Mutation Research, 262 (1991) 63-71 Elsevier

63

MUTLET 0448

Constant denaturant gel electrophoresis, a modification of denaturing gradient gel electrophoresis, in mutation detection Eivind Hovig, Birgitte Smith-Sorensen, Anton Bragger and Anne-Lise Borresen Department of Genetics, Institute of Cancer Research, The Norwegian Radium Hospital, 0310 Oslo 3 (Norway) (Received 17 August 1990) (Accepted 17 September 1990)

Keywords." Denaturing gradient gel electrophoresis; Constant denaturant gel electrophoresis; Mutation detection; Hypoxanthine phosphoribosyltransferase

Summary Denaturing gradient gel electrophoresis (DGGE) is increasingly being utilized in mutational detection, both in characterization of variations in genomic DNA and in the generation of mutational spectra after in vitro and in vivo mutagenesis. The basis for this electrophoretic separation technique is strand dissociation of DNA fragments in discrete, sequence-dependent melting domains followed by an abrupt decrease in mobility. We have modified the DGGE by using constant denaturant gels corresponding to the specific melting domains of certain DNA fragments. This leads to increased resolution of mutants as fragments differing in as little as 1 base pair migrate with a consistently different mobility through the whole gel allowing separations of several centimeters. By using a set of constant denaturant gels it is also possible to obtain a better approximation of the location of the different mutations as each denaturant concentration will correspond to specific melting domains. We have used this technique to separate 6 out of 7 exon-3 hypoxanthine phosphoribosyltransferase (HPRT) mutants while using conventional DGGE we were only able to separate 3.

Detection and localization of single-base differences in specific regions of genomic DNA are of great importance in the analysis of mutations Correspondence: Dr. A.-L. Borresen, Department of Genetics, Institute of Cancer Research, The Norwegian Radium Hospital, 0310 Oslo 3 (Norway). Abbreviations: CDGE, constant denaturant gel electrophoresis; DGGE, denaturing gradient gel electrophoresis; HPRT, hypoxanthine phosphoribosyltransferase; PCR, polymerase chain reaction.

associated with human diseases. Both inherited and acquired mutations are of importance, particularly in the analysis of malignant diseases. The separation techniques based on denaturing gradient gel electrophoresis (DGGE) first described by Fisher and Lerman (1983) have been increasingly utilized both in the detection of normal genetic variation in genomic DNA (Borresen et al., 1988), inherited mutation causing disease (Borresen et al., 1990; Traystman et al., 1990; Kogan and Gitschier, 1990) and in the analysis of mutational spectra after

0165-7992/91/$ 03.50 © 1991 Elsevier Science Publishers B.V. (Biomedical Division)

64

mutagenesis (Thilly, 1985). The separation principle of DGGE is based on the melting behavior of the DNA double helix of a given fragment. This melting behavior is sequence-dependent, and the melting of a domain in the DNA fragment will be detected as a reduction in the mobility of the DNA fragment as it moves through the gel as a consequence of partial strand separation. The thermodynamics of the transition of DNA double strand to DNA single strand has been described by Lerman et al. (1984), and computer programs for the analysis of denaturation are now available. Separation using DGGE is possible for homoduplex DNA fragments as well as for heteroduplex DNA fragments with minor sequence variations. Using standard broad-range DGGE, only the lowest melting domain can generally be assessed with some degree of certainty. This is due to the fact that migration through the gel will be greatly reduced after melting of the first domain. The opening of additional domains will result in even slower migration. This imposes a detection limit on the D G G E system. Using a set of gels with different gradient ranges can partly eliminate this problem. However, the fragment will continue to migrate with a mobility similar to what can be observed in a perpendicular DGGE. The movement into an increasingly higher denaturing concentration will continually give rise to new configurations of the molecule which will have different mobilities. Separation first obtained in one part of the gradient of the gel may be lost if the electrophoresis is extended. One way of overcoming this problem is to utilize the fact that along any vertical line in a perpendicular gradient gel, the molecules will behave identically. Running a perpendicular gel will indicate at what denaturant concentrations one can expect separation of fragments with different mutations. It occurred to us that running constant denaturant gel electrophoresis (CDGE) at these concentrations will give gels with an optimum concentration of denaturant for separation of fragments at all melting domains where resolution can be observed in a perpendicular DGGE. Domains not detectable in perpendicular gels may also

possibly be detected if prolonged running times are applied. We have utilized the CDGE technique to study exon-3 hypoxanthine phosphoribosyltransferase (HPRT) mutations as a model system. Materials and methods

