Extremophiles DOI 10.1007/s00792-016-0819-9
METHOD PAPER
Conjugative plasmid transfer from Escherichia coli is a versatile approach for genetic transformation of thermophilic Bacillus and Geobacillus species Yurie Tominaga1 · Takashi Ohshiro1 · Hirokazu Suzuki1
Received: 5 November 2015 / Accepted: 14 February 2016 © Springer Japan 2016
Abstract We previously demonstrated efficient transformation of the thermophile Geobacillus kaustophilus HTA426 using conjugative plasmid transfer from Escherichia coli BR408. To evaluate the versatility of this approach to thermophile transformation, this study examined genetic transformation of various thermophilic Bacillus and Geobacillus spp. using conjugative plasmid transfer from E. coli strains. E. coli BR408 successfully transferred the E. coli–Geobacillus shuttle plasmid pUCG18T to 16 of 18 thermophiles with transformation efficiencies between 4.1 × 10−7 and 3.8 × 10−2/recipient. Other E. coli strains that are different from E. coli BR408 in intracellular DNA methylation also generated transformants from 9 to 15 of the 18 thermophiles, including one that E. coli BR408 could not transform, although the transformation efficiencies of these strains were generally lower than those of E. coli BR408. The conjugation was performed by simple incubation of an E. coli donor and a thermophile recipient without optimization of experimental conditions. Moreover, thermophile transformants were distinguished from abundant E. coli donor only by high temperature incubation. These observations suggest that conjugative plasmid transfer, particularly using E. coli BR408, is a facile and versatile approach for plasmid introduction into thermophilic Bacillus and Geobacillus spp., and potentially a variety of other thermophiles.
Communicated by L. Huang. * Hirokazu Suzuki [email protected] 1
Department of Chemistry and Biotechnology, Graduate School of Engineering, Tottori University, Tottori 680‑8552, Japan
Keywords Geobacillus · Bacillus · Thermophiles · Conjugation · Genetic transformation Abbreviations LB Luria–Bertani LK5 LB medium supplemented with kanamycin (5 mg/l) PCR Polymerase chain reaction R–M Restriction–modification
Introduction Rational genetic modification, such as inactivation or forced expression of target genes, has been an important strategy in recent microbial studies. This process is commonly achieved via the introduction of exogenous DNA into microbial cells. Some bacteria exhibit natural competence and may autonomously uptake exogenous DNA; however, most other microbes barely uptake exogenous DNA without forcible artificial procedures. There are several methods for forcible DNA introduction (Aune and Aachmann 2010), including approaches using protoplast and competent cells, which are more permeable to exogenous DNA. Protoplast cells, for example, are widely used in Gram-positive bacteria, such as Streptomyces and Bacillus spp., whereas competent cells have been historically used for Escherichia coli. In addition, it is known that E. coli cells can uptake exogenous DNA following electroshock. This method, termed electroporation, is relatively versatile and is used for forcible DNA introduction into bacteria and eukaryotes. Various microbes can now be genetically modified using these methods. However, it is difficult to establish protocols for the forcible introduction of exogenous DNA into microbes of interest because effective methods and optimal conditions remarkably vary among microbes
13
Extremophiles
and have to be experientially determined. This fact often hinders biological and biotechnological studies of attractive microbes. The genus Bacillus comprises Gram-positive, aerobic or facultatively anaerobic, rod-shaped bacteria. The members of this genus include thermophilic, alkalophilic, psychrophilic, halophilic, and/or pressure resistant strains, which have been identified in a wide variety of environments. Several thermophilic members had been phylogenetically reclassified into the new genus Geobacillus (Nazina et al. 2001), whereas other thermophilic members remained in the genus Bacillus. These Bacillusrelated thermophiles exhibit optimum growth at temperatures ranging from 55 to 65 °C and often have remarkable properties, such as the cellulolytic ability of G. stearothermophilus XL-65-6 (Lai and Ingram 1993), alkanedegrading ability of G. thermoleovorans B23 (Kato et al. 2001), and pentose- and hexose-utilizing abilities of G. thermoglucosidasius (Cripps et al. 2009). Because of these properties, Bacillus-related thermophiles are attractive for use in microbial bioprocesses performed at high temperatures (Wiegel and Ljungdahl 1986). It is noteworthy that G. thermoglucosidasius has been further engineered for high-temperature ethanol and isobutanol production via rational genetic modification (Cripps et al. 2009; Lin et al. 2014; Taylor et al. 2008). This shows that rational genetic modification can expand opportunities for the use of these thermophiles in high-temperature bioprocesses. Although several Bacillus-related thermophiles can be transformed using electroporation or protoplast methods (Blanchard et al. 2014; Cripps et al. 2009; De Rossi et al. 1994; Imanaka et al. 1982; Kananavicˇiu¯te˙ and Čitavicˇius 2015; Liao et al. 1986; Nakayama et al. 1992; Narumi et al. 1993; Taylor et al. 2008; Wu and Welker 1989), we previously demonstrated that conjugative transfer from E. coli is an effective approach for plasmid transformation of G. kaustophilus HTA426 (Suzuki and Yoshida 2012). The conjugation was performed in a mixture that contained an E. coli donor and a G. kaustophilus recipient without minute optimization of experimental conditions. Although conjugation often causes difficulty in distinguishing between recipient transformants and donor cells in cell mixtures because they share a selectable marker, G. kaustophilus was readily distinguishable from E. coli via high temperature incubation. These observations led us to the hypothesis that conjugative plasmid transfer from E. coli may be useful for plasmid introduction into other thermophiles. To evaluate this hypothesis, this study examined the plasmid transformation of various thermophilic Bacillus and Geobacillus spp. using this approach.
