Immunol Res DOI 10.1007/s12026-015-8623-7

Construction and characterization of VL–VH tail-parallel genetically engineered antibodies against staphylococcal enterotoxins Xianzhi He • Lei Zhang • Pengchong Liu Li Liu • Hui Deng • Jinhai Huang

•

Ó Springer Science+Business Media New York 2015

Abstract Staphylococcal enterotoxins (SEs) produced by Staphylococcus aureus have increasingly given rise to human health and food safety. Genetically engineered small molecular antibody is a useful tool in immuno-detection and treatment for clinical illness caused by SEs. In this study, we constructed the VL–VH tail-parallel genetically engineered antibody against SEs by using the repertoire of rearranged germ-line immunoglobulin variable region genes. Total RNA were extracted from six hybridoma cell lines that stably express anti-SEs antibodies. The variable region genes of light chain (VL) and heavy chain (VH) were cloned by reverse transcription PCR, and their classical murine antibody structure and functional V(D)J gene rearrangement were analyzed. To construct the eukaryotic VH–VL tail-parallel co-expression vectors based on the ‘‘50 -VH-ivs-IRES-VL-30 ’’ mode, the ivsIRES fragment and VL genes were spliced by two-step overlap extension PCR, and then, the recombined gene fragment and VH genes were inserted into the pcDNA3.1(?) expression vector sequentially. And then the constructed eukaryotic expression clones termed as p2C2HILO and p5C12HILO were transfected into baby hamster kidney 21 cell line,

Xianzhi He and Lei Zhang have contributed equally to this work.

Electronic supplementary material The online version of this article (doi:10.1007/s12026-015-8623-7) contains supplementary material, which is available to authorized users. X. He  L. Zhang  P. Liu  L. Liu  H. Deng  J. Huang (&) School of Life Science, Tianjin University, No. 92, Weijin Road, Nankai District, Tianjin 300072, China e-mail: [email protected] X. He School of Chemical engineering & Technology, Tianjin University, No. 92, Weijin Road, Nankai District, Tianjin 300072, China

respectively. Two clonal cell lines stably expressing VL–VH tail-parallel antibodies against SEs were obtained, and the antibodies that expressed intracytoplasma were evaluated by enzyme-linked immunosorbent assay, immunofluorescence assay, and flow cytometry. SEs can stimulate the expression of some chemokines and chemokine receptors in porcine IPECJ2 cells; mRNA transcription level of four chemokines and chemokine receptors can be blocked by the recombinant SE antibody prepared in this study. Our results showed that it is possible to get functional VL–VH tail-parallel genetically engineered antibodies in same vector using eukaryotic expression system. Keywords Staphylococcal enterotoxins  Germ-line genes, variable region  Genetically engineered recombinant antibodies  Disulfide stable  Self-assembly

Introduction Staphylococcus enterotoxins (SEs) are common pathogenic factors associated with serious community and hospital diseases, including food poisoning, and toxic shock syndrome. These diseases have been considered as a major problem of Public Health for a long time [33], and according to the Centers for Disease Control (CDC), the food poisoning is triggered by Staphylococcus aureus (S. aureus) pollution foods. Food poisoning caused by SEs is the second most commonly food-borne disease [30], and less than 1 lg SEs can bring out relevant symptoms. As for staphylococcal enterotoxin A (SEA) in liquid food, 0.5 ng/mL is sufficient [17, 34]. Accompanying with the symptoms of abdominal cramps, nausea, vomiting, and diarrhea, staphylococcal food-borne illness usually leads to inflammatory changes throughout the gastrointestinal tract with severe lesions, especially in the jejunum and ileum [34]. The