Source of DNA The H P R T mutants used in this study were prepared from UV-treated V79 and VH1 Chinese hamster cells (VH1 is a UV-sensitive derivative of V79), and ENU-treated mouse lymphoma GRSL cells. All the mutants were selected as 6-thioguanine-resistant clones, cDNAs were prepared from isolated mRNA. These cDNAs were amplified by polymerase chain reaction (PCR) and cloned into M13 and sequenced (Vrieling et al., 1989). All the DNA samples used in this study as well as sequence information were generously provided by Dr. Harry Vrieling, Department of Radiation Genetics and Chemical Mutagenesis, Leiden. The 7 mutants used here all contained mutations between the 2 regions of exon 3 of the H P R T gene which were used for primer annealing when fragments were amplified by PCR. The sequence of the analyzed fragment and the mutants are given in Fig. 1. A V79 hamster mutant and a GRSL mouse mutant containing mutations only in the regions for primer annealing were used as wild-type control fragments since they contained the wild-type sequences after PCR amplification. Polymerase chain reaction The PCR reactions were performed using a selfconstructed waterbath-based robot with conditions similar to those described by Saiki et al. (1988). Purified single-stranded M13 DNA (100 ng) was diluted in TE (10 mM Tris-HC1, 1 mM EDTA, pH 7.4) mixed with 2.75 mM MgClz, 60 mM KC1, 15 mM Tris-HCl, pH 8.8, 400 #M dNTP, 7.5 pmole primers and 2.5 units AmpliTaq (Perkin Elmer, Cetus Corporation, Emeryville, CA) in a total volume of 100 tA. The sequence of the 3' primer used was 5 ' - T A G C T C T T C A G T C T G A T A A A - 3 ' . The 5' primer used was attached to a GC-clamp (Sheffield et al., 1989) and had the

65

IGC-clamp[ 5"-primer

1

3

5

AA

G

A

II / I ITGTGGCCCTCTGTGTGCTGAAGGGGGGCTATAAATI'CTIq'GCTGACCTGCTGGATT' II I I I1,®I 65 aa

2

SA

4

6 7 A

I

-ACATTAAAGCACTGAATAGATAGTGAAATAGATCCATTCCCATGACTGTAGAI] T-primer I I 150

Fig. 1. Sequence of the amplified exon-3 H P R T fragment (189 bp) with the mutants and sequence variations indicated. Mutants numbered 1-6 are hamster fragments and mutant 7 is a mouse fragment. Base numbers correspond to the numbers in the theoretical melting profiles in Fig. 2.

following sequence: 5 ' - C G C C C G C C G C G C C CCGCGCCCGTCCCGCCGCCCCCGCCCGGA G A T G G G A G G C C A T C A C A T - 3 ' . Primers were synthesized by Genetic Designs, Inc., Houston, TX. Only the 60-mer primer was ordered purified. The reaction mixture was boiled for 7 min prior to the PCR process. The PCR cycle times were: 1 min at 94°C, 1 min at 45°C and 1 min at 72°C for 35 cycles. The PCR products were analyzed for purity after running 7.5°7o P A G E followed by staining with EtBr.

tean II Slab Electrophoresis Cell (Bio-Rad Laboratories). The modification allowed the glass plates surrounding the gels to be in direct contact with the buffer on both sides. Extensive circulation of the buffer was provided during the runs. For perpendicular gels the running time was 2 h and for parallel gels 3-8 h. After electrophoresis the gels were stained for a few minutes in EtBr (2 mg EtBr/1 TAE) and photographed using a UV transilluminator.

