Yang, H.; Zhang, M.; Huang, Q. Effects of simulated microgravity on primary human NK cells. Astrobiology 2013, 13, 703−14. (13) Chen, Y.; Wang, Y.; Zhuang, Y.; Zhou, F.; Huang, L. Mifepristone increases the cytotoxicity of uterine natural killer cells by acting as a glucocorticoid antagonist via ERK activation. PloS One 2012, 7, e36413. (14) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402−8. (15) Denman, C. J.; Senyukov, V. V.; Somanchi, S. S.; Phatarpekar, P. V.; Kopp, L. M.; Johnson, J. L.; Singh, H.; Hurton, L.; Maiti, S. N.; Huls, M. H.; Champlin, R. E.; Cooper, L. J.; Lee, D. A. Membranebound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PloS One 2012, 7, e30264. (16) Baur, J. A.; Sinclair, D. A. Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rev. Drug Discov. 2006, 5, 493−506. (17) Pezzuto, J. M. The phenomenon of resveratrol: Redefining the virtues of promiscuity. Ann. N.Y. Acad. Sci. 2011, 1215, 123−30. (18) Howitz, K. T.; Bitterman, K. J.; Cohen, H. Y.; Lamming, D. W.; Lavu, S.; Wood, J. G.; Zipkin, R. E.; Chung, P.; Kisielewski, A.; Zhang, L. L.; Scherer, B.; Sinclair, D. A. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 2003, 425, 191−6. (19) Lee, C. W.; Yen, F. L.; Huang, H. W.; Wu, T. H.; Ko, H. H.; Tzeng, W. S.; Lin, C. C. Resveratrol nanoparticle system improves dissolution properties and enhances the hepatoprotective effect of resveratrol through antioxidant and anti-inflammatory pathways. J. Agric. Food Chem. 2012, 60, 4662−71. (20) Lee, Y. J.; Im, J. H.; Won, S. Y.; Kim, Y. B.; Cho, M. K.; Nam, H. S.; Choi, Y. J.; Lee, S. H. Synergistic anti-cancer effects of resveratrol 10934
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
(40) Bachleda, P.; Vrzal, R.; Dvorak, Z. Resveratrol enhances NK cell cytotoxicity: Possible role for aryl hydrocarbon receptor. J. Cell. Physiol. 2010, 225, 289−90. (41) Calabrese, E. J.; Mattson, M. P.; Calabrese, V. Resveratrol commonly displays hormesis: Occurrence and biomedical significance. Hum. Exp. Toxicol. 2010, 29, 980−1015. (42) Timmers, S.; Auwerx, J.; Schrauwen, P. The journey of resveratrol from yeast to human. Aging 2012, 4, 146−58. (43) Goldberg, D. M.; Yan, J.; Soleas, G. J. Absorption of three winerelated polyphenols in three different matrices by healthy subjects. Clin. Biochem. 2003, 36, 79−87.
10935
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Concentration-Dependent Biphasic Effects of Resveratrol on Human Natural Killer Cells in Vitro Qi Li, Ting Huyan, Lin-Jie Ye, Ji Li, Jun-Ling Shi, and Qing-Sheng Huang* Key Laboratory for Space Bioscience and Space Biotechnology, School of Life Sciences, Northwestern Polytechnical University, 127 YouyiXilu, Xi’an, Shaanxi 710072, People’s Republic of China ABSTRACT: Resveratrol (RES) is a polyphenol phytoalexin from plants, which has been reported to possess a variety of biological effects. The properties of RES on human natural killer (NK) cells were assessed in this study. Results showed that RES has concentration-dependent biphasic effects on NK cells. In high concentration (50 μM), RES can inhibit viability and promoted apoptosis of NK cells and human lymphoblastoid T (Jurkat) cells, which may affect the caspase signaling pathway. The Jurkat cells were more sensitive than NK cells on the RES caused cell death. However, when the concentration range reduced from 3.13 to 1.56 μM, RES showed the positive effects on NK cells by increasing the NK cells cytotoxicity via up-regulating the expression of NKG2D and IFN-γ (in mRNA and protein levels). These results indicated that one needs to pay more attention to the dosage and biphasic effects when RES was applied as antitumor drugs or health products. KEYWORDS: resveratrol (RES), human natural killer (NK) cells, apoptosis, cytotoxicity, caspase
■
■
INTRODUCTION
Cell Lines and Primary Culture. The methods for preparing primary human NK cells were described in Huang et al.10 Briefly, peripheral venous blood (10 mL) from healthy donors (n = 12) was collected in heparinized tubes. The procedure of blood sample collecting was conforming to the informed consent guidelines of the Ethic Committees of Northwestern Polytechnical University. The peripheral blood mononuclear cells (PBMCs) were collected by using Lymphocyte Separation Liquid (Haoyang TBD, Tianjin, China) following the instructions. After being washed twice with PBS, the PBMCs were resuspended in RPMI-1640 media (Gibco, Rockville, MD), which was supplemented with 10% fetal bovine serum (FBS) (Gibco, Rockville, MD) containing 100IU IL-21 (Peprotech, Rocky Hill, NJ), 100 μg/mL of penicillin and streptomycin (Genview, Carlsbad, CA). Then, PBMCs were counted and cocultured with equal numbers of stimulating cells (irradiated genetically modified K562 cells, prepared according to Imai et al.11). After 3 weeks cultivation, 1 × 105 ex-vivo-expanded cells were collected and washed by PBS. The CD56-PE and CD3-FITC monoclonal antibodies (mAbs) and its isotype-matched controls (IgG1-FITC/IgG2-PE) (QuantoBio, Beijing) were used to test the purity of NK cells. The percentages of NK cells (CD56+CD3−) in ex-vivo-expanded cells were determined by flow cytometry (BD FACS Calibur, San Jose, CA). Jurkat cells, K562 cells (purchased from American Type Culture Collection, ATCC, Manassas, VA), and stimulating cells were maintained in RPMI-1640 cell media supplemented with 10% FBS containing 100 μg/mL of penicillin and streptomycin and routinely cultured at 37 °C in 5% CO2 incubator. RES Treatment. The RES was prepared in storage solution (100× working solution) (5, 2.5, 1.25, 0.625, 0.313, 0.156, and 0.078 mM) in DMSO. The working concentrations of RES used in this assays were 50, 25, 12.5, 6.25, 3.13, 1.56, and 0.78 μM, respectively. Jurkat cells or NK cells (5 × 105 each) were suspended, respectively, in 990 μL of RPMI-1640 (IL-2 free) and cultured in 24-well plates (Costar, New