13
Materials and methods Bacterial strains, media, plasmids, and primers Table 1 lists the bacterial strains used in this study, along with their strain codes. Primers used are summarized in Table 2. The plasmids pUCG18T, pIR207, and pIR408 were constructed previously (Suzuki and Yoshida 2012). pUB307 (Bennett et al. 1977) was used as a conjugation helper plasmid. The structures of these plasmids are shown in Fig. 1. E. coli DH5α was purchased from Takara Bio (Otsu, Shiga, Japan). E. coli DH5α harboring pUB307 was termed E. coli DH5α′. E. coli strains BR397, BR398, and BR408 were constructed previously (Suzuki and Yoshida 2012). E. coli strains were grown at 37 °C in Luria–Bertani (LB) medium, and ampicillin (50 mg/l), kanamycin (50 mg/l), chloramphenicol (13 mg/l), and tetracycline (7 mg/l) were added when necessary. G. kaustophilus HTA426 was obtained from the RIKEN BioResource Center (Tsukuba, Japan; JCM 12893). Other thermophiles were purchased from the Bacillus Genetic Stock Center (Columbus, OH, USA). Thermophiles were grown at 60 °C in LB medium; however, their transformants harboring pUCG18T were cultured in LK5, which is LB medium supplemented with kanamycin (5 mg/l). Conjugative plasmid transfer from E. coli Escherichia coli strains MK397, MK398, MK408, and DH5α′ were transformed with pUCG18T and used as DNA donors. E. coli donor and thermophile recipients were grown in LB media until the optical density at 600 nm reached 0.3. Cultures of donor (1 ml) and recipient (9 ml) were mixed and filtered through a nitrocellulose membrane (0.22 µm) using reduced pressure. Cells that accumulated on a membrane were incubated on LB plates at 37 °C for 16 h to achieve conjugation and suspended in LB medium. Aliquots of the cell suspensions were subsequently incubated at 60 °C on LB and LK5 plates to determine the total numbers of recipients and transformants, respectively. These numbers were used to calculate the conjugative transfer (transformation) efficiency, which is the ratio of the number of transformant cells (grown on LK5) to the total number of recipient cells (grown on LB). pUCG18T identification Plasmid pUCG18T was isolated from thermophilic transformants using the Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI, USA). The isolation was essentially performed according to the manufacturer’s protocol, except that cells were initially
Extremophiles Table 1 Bacterial strains used in this study Strain
Relevant description
Strain code
E. coli strains BR397
Derivative of strain ER1793; ΔhsdMS, Δdam, Δdcm, pUB307, pIR207
BR398
Derivative of strain ER1793; ΔhsdMS, dam+, Δdcm, pUB307, pIR207
BR408
Derivative of strain ER1793; ΔhsdMS, dam+, Δdcm, pUB307, pIR408 Derivative of strain DH5α; hsdMS+, dam+, dcm+, pUB307, pIR207
DH5α′ Thermophilic Bacillus spp. B. caldolyticus DSM 405
An isolate from hot natural pool (Sharp et al. 1980)
1
B. caldotenax DSM 406
An isolate from superheated pool water (Sharp et al. 1980)
2
B. caldovelox DSM 411
An isolate from superheated pool water (Sharp et al. 1980)
3 4
G. stearothermophilus NRRL B-4419
Type strain of G. stearothermophilus (Zeigler 2001) A sterilization standard (Zeigler 2001)
5
G. stearothermophilus XL-65-6
An isolate from rotting wood in Florida, USA (Lai and Ingram 1993)
6
Geobacillus spp. G. stearothermophilus ATCC 12980
G. stearothermophilus strain 10
An isolate from hot springs in Yellowstone National Park (Zeigler 2001)
7
G. thermoglucosidasius DSM 2542
An isolate from soil in Japan (Zeigler 2001)
8
G. thermoleovorans DSM 5366
An isolate from soil near hot water effluent (Zeigler 2001)
9
G. uzenensis DSM 13551
An isolate from formation water of the Liaohe oil field (Zeigler 2001)
10
G. subterraneus DSM 13552
An isolate from formation water of the Liaohe oil field (Zeigler 2001)
11
G. thermoleovorans B23 Geobacillus sp. NTU 01
An isolate from a deep subterranean oil reservoir at Niigata, Japan (Kato et al. 2001)
12
A strain from the collection of National Taiwan University
13
Geobacillus sp. NTU 02
A strain from the collection of National Taiwan University
14
Geobacillus sp. NTU 03
A strain from the collection of National Taiwan University
15
Geobacillus sp. NTU 04
A strain from the collection of National Taiwan University
16
G. kaustophilus ATCC 8005
An isolate from pasteurized milk (Priest et al. 1988); type strain of G. kaustophilus
17
G. kaustophilus HTA426
An isolate from a deep-sea sediment of the Mariana Trench (Takami et al. 1997, 2004)
18
hsdMS is responsible for N6-methylation of 5′-AACN6GTGC-3′ and 5′-GCACN6GTT-3′ (methylation sites underlined). dam and dcm are responsible for N6-methylation of 5′-GATC-3′ and C6-methylation of 5′-CCWGG-3′, respectively Table 2 Primers used in this study
Primer
Sequence (5′–3′)
Target region
F1
GCCGCATGCTTATTCAACATTTCCGTG
bla gene (0.8 kb)
R1
TAGTTGCCTGACTCCCCGTC
F2 R2 F3 R3 F4
CCCGGATCCTTCGAGCACTACAGGAAC CCGGATCCTGAGCGAAGGTAGTTGCAC GCGGTAATACGGTTATCCACAG ACCCCGTAGAAAAGATCAAAGG ACTTAGAGAAAGTGTATCAAACTG
bla gene (0.8 kb) pBST1 replicon (1.5 kb) pBST1 replicon (1.5 kb) pUC replicon (0.7 kb) pUC replicon (0.7 kb)
R4
TATCCACCTGAATCATAAATCGG
incubated at 37 °C for 15 min with lysozyme (1 mg/ml). The plasmid was analyzed using agarose gel electrophoresis, reintroduction into E. coli DH5α, and polymerase chain reaction (PCR). PCR was performed using Quick Taq HS DyeMix (Toyobo, Osaka, Japan) and primers to amplify bla gene (F1 and R1), the pBST1 replicon (F2 and R2), and the pUC replicon (F3 and R3). Inverse PCR was also performed using primers (F4 and R4) that anneal to the middle position of TK101 gene with
Circular DNA containing TK101 gene Circular DNA containing TK101 gene
a back-to-back orientation and thereby amplify circular pUCG18T. pUCG18T stability assay Thermophilic transformants harboring pUCG18T (102 cells/ml) were cultured at 60 °C for 24 h in liquid LB without antibiotics. The resulting cells in late stationary phase (109 cells/ml) were spread on LB plates to isolate single
13
Extremophiles Fig. 1 Plasmid structures of pUCG18T (a), pIR207 (b), pIR408 ▸ (c), and pUB307 (d). a pUCG18T is a pUC18-derived plasmid that can shuttle between E. coli and Geobacillus spp. (Taylor et al. 2008; Suzuki and Yoshida 2012). The structure is shown with unique restriction enzyme sites. bla, ampicillin resistance gene functional in E. coli; TK101, kanamycin resistance gene functional at high temperatures (Liao et al. 1986); pUC, pUC replicon functional in E. coli; pBST1, pBST1 replicon functional in Geobacillus spp. (Taylor et al. 2008); oriT, conjugative transfer origin from pRK2013 (Figurski and Helinski 1979). b pIR207 is an E. coli plasmid containing a chloramphenicol resistance gene (cat) and the p15A replicon (Suzuki and Yoshida 2012). c pIR408 is a derivative of pIR207, containing the hsdM1S1 and hsdM2S2 genes that encode DNA methyltransferase subunits of type I R–M systems of 18 (Suzuki and Yoshida 2012). d pUB307 is a derivative of the conjugation plasmid RP1 (Bennett et al. 1977). This plasmid contains kanamycin (kan) and tetracycline (tet) resistance genes, the oriV replication origin, the tra genes to serve as a conjugation helper, and the oriT region. The oriV replicon is functional in E. coli and compatible with pUC and p15A replicons. pUB307 cannot replicate in thermophiles even if transferred to their cells
colonies and subsequently 100 colonies were checked for kanamycin resistance to determine plasmid retention rate.