123

Immunol Res

economic loss due to these diseases is also substantial, reaching $35 billion annually in the USA [8]. However, the physiopathological mechanism of complex clinical symptoms caused by SEs is not fully understood in details yet [41]. To date, 21 different serotypes of SEs, including SEA-SEE (SEA-E), toxic shock syndrome toxin (TSST-1, SEF), and staphylococcal enterotoxin G-V (SEG-V), have already been identified [6, 47]. In fact, more and more enterotoxin genotypes are detected from different staphylococcus isolates, but an effective verification method is still missing [34]. The emetic activity and the superantigens are two remarkable phenotypes of SEs. A series of independent studies suggested that all the SEs, except for staphylococcal enterotoxin-like toxins SEl-S and SEl-T [43], have been described as superantigens because they can bind as whole molecules directly to MHC class II [18, 38] and TCR b-chain [22], outside the normal antigen-binding interface that governs peptide MHC recognition [13]. It is a nonspecific manner that usually leads to an overproduction of various pro-inflammatory cytokines including IFN-c, TNF-a, IL-1, IL-6, and IL-8 [1, 2, 9], which may cause superantigen-mediated acute inflammation, shock, and even death in severe cases [5, 29, 37]. For both human being and livestock, SE is one of the most deleterious superantigen enterotoxins. With a compact tertiary structure, SE proteins are highly resistant to heat, pH conditions, and even gastrointestinal proteases including pepsin, trypsin, rennin, and papain [25, 36]. Immuno-detection system based on the availability of specific and high-affinity antibody is still the primary method to detect enterotoxins. As a kind of superantigen, SEs usually result in generation of low-titer polyclonal and monoclonal antibodies. The development of a suitable assay system is strongly anticipated [35]. In consideration of the restrictive traditional antibody preparation technology, genetically engineered antibodies seem to be a better choice for SE detection and clinical treatment. Single-chain variable fragment (scFv) is a fusion protein made of variable regions on immunoglobulin heavy (VH) and light (VL) chains. A short linker peptide (about 10–20 amino acids), usually (Gly4Ser)3, covalently links either the N- or C-terminal of the desired protein, which is described in Fig. 1a [3]. However, this traditional method always leads to a reversed amino acid sequence of VH or VL. The problem is further aggravated if the fusion protein is expressed in a prokaryotic system without correct folding or modification, which may decrease the affinity. Hence, we focus on a new construction model that the C-terminals of both VH and VL are connected in parallel via Internal Ribosome Entry Site (IRES) noncoding sequence to imitate the native conformation of antibodies (Fig. 1b). In this paper, we successfully constructed two genetically engineered antibodies against SEs using our new construction model, which indicates a potential in clinical application.

123

Fig. 1 Technical route of the construction of genetically engineered recombinant antibodies. a Traditional construction mode: a fusion protein of VH and VL of immunoglobulin that is connected with a short linker peptide of 10 to about 20 amino acids, usually (Gly4Ser)3, covalently links either the N- or C-terminal of the desired protein sequence, which always leads to the damage of affinity to antigens. b New construction mode put forward in this paper: The C-terminals of both VH and VL were connected in parallel via internal ribosome entry site (IRES) noncoding sequence to imitate the native conformation of antibodies for maximum

Materials and methods Recombinant antigens for immunization and identification In order to prepare immunogens, three kinds of mature peptides of staphylococcal enterotoxins (SEs)-coding genes were inserted into prokaryotic expression vector pGEM6p-1 with glutathione S-transferase (GST) gene. The purified SEs-GST fusion protein (termed SEA-GST, SEK-GST, SEO-GST) was produced in E. coli BL21 host cells and purified by Bulk GST Purification Module kit (GE Healthcare Co.). In addition, to prepare the antigens for subsequent screening and identification of monoclonal antibodies, six different recombinant SEs proteins (SEAHis, SEG-His, SEK-His, SEO-His, SEQ-His, and SEU-His) containing polyhistidine (69 His) tag in N-terminal had been cloned into bacterial expression vector pET28a and then transformed into E. coli BL21 (DE3) cells, followed by purification with NI-NTA purification column (Invitrogen Co., USA) as described previously [21]. The natural SEA enterotoxin was purchased from Institute of