Resveratrol (RES, 3,4′,5-trihydroxystilbene) is a polyphenol phytoalexin, which present in many plants. The skin and seeds of grape, wine, berries, and nuts are recognized as a rich source of RES.1 Recently, RES has been an extensively studied natural product due to its many beneficial effects, such as antioxidant, anti-inflammatory, antithrombotic, and anticancer.2−4 RES could modulate various physiological processes like cell proliferation, apoptosis, metastasis, and angiogenesis.5,6 Raffaele et al. reviewed the triggering cell death effect of RES on many lymphoma and leukemia cell lines mainly relying on its antiproliferation and induced apoptosis effects.7 Therefore, RES has received increasing attention as its potential applications in hematologic tumors treatments. Natural killer (NK) cells are lymphocytes with large granular properties, which are defined by the presence of CD56 and absence of CD3 on the cell surface (CD56+CD3−).8 NK cells comprise 5−10% of all peripheral blood lymphocytes,9 can lyse virally infected cells or oncogenically transformed cells, and secrete many kinds of cytokines without requiring prior immunization. NK cells could exert cytotoxicity on oncogenically transformed cells specifically and efficiently, which make them play an important role in tumor identification and surveillance. However, as a potential antitumor drug, the effects of RES on NK cells should be considered carefully. This study aims to investigate the effect of RES on human primary NK cells. Human lymphoblastoid T (Jurkat) cells were employed to compare the sensitivity of tumor cell line and primary cells to RES. After being treated with RES in concentration gradient, the viability and cytotoxicity of NK cells were analyzed. Furthermore, the underlying mechanism, including the apoptosis level, the expression of three NK cytokines (IFN-γ, perforin and granzyme-B), and four NK cell functional receptors (NKG2A, NKG2D, NKp30 and NKp44) were also delineated. © 2014 American Chemical Society
MATERIALS AND METHODS
Received: Revised: Accepted: Published: 10928
June 25, 2014 October 4, 2014 October 4, 2014 October 4, 2014 dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
York) at 37 °C in a 5% CO2 incubator with 10 μL of the RES storage solutions for 48 h. A 10 μL portion of DMSO was added to each control group to exclude its effect on cells. In addition, caspase inhibitor (z-VAD-FMK, Beyotime Institute of Biotechnology, Haimen, China) and JNK inhibitor (SP600125, Beyotime Institute of Biotechnology, Haimen, China) were used here to assess the relevant RES signaling pathway. Cell Viability and Cytotoxicity Assay. After 48 h RES treatment, Jurkat cells and NK cells in each group were centrifuged at 1000 × g for 5 min, washed with PBS, and resuspended in 600 μL of RPMI1640 media (IL-2 free). A 20 μL portion of CCK-8 (Cell Counting Kit-8, Dojindo, Japan) was added to a 200 μL cell suspension per well in a 96-well plate in triplicate for each group. The cells were then incubated for 2 h at 37 °C in a 5% CO2 incubator. The optical density (OD) values per well were recorded at 450 nm in microplate reader (BioTek Synergy-4). The procedure of NK cell cytotoxicity assay was described by Li et al.12 Briefly, NK cells (8 × 105) were separated from each RES treated group, washed three times with PBS, and resuspended in 400 μL of RPMI-1640 (IL-2 free). A 100 μL portion of NK cells (2 × 105) was plated into each well of a 96-well plate with 100 μL of K562 cells (4 × 104) in triplicate to make the effector-to-target ratio (E:T) at 5:1. The effector control wells contained 100 μL of NK cells (2 × 105 cells) and 100 μL of medium. The target control wells contained 100 μL of K562 cells (4 × 104 cells) and 100 μL of medium. Plates were incubated at 37 °C in a 5% CO2 incubator. After 4 h coculture, 20 μL of CCK-8 was added to each well, and the plate was then incubated for another 2 h with OD values recorded at 450 nm. Cytotoxicity was determined by evaluating the rate at which NK cells killed K562 cells; the killing rate was calculated as following equation:13
Table 1. Primer Pairs Used for RT-qPCR Analysis primer IFN-γ perforin granzyme-B NKG2A NKG2D
NKp30 NKp44 GAPDH
sequence (5′-3′) F: TGCAGGTCATTCAGATGTAGC R: GGACATTCAAGTCAGTTACCG F: GGGACAATAACAACCCCATCT R:GGAATTTTAGGTGGCCATGAT F:AGATCGAAAGTGCGAATCTGA R: TTCGTCCATAGGAGACAATGC F: TCATTGTGGCCATTGTCCTGAGG R: AGCACTGCACAGTTAAGTTCAGC F: ATCGCTGTAGCCATGGGAATCCG R: AGACATACAAGAGACCTGGCTCTC F: TGAGATTCGTACCCTGGAAGG R: CACTCTGCACACGTAGATGCT F: TCCAAGGCTCAGGTACTTCAA R: GATTGTGAATCGAGAGGTCCA F: TCCTGCACCACCAACTGCTTAGC R: ACACGGAAGGCCATGCCAGTGAGC