Results Conjugative plasmid transfer from E. coli BR408 Escherichia coli BR408 transferred the E. coli–Geobacillus shuttle plasmid pUCG18T (Fig. 1a) to 16 of 18 thermophiles via conjugation, generating transformants resistant to kanamycin. Transformation efficiencies were markedly different (Fig. 2). Strains 8 and 13 were transformed as efficiently as 18. Strain 9 was more efficiently transformed, but others were less efficiently transformed than 18. Strains 4 and 15 provided no transformants (transformation efficiency, 99 >99 >99 47 ± 11
18
27 ± 13
In a previous study (Suzuki and Yoshida 2012), we constructed E. coli BR408, which was designed for conjugative plasmid transfer to 18. E. coli BR408 harbors dam although it lacks dcm and hsdMS genes, which are intrinsic E. coli genes that encode DNA methyltransferases. This strain also has the plasmid pIR408 (Fig. 1b), which encodes methyltransferase subunits of the type I restriction-modification (R–M) systems of 18. Both dam and pIR408 are responsible for protecting plasmids transferred into 18 from digestion by types II and I R–M systems in 18, respectively. The deficiency in dcm and hsdMS allows transferred plasmids to circumvent restriction barriers presented by type IV R–M systems, which digest plasmids having heterologous DNA methylation. Thus, E. coli BR408 produces plasmids that circumvent restriction barriers by two type I, one type II, and three type IV R–M systems in 18. Moreover, E. coli BR408 harbors a conjugation plasmid, pUB307 (Fig. 1c), which has tra genes and thereby mediates conjugative transfer of oriT-containing plasmids. E. coli BR408 successfully transferred pUCG18T to 16 of 18 thermophiles, whereas E. coli BR397, BR398, and DH5α′ provided transformants from 11, 15, and 9 thermophiles, respectively. Although strain 4 was transformed using only E. coli BR397, other transformants were more efficiently generated using E. coli BR408 (Fig. 2). Inverse PCR confirmed that pUCG18T exists as circular forms in thermophilic transformants. These observations suggest that conjugative transfer from E. coli BR408 is effective for plasmid transformation of not only 18 but also various Bacillus-related thermophiles, and that pUCG18T is
Thermophilic transformants harboring pUCG18T were cultured without antibiotics and analyzed for plasmid retention rates. Data are presented as the mean ± SD (n = 3)
also includes ineluctable degradation and contamination of chromosomes during plasmid purification, which causes smear backgrounds of agarose gel electrophoresis. Plasmids from transformants of 1–9, 11, 12, and 17 were able to transform E. coli but those from 10, 13, 14, and 16 were not. For plasmids from all transformants, however, PCR analysis clearly detected the bla gene and the pBST1 and pUC replicons of pUCG18T. Moreover, inverse PCR
13
Extremophiles
a practical plasmid for genetic modification of Bacillusrelated thermophiles. The transformation efficiency of a Bacillus-related thermophile was markedly different among E. coli donors. The difference in transformation efficiency is attributable to R–M systems harbored by Bacillus-related thermophiles, because the donors are different in intracellular DNA methylation and plasmid methylation is known to affect the transformation efficiency of many bacteria in consequence of their R–M systems (Aune and Aachmann 2010; Chen et al. 2008; Groot et al. 2008; Kwak et al. 2002; Mermelstein and Papoutsakis 1993; Purdy et al. 2002; Suzuki 2012; Suzuki et al. 2011; Suzuki and Yoshida 2012; Yasui et al. 2009). Thermophiles that can be transformed using all E. coli strains (i.e., 6 and 8–12) may not harbor any potent R–M systems. In contrast, it is likely that 4 and 15 have potent systems that are difficult to be circumvented by DNA methylation in the E. coli strains examined. Thermophiles that accepted plasmids more efficiently from E. coli BR398 than BR397 (i.e., 5–7, 13, 14, 17, and 18) may harbor type II R–M systems that are circumvented by dam methylation. Thermophiles that accepted plasmids more efficiently from E. coli BR398 than DH5α′ (i.e., 1–3, 6, 7, 11, 14, 17, and 18) probably harbor potent type IV systems to digest plasmids with redundant DNA methylation arising from dcm and/ or hsdMS. Thermophiles that accept plasmids more efficiently from E. coli BR408 than BR398 (i.e., 3, 5, 8, 9, 12, 13, and 16–18) probably have type I R–M systems of 18. Note that these R–M systems of types I, II, and IV are observed in 18 (Suzuki and Yoshida 2012). These observations indicate that the R–M systems of 18 are distributed in Bacillus-related thermophiles and that it is a reason for efficient plasmid transfer from E. coli BR408 to various Bacillus-related thermophiles. This study demonstrated the facile transformation of Bacillus-related thermophiles, including biotechnologically-important strains 6 (Lai and Ingram 1993) and 12 (Kato et al. 2001), using conjugative transfer. The results not only facilitate their rational modification but also suggest that conjugative transfer, particularly using E. coli BR408, is a facile and versatile approach to plasmid introduction into Bacillus-related thermophiles, and potentially other thermophiles, although it may be important for more efficient transformation to optimize DNA methylation in the E. coli donor. The outcome also raise the possibility that this approach is effective for a variety of extremophiles, which are distinguishable from E. coli after conjugation process by culture under extreme conditions. Acknowledgments The authors thank Dr. Hisashi Yagi of Tottori University for useful discussions.