Immunol Res

Biotechnology, Academy of Military Medical Sciences in China. Generation of hybridoma cells Fifteen 6-week-old BABL/c mice were divided into three groups immunized with purified SEA-GST, SEK-GST, SEO-GST proteins, respectively. Mice were maintained within SPF facility in individually ventilated cages at the Tianjin Laboratory Animals Center. This study was carried out in strict accordance with the guidelines in the Guide for the Care and Use of Laboratory Animals in China. Animal experiments were performed in compliance with the regulations by Tianjin University Institutional Animal Care and Use Committee and were approved by the veterinarian authorities of Tianjin Animal Inspection Institute. Immunizations were conducted every 2 or 3 weeks according to circumstances, four times in total. Mice were immunized im with 100 lg antigen mixed with Freund’s adjuvant. Booster immunization was given with Freund’s incomplete adjuvant. At 15 days after the second dose, 50 lg antigen diluted with 100 mM Hepes buffer (pH 7.5) was injected via tail intravenous inoculation to accelerate the immunization process [24]. Ten days later, caudal vein blood samples were collected for the indirect ELISA test. Mice of high titer in serum were given a booster of 50 lg antigen 3 days prior to fusion. Then, mice were killed with carbon dioxide. Spleen cells were collected and fused with myeloma cell line SP2/0, following the procedures described elsewhere [16]. Culture supernatants from the clones that produced each antigen-specific antibody were screened by ELISA against 2 lg/mL natural SEA, SEA-His, SEG-His, SEK-His, SEO-His, SEQ-His, and SEU-His. Positive clones were subcloned for three times for antibody secretion by ELISA and then identified by Western blot analysis. Cloning of monoclonal antibody variable region genes Total RNA were isolated from six hybridoma cell lines(2C2, 4A2, 7G5, 1F10, 5C12, and 2G7), using TRIzol reagent according to the manufacturer’s instructions. Firststrand cDNA was obtained from 5 lg of total RNA by reverse transcription kit (TranScript First-Strand cDNA Synthesis SuperMix Kit, Transgen Co.) and oligo (dT)18 primers. Based on the c chain and j chain of murine antibodies, two pairs of amplification primers for VH and VL genes, namely VLF1/VLR1 and VHF2/VHR1 (Table 1), were designed from the highly conservative regions FR1 and FR4 by CODEHOP System online (http://blocks.fhcrc. org/codehop.html) [4, 7, 15]. The amplification parameters were as follows: 4 min at 94 °C for initial denaturation, 30 cycles of denaturation (94 °C for 30 s), annealing (59 °C for 30 s), and extension (72 °C for 30 s), and 6 min at

72 °C for a final extension. PCR products were resolved by a 1.5 % agarose gel electrophoresis and purified using a gel extraction kit (Biotech Co., Beijing). Twelve VH and VL gene fragments were separately cloned into the pUC T-simple vector (CW Biotech Co.), following the manufacturer’s instructions. All nucleotide sequences of identified clones were compared with NCBI BLAST analysis (http://blast.ncbi.nlm.nih.Gov/Blast.cgi). Meanwhile, characteristic amino acid and the homology of VL and VH germ-line genes were analyzed by IMGT/VQUEST system (http://www.imgt.org/IMGT_vquest/share/ textes/index.html). Construction of eukaryotic co-expression vectors Two pairs of expression primers, VHexF-2C2/VHexR-2C2 and VHexF-5C12/VHexR-5C12, were designed to amplify the coded sequence of 2C2-VH and 5C12-VH, the Kozak sequence ‘‘GCCACCATG’’ was added at the 50 -terminal of two forward primers, and an additional oligonucleotides ‘‘ACA’’-coding cysteine was added at the 50 -end of each reverse primer. The PCR program was the same as described above. Both 2C2-VH and 5C12-VH genes were digested with NheI and HindIII restriction enzymes and ligated into an NheI- and HindIII-linearized eukaryotic expression vector pcDNA3.1(?) (Invitrogen Co.). Following further determination with PCR and double restriction enzyme digestion, two transitional plasmids, pcDNA3.1-2C2VH and pcDNA-5C12VH, were extracted and purified. VLexF and VLexR, the primers modified with Cys amino acid were used to amplify the VL chains. IRESOF and IRESOR were designed for the amplification of ivsIRES sequence from the expression vector pIRESneo (Invitrogen Co.). PCR-amplified VL gene fragment and ivsIRES sequence were joined together by two-step overlap extension PCR. The optimum PCR conditions were described as follows: The reaction system includes equimolar concentrations of purified VL and ivs-IRES gene fragments without primers with predenaturation at 94 °C for 4 min, 5 cycles of denaturation at 94 °C for 30 s, annealing at 53 °C for 1 min, extension at 72 °C for 30 s, and, following the final cycle, an additional extension at 72 °C for 8 min. And then the additional VlexF and IRESOR primers were added into the reaction system with 30 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 1 min, and extension at 72 °C for 30 s. After resolved and purified, the recombinant fragments were digested with BamHI and XbaI restriction enzymes and then ligated into the transitional vectors pcDNA3.12C2VH or pcDNA3.1-5C12VH. The two eukaryotic co-expression vectors, named p2C2HILO and p5C12HILO, which linked VH and VL fragment on ‘‘50 -VH-ivs-IRES-VL’’