amplicon size (bp) 248 174 138 291 213
235 163 254
Biotechnology, Haimen, China), cells were centrifuged and washed 3 times with PBS, and then labeled with AnnexinV-FITC and PI following the instructions. NK cells treated by RES were centrifuged and washed with PBS, and then divided into 4 groups (1 × 105 cells each) and labeled with PE-conjugated mouse antihuman NKG2A (R&D Systems, Minnesota), NKG2D, NKp30, and NKp44 (BD Bioscience, California). All the cells were analyzed using flow cytometry. Data Analysis. Statistical analysis was performed using SPSS 16.0 statistical software (IBM, New York). The data were presented as the mean ± SD. The results were analyzed using the analysis of variance (ANOVA). Multiple comparisons used LSD test to evaluate the significance of differences between groups. Statistical significance was defined as p < 0.05.
killing rate (%) = [1 − (ODe + t − ODe)/ODt ] × 100% The notation is defined as follows: ODe, average OD450 of triplicate wells for NK cell control; ODt, average OD450 of triplicate wells for K562 cells control; ODe+t, average OD450 of triplicate wells for NK cells plus K562 cells. mRNA Expression Analysis. Total RNA was isolated from RES treated NK cells (1 × 107) by using TRIzol reagent (Invitrogen, Carlsbad, CA). The mRNA levels of three cytokines, IFN-γ, perforin, granzyme-B, and four receptors related to the cytotoxicity of NK cell, NKG2A, NKG2D, NKp30, and NKp44, were evaluated by relative quantification PCR (RT-qPCR) with SYBR Green random mixing method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. The 2−ΔΔCt method was used to calculate relative changes in gene expression.14 All primers used here are shown in Table 1. RT-qPCR was performed as the instructions of the TransStart Top Green qPCR SuperMix kit (TransGen Biotech, Beijing, China). The reaction mixtures were incubated for 30 min at 48 °C, followed by 40 cycles of PCR at 94 °C for 5 s, 55 °C for 15 s, and 72 °C for 10 s. At the end of 40 cycles, a melting curve analysis was performed to confirm the presence of only a single amplified product of the expected size. ELISA Assay of IFN-γ, Perforin, and Granzyme-B. The secretions of IFN-γ, perforin, and granzyme-B were assessed by corresponding ELISA Kits (BD Bioscience, CA). After RES treatment, NK cells (8 × 105) were centrifuged and washed with PBS, resuspended in 400 μL RPMI-1640 (IL-2 free), mixed with 1.6 × 105 K562 cells in 100 μL RPMI-1640 (IL-2 free), and then incubated for 4 h at 37 °C in 5% CO2 incubator (K562 cells were used to activate the cytokine secretion of NK cells according the literature).15 In the ELISA assay, each condition was performed twice, and OD values were recorded at 450 nm. Curve Expert 13.0 was employed to create the standard curve according to the OD values of standards. The quantities of these cytokine secreted by NK were calculated from these standard curves. Apoptosis and Receptor Expression Assay. AnnexinV-FITC Apoptosis Detection Kit (Beyotime Institute of Biotechnology, Haimen, China) was used to assess the apoptosis of Jurkat cells and NK cells. After treatment with RES in presence or absence of the zVAD-FMK (caspase inhibitor, 50 μg/mL, Beyotime Institute of
■
RESULTS NK Cell Purity. After 3 weeks of ex vivo expansion, primary human NK cells were harvested, stained with CD56-PE and CD3-FITC mAbs, and analyzed by flow cytometry. The percentage of NK cells (CD56+CD3−) was determined. The mean percentage of NK cells from 12 donors was 91.21 ± 1.78% (n = 12). Cell Viability. RES (12.5−50 μM) shows concentrationdependent effects on the viability of both Jurkat cells and NK cells. In the concentration of 50 μM, RES can inhibit the viability of both cells. Figure 1 shows the OD values were significantly reduced, which were 1.94 ± 0.33, 1.8 ± 0.34, 1.79 ± 0.37 1.74 ± 0.23, 1.85 ± 0.26, 1.47 ± 0.21, 1.41 ± 0.36, and 1.18 ± 0.29 in Jurkat cells, and 0.77 ± 0.05, 0.76 ± 0.03, 0.77 ± 0.04, 0.76 ± 0.03, 0.76 ± 0.04, 0.74 ± 0.02, 0.62 ± 0.03, and 0.48 ± 0.03, respectively, in NK cells with the concentration of RES increased from 0 to 50 μM (Figure 1A). It was noticed that when the concentration of RES reduced to 12.5 μM, there was no obvious inhibited effect on NK cells, but the Jurkat cells still could be affected until it reduced to 6.25 μM. This suggested that Jurkat cells are more sensitive than NK cells in response to RES causing cell death. On the other hand, inhibitors were employed here to assess the relevant signaling pathway RES may act with (Figure 1B). After pretreatment by inhibitors (z-VAD-FMK and SP600125), RES (50 μM) no longer showed the inhibited effect on Jurkat cells and NK cells in z-VAD-FMK group. The OD values in z-VAD-FMK group 10929
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Figure 1. OD values of cells treated with RES and inhibitors (n = 4). (A) Cells treated with RES in concentration gradient (0−50 μM) for 48 h. (B) Cells treated with RES (50 μM) in present or absent of z-VAD-FMK and SP600125 (50 μM each) for 48 h. Data represent the mean ± SD of four independent experiments. One-way ANOVA and LSD tests were performed: * p < 0.05 compared with the control; # p < 0.05 compared with the RES treated group.