13
References Aune TEV, Aachmann FL (2010) Methodologies to increase the transformation efficiencies and the range of bacteria that can be transformed. Appl Microbiol Biotechnol 85:1301–1313 Bennett PM, Grinsted J, Richmond MH (1977) Transposition of TnA does not generate deletions. Mol Gen Genet 154:205–211 Blanchard K, Robic S, Matsumura I (2014) Transformable facultative thermophile Geobacillus stearothermophilus NUB3621 as a host strain for metabolic engineering. Appl Microbiol Biotechnol 98:6715–6723 Chen Q, Fischer JR, Benoit VM, Dufour NP, Youderian P, Leong JM (2008) In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56. J Bacteriol 190:7885–7891 Cripps RE, Eley K, Leak DJ, Rudd B, Taylor M, Todd M, Boakes S, Martin S, Atkinson T (2009) Metabolic engineering of Geobacillus thermoglucosidasius for high yield ethanol production. Metab Eng 11:398–408 De Rossi E, Brigidi P, Welker NE, Riccardi G, Matteuzzi D (1994) New shuttle vector for cloning in Bacillus stearothermophilus. Res Microbiol 145:579–583 Figurski DH, Helinski DR (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA 76:1648–1652 Groot MN, Nieboer F, Abee T (2008) Enhanced transformation efficiency of recalcitrant Bacillus cereus and Bacillus weihenstephanensis isolates upon in vitro methylation of plasmid DNA. Appl Environ Microbiol 74:7817–7820 Imanaka T, Fujii M, Aramori I, Aiba S (1982) Transformation of Bacillus stearothermophilus with plasmid DNA and characterization of shuttle vector plasmids between Bacillus stearothermophilus and Bacillus subtilis. J Bacteriol 149:824–830 Kananavicˇiu¯te˙ R, Čitavicˇius D (2015) Genetic engineering of Geobacillus spp. J Microbiol Methods 111:31–39 Kato T, Haruki M, Imanaka T, Morikawa M, Kanaya S (2001) Isolation and characterization of long-chain-alkane degrading Bacillus thermoleovorans from deep subterranean petroleum reservoirs. J Biosci Bioeng 91:64–70 Kwak J, Jiang H, Kendrick KE (2002) Transformation using in vivo and in vitro methylation in Streptomyces griseus. FEMS Microbiol Lett 209:243–248 Lai X, Ingram LO (1993) Cloning and sequencing of a cellobiose phosphotransferase system operon from Bacillus stearothermophilus XL-65-6 and functional expression in Escherichia coli. J Bacteriol 175:6441–6450 Liao H, McKenzie T, Hageman R (1986) Isolation of a thermostable enzyme variant by cloning and selection in a thermophile. Proc Natl Acad Sci USA 83:576–580 Lin PP, Rabe KS, Takasumi JL, Kadisch M, Arnold FH, Liao JC (2014) Isobutanol production at elevated temperatures in thermophilic Geobacillus thermoglucosidasius. Metab Eng 24:1–8 Mermelstein LD, Papoutsakis ET (1993) In vivo methylation in Escherichia coli by the Bacillus subtilis φ3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol 59:1077–1081 Nakayama N, Narumi I, Nakamoto S, Kihara H (1992) A new shuttle vector for Bacillus stearothermophilus and Escherichia coli. Biotechnol Lett 14:649–652 Narumi I, Nakayama N, Nakamoto S, Kimura T, Yanagisawa T, Kihara H (1993) Construction of a new shuttle vector pSTE33 and its stabilities in Bacillus stearothermophilus, Bacillus subtilis, and Escherichia coli. Biotechnol Lett 15:815–820
Extremophiles Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Grigoryan AA, Ivanova AE, Lysenko AM, Petrunyaka VV, Osipov GA, Belyaev SS, Ivanov MV (2001) Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G. thermodenitrificans. Int J Syst Evol Microbiol 51:433–446 Priest FG, Goodfellow M, Todd C (1988) A numerical classification of the genus Bacillus. J Gen Microbiol 134:1847–1882 Purdy D, O’Keeffe TAT, Elmore M, Herbert M, McLeod A, BokoriBrown M, Ostrowski A, Minton NP (2002) Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier. Mol Microbiol 46:439–452 Sharp RJ, Bown KJ, Atkinson A (1980) Phenotypic and genotypic characterization of some thermophilic species of Bacillus. J Gen Microbiol 117:201–210 Suzuki H (2012) Host-mimicking strategies in DNA methylation for improved bacterial transformation. In: Dricu A (ed) Methylation–from DNA, RNA and histones to diseases and treatment. InTech, Croatia, pp 219–236 Suzuki H, Yoshida K (2012) Genetic transformation of Geobacillus kaustophilus HTA426 by conjugative transfer of host-mimicking plasmids. J Microbiol Biotechnol 22:1279–1287
Suzuki H, Takahashi S, Osada H, Yoshida K (2011) Improvement of transformation efficiency by strategic circumvention of restriction barriers in Streptomyces griseus. J Microbiol Biotechnol 21:675–678 Takami H, Inoue A, Fuji F, Horikoshi K (1997) Microbial flora in the deepest sea mud of the Mariana Trench. FEMS Microbiol Lett 152:279–285 Takami H, Nishi S, Lu J, Shinamura S, Takaki Y (2004) Genomic characterization of thermophilic Geobacillus species isolated from the deepest sea mud of the Mariana Trench. Extremophiles 8:351–356 Taylor MP, Esteban CD, Leak DJ (2008) Development of a versatile shuttle vector for gene expression in Geobacillus spp. Plasmid 60:45–52 Wiegel J, Ljungdahl LG (1986) The importance of thermophilic bacteria in biotechnology. Crit Rev Biotechnol 3:39–108 Wu LJ, Welker NE (1989) Protoplast transformation of Bacillus stearothermophilus NUB36 by plasmid DNA. J Gen Microbiol 135:1315–1324 Yasui K, Kano Y, Tanaka K, Watanabe K, Shimizu-Kadota M, Yoshikawa H, Suzuki T (2009) Improvement of bacterial transformation efficiency using plasmid artificial modification. Nucleic Acids Res 37:e3 Zeigler DR (2001) The genus Geobacillus. In: Bacillus genetic stock center catalog of strains, vol 3, 7 edn. The Bacillus Genetic Stock Center
13
METHOD PAPER
Conjugative plasmid transfer from Escherichia coli is a versatile approach for genetic transformation of thermophilic Bacillus and Geobacillus species Yurie Tominaga1 · Takashi Ohshiro1 · Hirokazu Suzuki1
Received: 5 November 2015 / Accepted: 14 February 2016 © Springer Japan 2016
Abstract We previously demonstrated efficient transformation of the thermophile Geobacillus kaustophilus HTA426 using conjugative plasmid transfer from Escherichia coli BR408. To evaluate the versatility of this approach to thermophile transformation, this study examined genetic transformation of various thermophilic Bacillus and Geobacillus spp. using conjugative plasmid transfer from E. coli strains. E. coli BR408 successfully transferred the E. coli–Geobacillus shuttle plasmid pUCG18T to 16 of 18 thermophiles with transformation efficiencies between 4.1 × 10−7 and 3.8 × 10−2/recipient. Other E. coli strains that are different from E. coli BR408 in intracellular DNA methylation also generated transformants from 9 to 15 of the 18 thermophiles, including one that E. coli BR408 could not transform, although the transformation efficiencies of these strains were generally lower than those of E. coli BR408. The conjugation was performed by simple incubation of an E. coli donor and a thermophile recipient without optimization of experimental conditions. Moreover, thermophile transformants were distinguished from abundant E. coli donor only by high temperature incubation. These observations suggest that conjugative plasmid transfer, particularly using E. coli BR408, is a facile and versatile approach for plasmid introduction into thermophilic Bacillus and Geobacillus spp., and potentially a variety of other thermophiles.