Constant denaturant gel electrophoresis Denaturing gradient gel electrophoresis Denaturing gradient gels (16 x 2 0 x 0.1 cm) contained 7.5°7o acrylamide in TAE (0.04 M Tris-acetate, 0.001 M EDTA, pH 8.0), DATD (N,N'-diallyltartardiamide) as crosslinker (0.55 g/100 ml), and varying denaturant concentrations consisting of urea and formamide (100°70 denaturant corresponds to 7 M urea and 40°7o formamide). The gels were polymerized with ammonium persulfate (5 mg/gel) and T E M E D (N,N,N',N'-tetramethylethylenediamine) (10 #1/ gel). The gradient gels were cast with a gravitational gradient mixer. All reagents used were of electrophoretic grade. Gels were run submerged in TAE buffer at 59.5°C at 150 V constant, using a modified Pro-

The gels used in CDGE contained the same chemicals as for DGGE, but with a uniform denaturant concentration through the gel. Running conditions were as for DGGE, but with different running times. Gels with 18°7o denaturant were run for 3 h, gels with 29°7o denaturant for 6 h and gels with 40% denaturant for 8 h. Results

The wild-type hamster and 6 exon-3 H P R T hamster mutants as well as the wild-type mouse and an exon-3 H P R T mouse mutant were amplified using the PCR technique. Analysis of the PCR products by P A G E showed pure PCR products with the expected size. In addition some single-stranded

66

IOC

5' primer with G C - c l a m ~ 95

!

9~

i

8~

~i

Domain3

Domain2

~

~

i

60

80

......

~_~-

Hamster [ .........

t Domam 1 !

i

i

i

l

200

22(1

e~

E

7~ 7C~

•

m

c

r

65 6C 0

20

40

100

120 140 Base n u m b e r

160

180

240

Fig. 2. Theoretical melting profiles at temperatures giving a 50% chance of the base pair being in either double- or single-stranded state of mouse and hamster exon-3 H P R T . The 2 profiles shown are those of wild-type mouse and wild-type hamster sequences. The 3 base differences between mouse and hamster are shown (hamster--*mouse).

a) I 0%

Denaturant

~

b) 2

1

2

c) I

2

50% ¢-)

N" O i,...I

o ,7;

+ +

18%

45%

29% I cm

Fig. 3. Perpendicular gel of 0-50°70 denaturant of wild-type m o u s e and wild-type hamster exon-3 H P R T fragments. 50 #1 of the P C R products of the 2 fragments were loaded all along the top of the gel. The gel was run at 59.5°C at 150 V constant for 2 hours, giving approximately 11 Wh.

Fig. 4. CDGE of wild-type mouse and hamster exon-3 H P R T fragments run in (a) 18% CDGE, (b) 29% CDGE and (c) 45% C D G E . 5 t~l PCR products were loaded in each lane. Lane 1 contained the wild-type mouse fragment and lane 2 the wild-type hamster fragment. The gels were run at 59.5°C at 150 V constant. The running time was 2 h for the gel in (a), giving approximately 6.7 W h , 6 h for the gel in (b) (21 Wh), and 8 h for the gel in (c) (32 Wh).

67

products could occasionally be seen. The amplified target sequence, indicating the nature of the mutants, is shown in Fig. 1. Using the computer p r o g r a m of Lerman et al. (1984) we have predicted the melting behavior of the amplified fragments. The steep parts in the profiles represent openings of new melting domains. Fig. 2 shows the wild-type mouse and hamster melting profiles. As can be seen the 2 theoretical profiles differ in 3 melting domains, as a consequence of the 3 base differences in the 2 species. One base change resides in the lowest melting domain, 1 in the middle domain, and 1 in the highest melting domain. The profile differences are most clearly observed for the 2 lowest domains. The results of a hamster and a mouse exon-3 H P R T P C R product run on a perpendicular gel are shown in Fig. 3. Two melting domains can be observed, 1 at 18% and 1 at 29% denaturant. Taking these denaturant concentrations as those giving optimal resolution for the 2 discernible domains, we cast 2 gels, one with a denaturant concentration

of 18°-/0 and the other with a denaturant concentration o f 29°7o. Running the same 2 products on these gels, using essentially the same running conditions as for the perpendicular gel, we were able to reverse the relative positions of the mouse and hamster fragments in these 2 gels as can be seen in Fig. 4 (a,b). To compare the separation ability between C D G E and D G G E we performed a time-course study using the wild-type mouse and hamster fragments. As can be seen from Fig. 5a, the use of C D G E and extended running times leads to an increased resolution of several centimeters without loss of sharpness of the bands. By using D G G E a m a x i m u m separation of 0.5 cm was achieved at approximately 18% denaturant as can be seen from Fig. 5b. This separation, however, disappeared when increasing running times were used (Fig. 5b, lanes 5, 6, 7 and 8). P C R products from the 6 hamster and the 1 mouse exon-3 H P R T mutants were subjected to 2