Figure 2. Apoptosis and necrosis of Jurkat cells after RES treatment (n = 4). (A) A representative flow cytometry plot of Jurkat cells from one donor. The percentages of viable (Annexin V−/PI−), early apoptotic (Annexin V+/PI−), and late apoptotic/necrotic (Annexin V+/PI+) cells are shown. (B) The percentage of apoptosis in these cells is summarized in the bar graph; each column represents the mean ± SD from four independent experiments. Multivariate ANOVA and LSD tests were performed: * p < 0.05 compared with the control; # p < 0.05 compared with the RES treated group.
were 1.82 ± 0.11 and 0.71 ± 0.04, respectively, compared with the 1.29 ± 0.26 (Jurkat cells) and 0.56 ± 0.06 (NK cells) in RES groups. However, the OD values in SP600125 groups of the two cells showed no significant changes compared with the RES groups. It is suggested that RES may inhibit the viability of cells by causing them apoptosis/death via caspase signal pathway.
Cell Apoptosis. Cells stained by AnnexinV and PI after 48 h RES (50 μM) treatment in presence or absence of z-VADFMK were shown in Figures 2 and 3. Apoptosis of both Jurkat cells and NK cells increased comparing with the controls, and the apoptosis of Jurkat cells was more damaged than the latter. Early apoptosis (AnnexinV+/PI−) occurred in 15.9 ± 1.99% in NK cells and 15.59 ± 2.67% in Jurkat cells after RES treated 10930
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Figure 3. Apoptosis and necrosis of NK cells after RES treatment (n = 4). (A) A representative flow cytometry plot of NK cells from one donor. The percentages of viable (Annexin V−/PI−), early apoptotic (Annexin V+/PI−), and late apoptotic/necrotic (Annexin V+/PI+) NK cells are shown. (B) The percentage of apoptosis in these cells is summarized in the bar graph; each column represents the mean ± SD from four independent experiments. Multivariate ANOVA and LSD tests were performed: * p < 0.05 compared with the control; # p < 0.05 compared with the RES treated group.
compared with 4.24 ± 1.57% and 4.29 ± 1.25%, respectively, of the control (p < 0.05). Meanwhile, the late apoptosis/necrosis NK cells were 4.12 ± 1.08%, with no significant difference compared with 3.8 ± 1.79% of the control. However, the late apoptosis/necrosis Jurkat cells were 18.35 ± 3.24%, increased significantly compared with the 4.3 ± 1.82% in the control. Correspondingly, the percentages of viable cells were 78.78 ± 2.06% (NK cells) and 61.06 ± 2.4% (Jurkat cells) in RES treated groups compared with 89.98 ± 1.93% (NK cells) and 88.79 ± 1.5% (Jurkat cells) in control, respectively (p < 0.05). Furthermore, the RES-induced apoptosis and necrosis of cells were blocked by caspase inhibitor (z-VAD-FMK). After pretreatment by z-VAD-FMK, the apoptosis rates of Jurkat cells and NK cell were reduced partially. These results suggested that RES could induce Jurkat cell and NK cell apoptosis in 50 μM, which may be relevant with caspase signaling pathways. NK cells showed more resistance than Jurkat cells on RES induced apoptosis at dose tested. NK Cells Cytotoxicity. In this assay, NK cells were treated with RES in concentration gradient for 48 h. The cytotoxicity of the NK cells was tested. As shown in Figure 4, the cytotoxicity of NK cells was significantly decreased when the concentration of RES was above 25 μM, 61.42 ± 3.93% and 71.28 ± 3.55% in 50 and 25 μM treated groups compared with the 90.22 ± 1.43% in the control (p < 0.05). Unexpectedly, RES in low concentration (3.13 and 1.56 μM) increased the cytotoxicity of NK cells, 95.86 ± 1.56% and 94.73 ± 1.62% compared with control (p < 0.05). Therefore, in the following experiments, the mechanism underlying the increased NK cells cytotoxicity was studied under 3.13 μM treatment of RES.