Communicated by L. Huang. * Hirokazu Suzuki [email protected] 1
Department of Chemistry and Biotechnology, Graduate School of Engineering, Tottori University, Tottori 680‑8552, Japan
Keywords Geobacillus · Bacillus · Thermophiles · Conjugation · Genetic transformation Abbreviations LB Luria–Bertani LK5 LB medium supplemented with kanamycin (5 mg/l) PCR Polymerase chain reaction R–M Restriction–modification
Introduction Rational genetic modification, such as inactivation or forced expression of target genes, has been an important strategy in recent microbial studies. This process is commonly achieved via the introduction of exogenous DNA into microbial cells. Some bacteria exhibit natural competence and may autonomously uptake exogenous DNA; however, most other microbes barely uptake exogenous DNA without forcible artificial procedures. There are several methods for forcible DNA introduction (Aune and Aachmann 2010), including approaches using protoplast and competent cells, which are more permeable to exogenous DNA. Protoplast cells, for example, are widely used in Gram-positive bacteria, such as Streptomyces and Bacillus spp., whereas competent cells have been historically used for Escherichia coli. In addition, it is known that E. coli cells can uptake exogenous DNA following electroshock. This method, termed electroporation, is relatively versatile and is used for forcible DNA introduction into bacteria and eukaryotes. Various microbes can now be genetically modified using these methods. However, it is difficult to establish protocols for the forcible introduction of exogenous DNA into microbes of interest because effective methods and optimal conditions remarkably vary among microbes
13
Extremophiles
and have to be experientially determined. This fact often hinders biological and biotechnological studies of attractive microbes. The genus Bacillus comprises Gram-positive, aerobic or facultatively anaerobic, rod-shaped bacteria. The members of this genus include thermophilic, alkalophilic, psychrophilic, halophilic, and/or pressure resistant strains, which have been identified in a wide variety of environments. Several thermophilic members had been phylogenetically reclassified into the new genus Geobacillus (Nazina et al. 2001), whereas other thermophilic members remained in the genus Bacillus. These Bacillusrelated thermophiles exhibit optimum growth at temperatures ranging from 55 to 65 °C and often have remarkable properties, such as the cellulolytic ability of G. stearothermophilus XL-65-6 (Lai and Ingram 1993), alkanedegrading ability of G. thermoleovorans B23 (Kato et al. 2001), and pentose- and hexose-utilizing abilities of G. thermoglucosidasius (Cripps et al. 2009). Because of these properties, Bacillus-related thermophiles are attractive for use in microbial bioprocesses performed at high temperatures (Wiegel and Ljungdahl 1986). It is noteworthy that G. thermoglucosidasius has been further engineered for high-temperature ethanol and isobutanol production via rational genetic modification (Cripps et al. 2009; Lin et al. 2014; Taylor et al. 2008). This shows that rational genetic modification can expand opportunities for the use of these thermophiles in high-temperature bioprocesses. Although several Bacillus-related thermophiles can be transformed using electroporation or protoplast methods (Blanchard et al. 2014; Cripps et al. 2009; De Rossi et al. 1994; Imanaka et al. 1982; Kananavicˇiu¯te˙ and Čitavicˇius 2015; Liao et al. 1986; Nakayama et al. 1992; Narumi et al. 1993; Taylor et al. 2008; Wu and Welker 1989), we previously demonstrated that conjugative transfer from E. coli is an effective approach for plasmid transformation of G. kaustophilus HTA426 (Suzuki and Yoshida 2012). The conjugation was performed in a mixture that contained an E. coli donor and a G. kaustophilus recipient without minute optimization of experimental conditions. Although conjugation often causes difficulty in distinguishing between recipient transformants and donor cells in cell mixtures because they share a selectable marker, G. kaustophilus was readily distinguishable from E. coli via high temperature incubation. These observations led us to the hypothesis that conjugative plasmid transfer from E. coli may be useful for plasmid introduction into other thermophiles. To evaluate this hypothesis, this study examined the plasmid transformation of various thermophilic Bacillus and Geobacillus spp. using this approach.