a) 1

2

3

4

5

b) 6

7

8

8

7

6

5

4

3

2

1

O

+

Fig. 5. Time course of wild-type mouse and hamster exon-3 HPRT fragments in a 18% CDGE (a) and in a 0-400/o denaturant gel (DGGE) (b). 5 ~1 PCR products were loaded in each lane. Lanes 1, 3, 5 and 7 contain the wild-type mouse fragment. Lanes 2, 4, 6 and 8 contain the wilde-type hamster fragment. The gels were run at 59.5°C at 150 V constant. (a) The samples in lanes 1 and 2 were loaded at the beginning of the run, in lanes 3 and 4 the loading was 0.5 h later, in lanes 5 and 6 1 h later and in lanes 7 and 8 1.5 h later. The total running time for the gel was 2 h (8.7 Wh). (b) The samples in lanes 1 and 2 were loaded at the beginning of the run, in lanes 3 and 4 the loading was 2 h later, in lanes 5 and 6 4 h later and in lanes 7 and 8 6 h later. The total running time for the gel was 6.5 h

(30 Wh).

at 150 V constant.

b)

described The running

123456789

time was

5; 7, mutant

6; 8, hamster

wild type; 9, mutant

3. The

I .5 h (6.7 Wh) for the gel in (a), 6 h (21 Wh) for the gel in (b) and

4; 6, mutant

I run in (a) 18% CDGE, (b) 29% CDGE and (c) 45% CDGE. Lanes: I,

2: 5, mutant

in Fig.

123456789

1; 4, mutant

mutants

7; 3, mutant

8 h (32 Wh) for the gel in (c).

gels were run at 59.5”C

mouse wild type; 2, mutant

Fig. 6. The panel of presequenced

123456789

a)

+

69 CDGEs. The denaturant concentrations in the gels were 18% and 29% respectively. The results are shown in Fig. 6 (a,b). The mouse mutant separated f r o m the wild type in the 18% denaturant gel, as can be seen in Fig. 6a, but the hamster mutants did not separate from the wild type in this gel. In Fig. 6b the results of the gel at 29% denaturant are shown. No separation could be observed between the 2 mouse fragments, but 5 of the 6 hamster mutants separated from the hamster wild type (lanes 3-7).

Discussion Although D G G E has found wide application in mutation detection, a major concern in applying the method is the fact that the system as such is based on the discontinuous phenomenon of strand dissociation. A molecule in a parallel gradient gel will migrate with a constant mobility until it reaches the position in the gel where the denaturant concentration is sufficient for the double-stranded molecule to undergo partial melting. At this position the molecule will start to migrate more slowly as a consequence of the double-stranded D N A becoming partly single-stranded. However, the fragment does noT, necessarily stop altogether, as can be seen in a perpendicular denaturing gradient gel (Fig. 3). In a parallel D G G E , the residual movement will cause the molecule to migrate into a higher denaturant concentration, leading to new conformational changes and further changes in the migration rate of the molecule. If a D N A fragment has 2 independent mutations, both affecting melting behavior in the same domain, they may in some instances balance each other. In such circumstances, comparisons will be difficult. There m a y be problems of reproducibility of gels because of the need for absolute run time control as can be seen in Fig. 5b. Another problem involves the reproducibility of casting gradient gels. In an effort to eliminate these problems, we used gels with an even concentration of denaturant. These concentrations were chosen to coincide with the steep parts of the profile observed in the perpendicular gel, as indicated in Fig. 3. The