Figure 4. Effect of RES on NK cell cytotoxicity (n = 4). Each column represents the mean ± SD from four independent experiments. Oneway ANOVA and LSD tests were performed: * p < 0.05 compared with the control.
RT-qPCR. Table 2 depicted the expression profiles of genes involved in NK cell functions after low concentration RES (3.13 μM) treatment. The mRNA level of IFN-γ increased significantly in the RES-treated group to 4.5-fold compared with the control (p < 0.05). Meanwhile, the mRNA levels of triggering receptors NKG2D were also up-regulated signifi10931
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Table 2. RES in Low Concentration Regulated NK Cell Functional Proteins at the mRNA Level (n = 6)a gene
IFN-γ
perforin
granzyme-B
NKG2A
NKG2D
NKp30
NKp44
compared with control
4.5(fold)b
2.14(fold)
1.77(fold)
0.53(fold)
6.36(fold)b
1.39(fold)
1.71(fold)
a
SYBR green-based RTq-PCR was used to examine the mRNA levels of genes that are important for NK cell functions. The data represent the mean ± SD of six independent experiments. One-way ANOVA and LSD test. bp < 0.05 compared with 1.
treated by RES with concentration gradient. The viability, apoptosis, and cytotoxicity of NK cells were detected. Jurkat cells were used to assess if there was a sensitivity difference for RES between primary cells and tumor cells. When RES was employed as a drug or adjuvant to inhibit viability or induce apoptosis on tumor cells in vitro, the common working concentrations were 25−200 μM.27−30 In the present study we noticed that when the concentration of RES above 12.5 μM, the significant inhibiting effect was observed on Jurkat cells, but the threshold in NK cells was 25 μM. It indicated that tumor cell lines such as Jurkat are more sensitive than NK cells to the toxicity effect of RES. Jazirehi et al. reported that, in 10 μM concentration, RES did not show any toxicity on human PBMCs, but it caused cell death in Roma cell lines.31 Another study reported that RES reduced the viability and DNA synthesis capability of the promyelocytic leukemia (HL-60) cell;32 it also inhibited growth of human colon tumorigenic cells mediated by cell cycle arrest.33 Tumor cells grow more actively than primary cells, the DNA synthesis reduction and cell cycle arrest caused by RES affect the tumor cell proliferation more serious than primary cells, which may explain the sensitivity difference of RES between the two kinds of cells. Many studies have indicated the biphasic effects of RES on cells. It was reported that RES can promote GH3 cells proliferation at low concentrations (1 μM) and inhibit it at high concentrations (>10 μM), and the RES-induced GH3 cell apoptosis was caspase-dependent.25 Suzuki et al. observed cleavage of caspase-3 and poly(ADP-ribose) polymerase in RES-treated cells, which indicated that RES induces caspasedependent apoptosis in MT-2 and HUT-102 cells.34 Our results showed, at the high concentration (50 μM), RES reduces OD values of both Jurkat cells and NK cells, while caspase inhibitor z-VAD-FMK can prevent RES caused cell death. The flow cytometry assay confirmed these results; after pretreatment by z-VAD-FMK, the early and late apoptosis/ necrosis cells caused by RES were reduced significantly, which suggests that RES promotes cell apoptosis via caspase signaling pathway. Kashif et al. reported that RES (4−8 μM) treatment inhibited the caspase activation, and H2O2 induced apoptosis in HL60 cells.35 Another study showed that RES in 2 and 5 μM increased the percentage of CD19+ cell in human PBMCs. However, 10 μM RES inhibited the proliferation of B lymphocyte.36 In our results, RES (in 1.56−6.25 μM) did not show the promote proliferation or antiapoptosis effects (data not shown) on either Jurkat cells or NK cells, but it actually promoted the cytotoxicity of NK cells in 1.56−3.13 μM. The cytotoxicity of NK cells plays a key role in tumor identification and surveillance. NK cells kill malignant cells by secretion of IFN-γ, perforin, and granzyme-B. NKG2D is the most important triggering receptor on NK cells which trigger cytotoxicity and mediate the secretion of IFN-γ.37 RT-qPCR and flow cytometry assays indicated that RES in 3.13 μM can increase the expression of NKG2D both in mRNA and protein level. Results from Lu et al. show that RES pretreatment increases NK cell cytotoxicity in a dose-dependent (1.56−12.5
cantly in the RES treated group, which increased 6.36-fold compared with control (p < 0.05). ELISA. The levels of cytokine and cytolytic proteins in the NK cell supernatants are illustrated in Figure 5. It is noticed
Figure 5. IFN-γ, perforin, and granzyme-B secretion of NK cells after RES treatment. RES (3.125 μM) treated NK cells were stimulated with K562 cells, supernatants were collected, and then the concentrations of IFN-γ, perforin, and granzyme-B were detected. Each column represents mean ± SD of four independent experiments. One-way ANOVA and LSD tests were performed: * p < 0.05 compared with control.
that the IFN-γ level was increased under 3.13 μM RES treatment, which was increased to 730 ± 41 pg/mL compared with the 400 ± 35 pg/mL in the control (p < 0.05). The concentration of perforin was not changed significantly. They were about 800 ng/mL in RES treated and control groups. However, the granzyme-B was hardly detected in the supernatants of two groups. Receptor Expression. Flow cytometry assays indicate that NK cells display a significant up-regulation of NKG2D (Figure 6). The positive percentage of NKG2D increased from 83.52 ± 5.64% in the control group to 94.2 ± 4.67% in RES treated group (p < 0.05). The positive percentages of NKG2A, NKp30, and NKp44 were not changed obviously.