13
Materials and methods Bacterial strains, media, plasmids, and primers Table 1 lists the bacterial strains used in this study, along with their strain codes. Primers used are summarized in Table 2. The plasmids pUCG18T, pIR207, and pIR408 were constructed previously (Suzuki and Yoshida 2012). pUB307 (Bennett et al. 1977) was used as a conjugation helper plasmid. The structures of these plasmids are shown in Fig. 1. E. coli DH5α was purchased from Takara Bio (Otsu, Shiga, Japan). E. coli DH5α harboring pUB307 was termed E. coli DH5α′. E. coli strains BR397, BR398, and BR408 were constructed previously (Suzuki and Yoshida 2012). E. coli strains were grown at 37 °C in Luria–Bertani (LB) medium, and ampicillin (50 mg/l), kanamycin (50 mg/l), chloramphenicol (13 mg/l), and tetracycline (7 mg/l) were added when necessary. G. kaustophilus HTA426 was obtained from the RIKEN BioResource Center (Tsukuba, Japan; JCM 12893). Other thermophiles were purchased from the Bacillus Genetic Stock Center (Columbus, OH, USA). Thermophiles were grown at 60 °C in LB medium; however, their transformants harboring pUCG18T were cultured in LK5, which is LB medium supplemented with kanamycin (5 mg/l). Conjugative plasmid transfer from E. coli Escherichia coli strains MK397, MK398, MK408, and DH5α′ were transformed with pUCG18T and used as DNA donors. E. coli donor and thermophile recipients were grown in LB media until the optical density at 600 nm reached 0.3. Cultures of donor (1 ml) and recipient (9 ml) were mixed and filtered through a nitrocellulose membrane (0.22 µm) using reduced pressure. Cells that accumulated on a membrane were incubated on LB plates at 37 °C for 16 h to achieve conjugation and suspended in LB medium. Aliquots of the cell suspensions were subsequently incubated at 60 °C on LB and LK5 plates to determine the total numbers of recipients and transformants, respectively. These numbers were used to calculate the conjugative transfer (transformation) efficiency, which is the ratio of the number of transformant cells (grown on LK5) to the total number of recipient cells (grown on LB). pUCG18T identification Plasmid pUCG18T was isolated from thermophilic transformants using the Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI, USA). The isolation was essentially performed according to the manufacturer’s protocol, except that cells were initially
Extremophiles Table 1 Bacterial strains used in this study Strain
Relevant description
Strain code
E. coli strains BR397
Derivative of strain ER1793; ΔhsdMS, Δdam, Δdcm, pUB307, pIR207
BR398
Derivative of strain ER1793; ΔhsdMS, dam+, Δdcm, pUB307, pIR207
BR408
Derivative of strain ER1793; ΔhsdMS, dam+, Δdcm, pUB307, pIR408 Derivative of strain DH5α; hsdMS+, dam+, dcm+, pUB307, pIR207
DH5α′ Thermophilic Bacillus spp. B. caldolyticus DSM 405
An isolate from hot natural pool (Sharp et al. 1980)
1
B. caldotenax DSM 406
An isolate from superheated pool water (Sharp et al. 1980)
2
B. caldovelox DSM 411
An isolate from superheated pool water (Sharp et al. 1980)
3 4
G. stearothermophilus NRRL B-4419
Type strain of G. stearothermophilus (Zeigler 2001) A sterilization standard (Zeigler 2001)
5
G. stearothermophilus XL-65-6
An isolate from rotting wood in Florida, USA (Lai and Ingram 1993)
6
Geobacillus spp. G. stearothermophilus ATCC 12980
G. stearothermophilus strain 10
An isolate from hot springs in Yellowstone National Park (Zeigler 2001)
7
G. thermoglucosidasius DSM 2542
An isolate from soil in Japan (Zeigler 2001)
8
G. thermoleovorans DSM 5366
An isolate from soil near hot water effluent (Zeigler 2001)
9
G. uzenensis DSM 13551
An isolate from formation water of the Liaohe oil field (Zeigler 2001)
10
G. subterraneus DSM 13552
An isolate from formation water of the Liaohe oil field (Zeigler 2001)
11
G. thermoleovorans B23 Geobacillus sp. NTU 01
An isolate from a deep subterranean oil reservoir at Niigata, Japan (Kato et al. 2001)
12
A strain from the collection of National Taiwan University
13
Geobacillus sp. NTU 02
A strain from the collection of National Taiwan University
14
Geobacillus sp. NTU 03
A strain from the collection of National Taiwan University
15
Geobacillus sp. NTU 04
A strain from the collection of National Taiwan University
16
G. kaustophilus ATCC 8005
An isolate from pasteurized milk (Priest et al. 1988); type strain of G. kaustophilus
17
G. kaustophilus HTA426
An isolate from a deep-sea sediment of the Mariana Trench (Takami et al. 1997, 2004)
18
hsdMS is responsible for N6-methylation of 5′-AACN6GTGC-3′ and 5′-GCACN6GTT-3′ (methylation sites underlined). dam and dcm are responsible for N6-methylation of 5′-GATC-3′ and C6-methylation of 5′-CCWGG-3′, respectively Table 2 Primers used in this study
Primer
Sequence (5′–3′)
Target region
F1
GCCGCATGCTTATTCAACATTTCCGTG
bla gene (0.8 kb)
R1
TAGTTGCCTGACTCCCCGTC
F2 R2 F3 R3 F4
CCCGGATCCTTCGAGCACTACAGGAAC CCGGATCCTGAGCGAAGGTAGTTGCAC GCGGTAATACGGTTATCCACAG ACCCCGTAGAAAAGATCAAAGG ACTTAGAGAAAGTGTATCAAACTG
bla gene (0.8 kb) pBST1 replicon (1.5 kb) pBST1 replicon (1.5 kb) pUC replicon (0.7 kb) pUC replicon (0.7 kb)
R4
TATCCACCTGAATCATAAATCGG
incubated at 37 °C for 15 min with lysozyme (1 mg/ml). The plasmid was analyzed using agarose gel electrophoresis, reintroduction into E. coli DH5α, and polymerase chain reaction (PCR). PCR was performed using Quick Taq HS DyeMix (Toyobo, Osaka, Japan) and primers to amplify bla gene (F1 and R1), the pBST1 replicon (F2 and R2), and the pUC replicon (F3 and R3). Inverse PCR was also performed using primers (F4 and R4) that anneal to the middle position of TK101 gene with
Circular DNA containing TK101 gene Circular DNA containing TK101 gene
a back-to-back orientation and thereby amplify circular pUCG18T. pUCG18T stability assay Thermophilic transformants harboring pUCG18T (102 cells/ml) were cultured at 60 °C for 24 h in liquid LB without antibiotics. The resulting cells in late stationary phase (109 cells/ml) were spread on LB plates to isolate single
13
Extremophiles Fig. 1 Plasmid structures of pUCG18T (a), pIR207 (b), pIR408 ▸ (c), and pUB307 (d). a pUCG18T is a pUC18-derived plasmid that can shuttle between E. coli and Geobacillus spp. (Taylor et al. 2008; Suzuki and Yoshida 2012). The structure is shown with unique restriction enzyme sites. bla, ampicillin resistance gene functional in E. coli; TK101, kanamycin resistance gene functional at high temperatures (Liao et al. 1986); pUC, pUC replicon functional in E. coli; pBST1, pBST1 replicon functional in Geobacillus spp. (Taylor et al. 2008); oriT, conjugative transfer origin from pRK2013 (Figurski and Helinski 1979). b pIR207 is an E. coli plasmid containing a chloramphenicol resistance gene (cat) and the p15A replicon (Suzuki and Yoshida 2012). c pIR408 is a derivative of pIR207, containing the hsdM1S1 and hsdM2S2 genes that encode DNA methyltransferase subunits of type I R–M systems of 18 (Suzuki and Yoshida 2012). d pUB307 is a derivative of the conjugation plasmid RP1 (Bennett et al. 1977). This plasmid contains kanamycin (kan) and tetracycline (tet) resistance genes, the oriV replication origin, the tra genes to serve as a conjugation helper, and the oriT region. The oriV replicon is functional in E. coli and compatible with pUC and p15A replicons. pUB307 cannot replicate in thermophiles even if transferred to their cells
colonies and subsequently 100 colonies were checked for kanamycin resistance to determine plasmid retention rate.