reason for this is that at these concentrations the resolution will be optimal for a separation detection of fragments differing in melting domain. As expected from the theoretical mouse and hamster melting profiles of exon-3 H P R T and the perpendicular gradient gel of these fragments, we were able to reverse the relative positions of the mouse and hamster fragments in the 2 gels. The relative position indicates the nature of the 2 base changes in the 2 lower domains. The reason for the reversed position is the nature of the base changes, GC base pairs being more stable than AT. The results shown in Fig. 4(a,b) are therefore in agreement with the fact that the hamster sequence contains a CG base pair difference compared to a TA base pair in the mouse sequence in the lowest melting domain, and an A T base pair difference compared to the GC base pair in the mouse sequence in the next melting domain (see Fig. 2). In a broad-range D G G E , these simultaneous base mutations will result in decreased resolution if the 2 fragments were run through a gradient interval covering both melting domains. The effect of increased running times can be seen in Fig. 5. With conventional D G G E , part of the resolution obtained at intermediate running times will be lost if running times are extended. Using C D G E the configuration of the molecules is constant through the gel and the resolution is merely a function of the distance travelled. There is a constant difference in the mobility of 2 fragments which differ in as little as 1 base pair, in a gel with an appropriate denaturant concentration. The effect is similar to what can be seen in a perpendicular gel, but with the possibility of loading multiple samples in separate lanes for screening purposes. An attempt to detect differences between the 2 species in the highest melting domain, shown in Fig. 4c, failed. This is probably due to a small difference in the melting properties of the 2 fragments. Large resolution can also be revealed by formation of heteroduplexes between wild-type and mutant sequences (Myers et al., 1985) prior to the D G G E . Formation of heteroduplexes is, however, more time-consuming and some manipulation of the P C R products has to be performed. In addi-

70 tion, since h e t e r o d u p l e x molecules p r o d u c e d f r o m a h e t e r o z y g o t e i n d i v i d u a l with 1 p r o b e c a n n o t be d i s t i n g u i s h e d f r o m those p r e p a r e d f r o m one o f the h o m o z y g o t e s , this t e c h n i q u e is not suitable for the screening o f h u m a n p o p u l a t i o n s . To test the extent o f r e s o l u t i o n by using C D G E , we e x a m i n e d a panel o f p r e s e q u e n c e d exon-3 H P R T m u t a n t s . The theoretical melting profiles indicate that these a n a l y z e d f r a g m e n t s melt in discrete d o m a i n s . The a n a l y z e d sequences c o n t a i n m u t a t i o n s in all 3 melting d o m a i n s . O n l y the m o u s e m u t a n t c o n t a i n s a m u t a t i o n in the lowest d o m a i n a n d it is the o n l y one which was expected to s e p a r a t e when r u n n i n g an 18°7o d e n a t u r a n t gel. The s e p a r a t i o n o f the m o u s e m u t a n t is t h e r e f o r e in a g r e e m e n t with the theoretical p r e d i c t i o n . The m u t a t i o n T A - ~ A T in that p o s i t i o n gave a theoretical melting profile showing the A T m u t a n t to be m o r e stable t h a n the wild type. H o w e v e r , the opposite was o b s e r v e d in o u r gel, and the r e a s o n for this is unclear. O f the h a m s t e r m u t a n t s , m u t a n t 5, c o n t a i n i n g a C G - - , A T m u t a t i o n , a n d m u t a n t 6, containing a CG~TA and a TA~AT mutation, s e p a r a t e d a c c o r d i n g to the theoretical p r e d i c t i o n . Mutants 1 and 2 both contain 2 GC--,AT mutations. A l t h o u g h these m u t a t i o n s are located in the b e g i n n i n g o f the t h i r d d o m a i n , they also seem to affect the second d o m a i n . The s e p a r a t i o n o f these m u t a n t s was also in a c c o r d a n c e with the theoretical prediction. Mutant 4 contains a CG~GC and A T - , T A m u t a t i o n in a d d i t i o n to an insertion o f a T A base pair. These m u t a t i o n s are all located between the second a n d the t h i r d d o m a i n s and will t h e r e f o r e affect b o t h . F r o m the theoretical calculations this m u t a n t was expected to m o v e m o r e slowly t h a n the wild type, but the o p p o s i t e was o b s e r v e d for an u n k n o w n reason. M u t a n t 3 c o n t a i n s an insertion o f a G C base pair l o c a t e d between the seco n d a n d the third d o m a i n . N o s e p a r a t i o n o f this m u t a n t could be o b s e r v e d r u n n i n g a 29% gel (see Fig. 6b), a l t h o u g h the theoretical melting profiles have some small differences. In a d d i t i o n , there was no d e t e c t a b l e s e p a r a t i o n between the 2 m o u s e f r a g m e n t s . This was expected as these f r a g m e n t s o n l y have d i f f e r e n t melting b e h a v i o r s in the lowest melting d o m a i n . As expected f r o m Fig. 4c, no