■
DISCUSSION As a small polyphenol, RES was found in various plant sources,16 and has been demonstrated to have many beneficial effects and received a lot of attention in recent years. RES was well-known for use in various areas including anti-inflammatory, antioxidant, antidiabetic, and antiaging.17−19 Also, it showed the positive effects of triggering cell death in a great variety of human tumor cells, such as colon, prostate, breast, lymphoma, and leukemia.20−24 For these reasons, RES has been recognized as a potential adjuvant in cancer chemotherapy.25,26 NK cells play a pivotal role in innate and adaptive immunity, especially in tumor surveillance. The effect of RES on human NK cells should be assessed carefully if it has been used as antitumor drug. In this study, primary human NK cells were 10932
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
Figure 6. Protein expression profiles for the NK cell receptors NKG2A, NKG2D, NKp30, and NKp44 after low concentration RES treatment. (A) NK cells were stained with PE-conjugated mAbs and analyzed by flow cytometry (for example). (B) The bar graph represents the mean ± SD from three independent experiments. One-way ANOVA and LSD test: * p < 0.05 compared with control.
μM) manner by up-regulation of the expression of NKG2D and perforin expression.38 In our results, the change of perforin expression was not obvious, but the IFN-γ expression was upregulated significantly. Increased expression of NKG2D and IFN-γ may be the reason for enhanced cytotoxicity of NK cells. Hu et al. reported that RES treatment also increases the cellsurface expression of NKG2D ligands on human promyeloblastic leukemia KG-1a cells.39 It indicated that RES can enhance the CIK (cytokine-induced killer) via up-regulation of the expression of both NKG2D and NKG2D ligands on effector and target cells, respectively. Thought that the effects of RES on NK cytotoxic activity may be due to partial agonistic activity of RES on aryl hydrocarbon receptor (AhR).40 They speculated that RES is a partial agonist of human AhR and exerts its effect on NK cells by the mechanism involving activation of JNK (c-Jun N-terminal kinase) and ERK (extracellular-regulated kinase).38,40 Unlike caspase inhibitor, JNK inhibitor SP600125 did not show the abolished effects on high concentration RES induced NK cell apoptosis in our study. However, JNK may relate to the positive effect of RES on NK cells. The present study indicated that RES has biphasic effects on human NK cells. Other biphasic effects of RES on tumor cells or several parasitic diseases were also reported (reviewed by Calabrese et al.41). In line with these findings, it indicated that RES acts via multiple target pathways (AhR, JNK, and ERK).42 Due to rapid metabolism in human body, RES may hardly reach the body tissues in sufficient dosage to exert the beneficial
health effects by oral consumption.43 Using RES as one kind of injection may be part of the solution. Therefore, it was very important to confirm and calculate the effective concentration of RES accurately when it was used as a potential antitumor or health product.
■
AUTHOR INFORMATION
Corresponding Author
*Phone:+86-029-88460332. Fax: +86-029-88460332. E-mail: [email protected]. Funding
We gratefully acknowledge financial support from the Natural Science Foundation of Shaanxi Province (Grant 2014JM4171) and the Fundamental Research Funds for the Central Universities (Grant 3102014JKY15008). Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED CCK-8, cell counting kit-8; E:T, effector versus target; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFN, interferon; IL, interleukin; LSD, least significant difference; mAbs, monoclonal antibodies; NK, natural killer; OD, optical density; PBMC, peripheral blood mononuclear cell; PBS, phosphate-buffered saline; RES, resveratrol 10933
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
■
Article