Results Conjugative plasmid transfer from E. coli BR408 Escherichia coli BR408 transferred the E. coli–Geobacillus shuttle plasmid pUCG18T (Fig. 1a) to 16 of 18 thermophiles via conjugation, generating transformants resistant to kanamycin. Transformation efficiencies were markedly different (Fig. 2). Strains 8 and 13 were transformed as efficiently as 18. Strain 9 was more efficiently transformed, but others were less efficiently transformed than 18. Strains 4 and 15 provided no transformants (transformation efficiency, 99 >99 >99 47 ± 11
18
27 ± 13
In a previous study (Suzuki and Yoshida 2012), we constructed E. coli BR408, which was designed for conjugative plasmid transfer to 18. E. coli BR408 harbors dam although it lacks dcm and hsdMS genes, which are intrinsic E. coli genes that encode DNA methyltransferases. This strain also has the plasmid pIR408 (Fig. 1b), which encodes methyltransferase subunits of the type I restriction-modification (R–M) systems of 18. Both dam and pIR408 are responsible for protecting plasmids transferred into 18 from digestion by types II and I R–M systems in 18, respectively. The deficiency in dcm and hsdMS allows transferred plasmids to circumvent restriction barriers presented by type IV R–M systems, which digest plasmids having heterologous DNA methylation. Thus, E. coli BR408 produces plasmids that circumvent restriction barriers by two type I, one type II, and three type IV R–M systems in 18. Moreover, E. coli BR408 harbors a conjugation plasmid, pUB307 (Fig. 1c), which has tra genes and thereby mediates conjugative transfer of oriT-containing plasmids. E. coli BR408 successfully transferred pUCG18T to 16 of 18 thermophiles, whereas E. coli BR397, BR398, and DH5α′ provided transformants from 11, 15, and 9 thermophiles, respectively. Although strain 4 was transformed using only E. coli BR397, other transformants were more efficiently generated using E. coli BR408 (Fig. 2). Inverse PCR confirmed that pUCG18T exists as circular forms in thermophilic transformants. These observations suggest that conjugative transfer from E. coli BR408 is effective for plasmid transformation of not only 18 but also various Bacillus-related thermophiles, and that pUCG18T is
Thermophilic transformants harboring pUCG18T were cultured without antibiotics and analyzed for plasmid retention rates. Data are presented as the mean ± SD (n = 3)
also includes ineluctable degradation and contamination of chromosomes during plasmid purification, which causes smear backgrounds of agarose gel electrophoresis. Plasmids from transformants of 1–9, 11, 12, and 17 were able to transform E. coli but those from 10, 13, 14, and 16 were not. For plasmids from all transformants, however, PCR analysis clearly detected the bla gene and the pBST1 and pUC replicons of pUCG18T. Moreover, inverse PCR
13
Extremophiles
a practical plasmid for genetic modification of Bacillusrelated thermophiles. The transformation efficiency of a Bacillus-related thermophile was markedly different among E. coli donors. The difference in transformation efficiency is attributable to R–M systems harbored by Bacillus-related thermophiles, because the donors are different in intracellular DNA methylation and plasmid methylation is known to affect the transformation efficiency of many bacteria in consequence of their R–M systems (Aune and Aachmann 2010; Chen et al. 2008; Groot et al. 2008; Kwak et al. 2002; Mermelstein and Papoutsakis 1993; Purdy et al. 2002; Suzuki 2012; Suzuki et al. 2011; Suzuki and Yoshida 2012; Yasui et al. 2009). Thermophiles that can be transformed using all E. coli strains (i.e., 6 and 8–12) may not harbor any potent R–M systems. In contrast, it is likely that 4 and 15 have potent systems that are difficult to be circumvented by DNA methylation in the E. coli strains examined. Thermophiles that accepted plasmids more efficiently from E. coli BR398 than BR397 (i.e., 5–7, 13, 14, 17, and 18) may harbor type II R–M systems that are circumvented by dam methylation. Thermophiles that accepted plasmids more efficiently from E. coli BR398 than DH5α′ (i.e., 1–3, 6, 7, 11, 14, 17, and 18) probably harbor potent type IV systems to digest plasmids with redundant DNA methylation arising from dcm and/ or hsdMS. Thermophiles that accept plasmids more efficiently from E. coli BR408 than BR398 (i.e., 3, 5, 8, 9, 12, 13, and 16–18) probably have type I R–M systems of 18. Note that these R–M systems of types I, II, and IV are observed in 18 (Suzuki and Yoshida 2012). These observations indicate that the R–M systems of 18 are distributed in Bacillus-related thermophiles and that it is a reason for efficient plasmid transfer from E. coli BR408 to various Bacillus-related thermophiles. This study demonstrated the facile transformation of Bacillus-related thermophiles, including biotechnologically-important strains 6 (Lai and Ingram 1993) and 12 (Kato et al. 2001), using conjugative transfer. The results not only facilitate their rational modification but also suggest that conjugative transfer, particularly using E. coli BR408, is a facile and versatile approach to plasmid introduction into Bacillus-related thermophiles, and potentially other thermophiles, although it may be important for more efficient transformation to optimize DNA methylation in the E. coli donor. The outcome also raise the possibility that this approach is effective for a variety of extremophiles, which are distinguishable from E. coli after conjugation process by culture under extreme conditions. Acknowledgments The authors thank Dr. Hisashi Yagi of Tottori University for useful discussions.