s e p a r a t i o n in the m u t a n t panel c o u l d be o b s e r v e d at 4 5 % d e n a t u r a n t c o n c e n t r a t i o n (Fig. 6c). Using the c o n c e n t r a t i o n s selected on the basis o f the wild-type f r a g m e n t s in C D G E , we were able to s e p a r a t e all except 1 o f the m u t a n t s , while a stand a r d b r o a d - r a n g e D G G E did not p e r m i t s e p a r a t i o n o f m o r e t h a n 3 o f the m u t a n t s ( m u t a n t s 5, 6 a n d 7, u n p u b l i s h e d results), thus d e m o n s t r a t i n g the sensitivity o f the C D G E m e t h o d .

Acknowledgements W e t h a n k Sigrid L y s t a d for excellent technical assistance, L. L e r m a n for access to the D N A melting p r o g r a m s , a n d A r n e D e g g e r d a l a n d S t e p h e n M c G i l l for helpful discussion a n d advice. This w o r k is part o f a N o r d i c p r o j e c t (P 88134) f u n d e d by the N o r d i c F u n d for T e c h n o l o g y a n d Ind u s t r i a l D e v e l o p m e n t . This w o r k was also supp o r t e d by grants f r o m the R o y a l N o r w e g i a n C o u n cil for Scientific a n d I n d u s t r i a l Research.

References Borresen, A.-L., E. Hovig and A. Brogger (1988) Detection of base mutations in genomic DNA using denaturing gradient gel electrophoresis (DGGE) followed by transfer and hybridization with gene-specific probes, Mutation Res., 202, 77-83. Borresen, A.-L., E. Hovig, B. Smith-S~rrensen, H. Vrieling, J. Apold and A. Brogger (1990) Screening for base mutations in the PAH and HPRT loci using the polymerase chain reaction (PCR) in combination with denaturing gradient gel electrophoresis, in: M. Mendelsohn (Ed.), Fifth International Conference on Environmental Mutagens, Alan R. Liss, New York. Fischer, S.G., and L.S. Lerman (1983) DNA fragments differing by single base-pair substitutions are separated in denaturing gradient gels: correspondence with melting theory, Proc. Natl. Acad. Sci. (U.S.A.), 80, 1579-1583. Kogan, S., and J. Gitschier (1990) Mutations and a polymorphism in the factor VIII gene discovered by denaturing gradient gel electrophoresis, Proc. Natl. Acad. Sci. (U.S.A.), 87, 2092-2096. Lerman, L.S., S.G. Fischer, 1. Hurley, K. Silverstein and N. Lumelsky (1984) Sequence-determined DNA separations, Annu. Rev. Biophys. Bioeng., 13, 399-423. Myers, R.M., N. Lumelsky, L.S. Lerman and T. Maniatis (1985) Detection of single base substitutions in total genomic DNA, Nature (London), 313, 495-498.

71

Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis and H.A. Erlich (1988) Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase, Science, 239, 487-491. Sheffield, V.C., D.R. Cox, L.S. kerman and R.M. Myers (1989) Attachment of a 40-base-pair G+C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes, Proc. Natl. Acad. Sci. (U.S.A.), 86, 232-236. Thilly, W.G. (1985) Potential use of gradient denaturing gel electrophoresis in obtaining mutation sperm from human cells, in: E. Huberman and S.H. Barr (Eds.), Carcinogenesis, Vol. 10, Raven Press, New York, pp. 511-522.

Traystman, M.D., M. Higuchi, C.K. Kasper, S.E. Antonarakis and H.H. Kazazian Jr. (1990) Use of denaturing gradient gel electrophoresis to detect point mutations in the Factor VII gene, Genomics, 6, 293-301. Vrieling, H., M.L. van Rooijen, M.Z. Zdzienicka, J.W.I.M. Simons, P.H.M. Lohman and A.A. van Zeeland (1989) Development of the PCR method for sequencing single base pair changes in the hprt gene of man, mouse and hamster: different mutation spectra in normal and repair-deficient UVsensitive V79 Chinese hamster cells, Mutation Res., 216, 82-89 (Abstract). Communicated by F.H. Sobels