and chemotherapeutic agent clofarabine against human malignant mesothelioma MSTO-211H cells. Food Chem. Toxicol. 2013, 52, 61−8. (21) Castillo-Pichardo, L.; Dharmawardhane, S. F. Grape polyphenols inhibit Akt/mammalian target of rapamycin signaling and potentiate the effects of gefitinib in breast cancer. Nutr. Cancer 2012, 64, 1058−69. (22) Can, G.; Cakir, Z.; Kartal, M.; Gunduz, U.; Baran, Y. Apoptotic effects of resveratrol, a grape polyphenol, on imatinib-sensitive and resistant K562 chronic myeloid leukemia cells. Anticancer Res. 2012, 32, 2673−8. (23) Iguchi, K.; Toyama, T.; Ito, T.; Shakui, T.; Usui, S.; Oyama, M.; Iinuma, M.; Hirano, K. Antiandrogenic activity of resveratrol analogs in prostate cancer LNCaP cells. J. Androl. 2012, 33, 1208−15. (24) Juan, M. E.; Alfaras, I.; Planas, J. M. Colorectal cancer chemoprevention by trans-resveratrol. Pharmacol. Res. 2012, 65, 584− 91. (25) Chao, W.; Xuexin, Z.; Jun, S.; Ming, C.; Hua, J.; Li, G.; Tan, C.; Xu, W. Effects of resveratrol on cell growth and prolactin synthesis in GH3 cells. Exp. Ther. Med. 2014, 7, 923−928. (26) Yang, X.; Li, X.; Ren, J. From French Paradox to cancer treatment: anti-cancer activities and mechanisms of resveratrol. AntiCancer Agents Med. Chem. 2014, 14, 806−25. (27) Park, D. G. Antichemosensitizing effect of resveratrol in cotreatment with oxaliplatin in HCT116 colon cancer cell. Ann. Surg. Treat. Res. 2014, 86, 68−75. (28) Yan, H. W.; Hu, W. X.; Zhang, J. Y.; Wang, Y.; Xia, K.; Peng, M. Y.; Liu, J. Resveratrol induces human K562 cell apoptosis, erythroid differentiation, and autophagy. Tumor Biol. 2014, 35, 5381−8. (29) Ge, J.; Liu, Y.; Li, Q.; Guo, X.; Gu, L.; Ma, Z. G.; Zhu, Y. P. Resveratrol induces apoptosis and autophagy in T-cell acute lymphoblastic leukemia cells by inhibiting Akt/mTOR and activating p38-MAPK. Biomed. Environ. Sci. 2013, 26, 902−11. (30) Zou, T.; Yang, Y.; Xia, F.; Huang, A.; Gao, X.; Fang, D.; Xiong, S.; Zhang, J. Resveratrol inhibits CD4+ T cell activation by enhancing the expression and activity of Sirt1. PloS One 2013, 8, e75139. (31) Jazirehi, A. R.; Bonavida, B. Resveratrol modifies the expression of apoptotic regulatory proteins and sensitizes non-Hodgkin’s lymphoma and multiple myeloma cell lines to paclitaxel-induced apoptosis. Mol. Cancer Ther. 2004, 3, 71−84. (32) Surh, Y. J.; Hurh, Y. J.; Kang, J. Y.; Lee, E.; Kong, G.; Lee, S. J. Resveratrol, an antioxidant present in red wine, induces apoptosis in human promyelocytic leukemia (HL-60) cells. Cancer Lett. 1999, 140, 1−10. (33) Gonzalez-Sarrias, A.; Gromek, S.; Niesen, D.; Seeram, N. P.; Henry, G. E. Resveratrol oligomers isolated from Carex species inhibit growth of human colon tumorigenic cells mediated by cell cycle arrest. J. Agric. Food Chem. 2011, 59, 8632−8. (34) Suzuki, Y.; Ito, S.; Sasaki, R.; Asahi, M.; Ishida, Y. Resveratrol suppresses cell proliferation via inhibition of STAT3 phosphorylation and Mcl-1 and cIAP-2 expression in HTLV-1-infected T cells. Leuk. Res. 2013, 37, 1674−9. (35) Ahmad, K. A.; Clement, M. V.; Hanif, I. M.; Pervaiz, S. Resveratrol inhibits drug-induced apoptosis in human leukemia cells by creating an intracellular milieu nonpermissive for death execution. Cancer Res. 2004, 64, 1452−9. (36) Zunino, S. J.; Storms, D. H. Resveratrol alters proliferative responses and apoptosis in human activated B lymphocytes in vitro. J. Nutr. 2009, 139, 1603−8. (37) Krzewski, K.; Strominger, J. L. The killer’s kiss: The many functions of NK cell immunological synapses. Curr. Opin. Cell Biol. 2008, 20, 597−605. (38) Lu, C. C.; Chen, J. K. Resveratrol enhances perforin expression and NK cell cytotoxicity through NKG2D-dependent pathways. J. Cell. Physiol. 2010, 223, 343−51. (39) Hu, L.; Cao, D.; Li, Y.; He, Y.; Guo, K. Resveratrol sensitized leukemia stem cell-like KG-1a cells to cytokine-induced killer cellsmediated cytolysis through NKG2D ligands and TRAIL receptors. Cancer Biol. Ther. 2012, 13, 516−26.