13
References Aune TEV, Aachmann FL (2010) Methodologies to increase the transformation efficiencies and the range of bacteria that can be transformed. Appl Microbiol Biotechnol 85:1301–1313 Bennett PM, Grinsted J, Richmond MH (1977) Transposition of TnA does not generate deletions. Mol Gen Genet 154:205–211 Blanchard K, Robic S, Matsumura I (2014) Transformable facultative thermophile Geobacillus stearothermophilus NUB3621 as a host strain for metabolic engineering. Appl Microbiol Biotechnol 98:6715–6723 Chen Q, Fischer JR, Benoit VM, Dufour NP, Youderian P, Leong JM (2008) In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56. J Bacteriol 190:7885–7891 Cripps RE, Eley K, Leak DJ, Rudd B, Taylor M, Todd M, Boakes S, Martin S, Atkinson T (2009) Metabolic engineering of Geobacillus thermoglucosidasius for high yield ethanol production. Metab Eng 11:398–408 De Rossi E, Brigidi P, Welker NE, Riccardi G, Matteuzzi D (1994) New shuttle vector for cloning in Bacillus stearothermophilus. Res Microbiol 145:579–583 Figurski DH, Helinski DR (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA 76:1648–1652 Groot MN, Nieboer F, Abee T (2008) Enhanced transformation efficiency of recalcitrant Bacillus cereus and Bacillus weihenstephanensis isolates upon in vitro methylation of plasmid DNA. Appl Environ Microbiol 74:7817–7820 Imanaka T, Fujii M, Aramori I, Aiba S (1982) Transformation of Bacillus stearothermophilus with plasmid DNA and characterization of shuttle vector plasmids between Bacillus stearothermophilus and Bacillus subtilis. J Bacteriol 149:824–830 Kananavicˇiu¯te˙ R, Čitavicˇius D (2015) Genetic engineering of Geobacillus spp. J Microbiol Methods 111:31–39 Kato T, Haruki M, Imanaka T, Morikawa M, Kanaya S (2001) Isolation and characterization of long-chain-alkane degrading Bacillus thermoleovorans from deep subterranean petroleum reservoirs. J Biosci Bioeng 91:64–70 Kwak J, Jiang H, Kendrick KE (2002) Transformation using in vivo and in vitro methylation in Streptomyces griseus. FEMS Microbiol Lett 209:243–248 Lai X, Ingram LO (1993) Cloning and sequencing of a cellobiose phosphotransferase system operon from Bacillus stearothermophilus XL-65-6 and functional expression in Escherichia coli. J Bacteriol 175:6441–6450 Liao H, McKenzie T, Hageman R (1986) Isolation of a thermostable enzyme variant by cloning and selection in a thermophile. Proc Natl Acad Sci USA 83:576–580 Lin PP, Rabe KS, Takasumi JL, Kadisch M, Arnold FH, Liao JC (2014) Isobutanol production at elevated temperatures in thermophilic Geobacillus thermoglucosidasius. Metab Eng 24:1–8 Mermelstein LD, Papoutsakis ET (1993) In vivo methylation in Escherichia coli by the Bacillus subtilis φ3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol 59:1077–1081 Nakayama N, Narumi I, Nakamoto S, Kihara H (1992) A new shuttle vector for Bacillus stearothermophilus and Escherichia coli. Biotechnol Lett 14:649–652 Narumi I, Nakayama N, Nakamoto S, Kimura T, Yanagisawa T, Kihara H (1993) Construction of a new shuttle vector pSTE33 and its stabilities in Bacillus stearothermophilus, Bacillus subtilis, and Escherichia coli. Biotechnol Lett 15:815–820
Extremophiles Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Grigoryan AA, Ivanova AE, Lysenko AM, Petrunyaka VV, Osipov GA, Belyaev SS, Ivanov MV (2001) Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G. thermodenitrificans. Int J Syst Evol Microbiol 51:433–446 Priest FG, Goodfellow M, Todd C (1988) A numerical classification of the genus Bacillus. J Gen Microbiol 134:1847–1882 Purdy D, O’Keeffe TAT, Elmore M, Herbert M, McLeod A, BokoriBrown M, Ostrowski A, Minton NP (2002) Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier. Mol Microbiol 46:439–452 Sharp RJ, Bown KJ, Atkinson A (1980) Phenotypic and genotypic characterization of some thermophilic species of Bacillus. J Gen Microbiol 117:201–210 Suzuki H (2012) Host-mimicking strategies in DNA methylation for improved bacterial transformation. In: Dricu A (ed) Methylation–from DNA, RNA and histones to diseases and treatment. InTech, Croatia, pp 219–236 Suzuki H, Yoshida K (2012) Genetic transformation of Geobacillus kaustophilus HTA426 by conjugative transfer of host-mimicking plasmids. J Microbiol Biotechnol 22:1279–1287
Suzuki H, Takahashi S, Osada H, Yoshida K (2011) Improvement of transformation efficiency by strategic circumvention of restriction barriers in Streptomyces griseus. J Microbiol Biotechnol 21:675–678 Takami H, Inoue A, Fuji F, Horikoshi K (1997) Microbial flora in the deepest sea mud of the Mariana Trench. FEMS Microbiol Lett 152:279–285 Takami H, Nishi S, Lu J, Shinamura S, Takaki Y (2004) Genomic characterization of thermophilic Geobacillus species isolated from the deepest sea mud of the Mariana Trench. Extremophiles 8:351–356 Taylor MP, Esteban CD, Leak DJ (2008) Development of a versatile shuttle vector for gene expression in Geobacillus spp. Plasmid 60:45–52 Wiegel J, Ljungdahl LG (1986) The importance of thermophilic bacteria in biotechnology. Crit Rev Biotechnol 3:39–108 Wu LJ, Welker NE (1989) Protoplast transformation of Bacillus stearothermophilus NUB36 by plasmid DNA. J Gen Microbiol 135:1315–1324 Yasui K, Kano Y, Tanaka K, Watanabe K, Shimizu-Kadota M, Yoshikawa H, Suzuki T (2009) Improvement of bacterial transformation efficiency using plasmid artificial modification. Nucleic Acids Res 37:e3 Zeigler DR (2001) The genus Geobacillus. In: Bacillus genetic stock center catalog of strains, vol 3, 7 edn. The Bacillus Genetic Stock Center
13