REFERENCES
(1) Dudka, J.; Gieroba, R.; Korga, A.; Burdan, F.; Matysiak, W.; Jodlowska-Jedrych, B.; Mandziuk, S.; Korobowicz, E.; Murias, M. Different effects of resveratrol on dose-related Doxorubicin-induced heart and liver toxicity. Evidence-Based Complementary Altern. Med.: eCAM 2012, 2012, 606183. (2) Sadruddin, S.; Arora, R. Resveratrol: Biologic and therapeutic implications. J. CardioMetab. Syndr. 2009, 4, 102−6. (3) Tome-Carneiro, J.; Larrosa, M.; Gonzalez-Sarrias, A.; TomasBarberan, F. A.; Garcia-Conesa, M. T.; Espin, J. C. Resveratrol and clinical trials: The crossroad from in vitro studies to human evidence. Curr. Pharm. Des. 2013, 19, 6064−93. (4) Pangeni, R.; Sahni, J. K.; Ali, J.; Sharma, S.; Baboota, S. Resveratrol: Review on therapeutic potential and recent advances in drug delivery. Expert Opin. Drug Deliv. 2014, 11, 1285−98. (5) Liu, Y. Z.; Wu, K.; Huang, J.; Liu, Y.; Wang, X.; Meng, Z. J.; Yuan, S. X.; Wang, D. X.; Luo, J. Y.; Zuo, G. W.; Yin, L. J.; Chen, L.; Deng, Z. L.; Yang, J. Q.; Sun, W. J.; He, B. C. The PTEN/PI3K/Akt and Wnt/ beta-catenin signaling pathways are involved in the inhibitory effect of resveratrol on human colon cancer cell proliferation. Int. J. Oncol. 2014, 45, 104−12. (6) Ferruelo, A.; Romero, I.; Cabrera, P. M.; Arance, I.; Andres, G.; Angulo, J. C. Effects of resveratrol and other wine polyphenols on the proliferation, apoptosis and androgen receptor expression in LNCaP cells. Actas Urol. Esp. 2014, 38, 397−404. (7) Frazzi, R.; Tigano, M. The multiple mechanisms of cell death triggered by resveratrol in lymphoma and leukemia. Int. J. Mol. Sci. 2014, 15, 4977−93. (8) Cooper, M. A.; Fehniger, T. A.; Caligiuri, M. A. The biology of human natural killer-cell subsets. Trends Immunol. 2001, 22, 633−40. (9) Trinchieri, G. Biology of natural killer cells. Adv. Immunol. 1989, 47, 187−376. (10) Huang, Q. S.; Li, Q.; Huang, Y.; Shang, P.; Zhang, M. J. Expansion of human natural killer cells ex vivo. Xibao yu Fenzi Mianyixue Zazhi 2008, 24, 1167−9. (11) Imai, C.; Iwamoto, S.; Campana, D. Genetic modification of primary natural killer cells overcomes inhibitory signals and induces specific killing of leukemic cells. Blood 2005, 106, 376−83. (12) Li, Q.; Mei, Q.; Huyan, T.; Xie, L.; Che, S.; Yang, H.; Zhang, M.; Huang, Q. Effects of simulated microgravity on primary human NK cells. Astrobiology 2013, 13, 703−14. (13) Chen, Y.; Wang, Y.; Zhuang, Y.; Zhou, F.; Huang, L. Mifepristone increases the cytotoxicity of uterine natural killer cells by acting as a glucocorticoid antagonist via ERK activation. PloS One 2012, 7, e36413. (14) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402−8. (15) Denman, C. J.; Senyukov, V. V.; Somanchi, S. S.; Phatarpekar, P. V.; Kopp, L. M.; Johnson, J. L.; Singh, H.; Hurton, L.; Maiti, S. N.; Huls, M. H.; Champlin, R. E.; Cooper, L. J.; Lee, D. A. Membranebound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PloS One 2012, 7, e30264. (16) Baur, J. A.; Sinclair, D. A. Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rev. Drug Discov. 2006, 5, 493−506. (17) Pezzuto, J. M. The phenomenon of resveratrol: Redefining the virtues of promiscuity. Ann. N.Y. Acad. Sci. 2011, 1215, 123−30. (18) Howitz, K. T.; Bitterman, K. J.; Cohen, H. Y.; Lamming, D. W.; Lavu, S.; Wood, J. G.; Zipkin, R. E.; Chung, P.; Kisielewski, A.; Zhang, L. L.; Scherer, B.; Sinclair, D. A. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 2003, 425, 191−6. (19) Lee, C. W.; Yen, F. L.; Huang, H. W.; Wu, T. H.; Ko, H. H.; Tzeng, W. S.; Lin, C. C. Resveratrol nanoparticle system improves dissolution properties and enhances the hepatoprotective effect of resveratrol through antioxidant and anti-inflammatory pathways. J. Agric. Food Chem. 2012, 60, 4662−71. (20) Lee, Y. J.; Im, J. H.; Won, S. Y.; Kim, Y. B.; Cho, M. K.; Nam, H. S.; Choi, Y. J.; Lee, S. H. Synergistic anti-cancer effects of resveratrol 10934
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
Journal of Agricultural and Food Chemistry
Article
(40) Bachleda, P.; Vrzal, R.; Dvorak, Z. Resveratrol enhances NK cell cytotoxicity: Possible role for aryl hydrocarbon receptor. J. Cell. Physiol. 2010, 225, 289−90. (41) Calabrese, E. J.; Mattson, M. P.; Calabrese, V. Resveratrol commonly displays hormesis: Occurrence and biomedical significance. Hum. Exp. Toxicol. 2010, 29, 980−1015. (42) Timmers, S.; Auwerx, J.; Schrauwen, P. The journey of resveratrol from yeast to human. Aging 2012, 4, 146−58. (43) Goldberg, D. M.; Yan, J.; Soleas, G. J. Absorption of three winerelated polyphenols in three different matrices by healthy subjects. Clin. Biochem. 2003, 36, 79−87.
10935
dx.doi.org/10.1021/jf502950u | J. Agric. Food Chem. 2014, 62, 10928−10935