123

Immunol Res Table 1 DNA sequence of primers used in this study Primer sequence (50 –30 )

Primer number Degenerate primers for amplication of VL genes VLF1

ACGTTTKATTTCCAGCTTGG

VLR1

GAYATTGTGYTRACACAGTC

Degenerate primers for amplication of VH genes VHF2

CCTGCGTGCTGTCCCARGTNCANYT

VHR1

CGGTCACGGAGGTGCCYTGNCCCCA

Expression primer for amplication of VL genes from 2C2 hybridoma cells VLexF

CTTGCCACAACCCCGGGaCCACCATGGC

VLexR

CGCTCTAGAbCTAACAGTTTGATTTCC

Expression primer for amplication of VH genes from 2C2 and 5C12 hybridoma cells VHexF-2C2 VHexR-2C2

GCTAGCcCACCATGGAGCAGTCTGGA CAAGCTTdCTAACAGGAGGTGCCTTGTC

VHexF-5C12

CTAGCTAGCcCACCATGAAGGAGTCAGGA

VHexR-5C12

CCCAAGCTTdCTAACACAGTAAGCAAAC

Primer for amplication of ivs-IRES sequence IRESOF

CGCGGATCCeAATTCGCTGTCTG

IRESOR

GCCATGGTGGCCCGGGaGTTGTGGCAAG

Glading lines indicate cysteine amino acid modified a

Bold bases indicate SamI site

b

Bold bases indicate XbaI site

c

Bold bases indicate NheI site

d

Bold bases indicate HindIII site

e

Bold bases indicate BamHI site

model and used the same promoter, were successfully constructed, respectively. Cell transfection and positive cell clones screening The recombinant plasmids p2C2HILO and p5C12HILO and the blank plasmid pcDNA3.1(?) were all extracted using Endotoxin-Free Plasmid Mini Kit (CWBIO Co.) and were quantified by spectrophotometer (NanoDrop 1000 Spectrophotometer, Thermo Fisher Scientific Inc.). The cells were maintained in the DMEM medium supplemented with 10 % fetal calf serum and L-glutamine (2 mM). The transient transfections were carried out in a 6-well plate. The cells (5 9 105 cells per well) were transiently transfected with 4 lL of Lipofectamine 2000 reagent (Invitrogen), 0.5 lg construct plasmid DNA, or 0.5 lg pcDNA3.1(?)-null plasmid DNA (Invitrogen) by following vendor’s instruction. Three BHK21 cell lines, respectively, transfected with p2C2HILO, p5C12HILO, or pcDNA3.1(?) plasmids were cultured for 48 h before being screened in the DMEM medium supplemented with 10 % fetal calf serum, L-glutamine (2 mM), and 600 lg/ mL Geneticin (G418, Amerasco Co.) for 14 days. The survival cells transfected with p2C2HILO, p5C12HILO, or

123

pcDNA3.1(?) plasmids were further subcloned in DMEM medium supplemented with 300 lg/mL G418 for three times by limiting dilution method [32]. And then three cell clones that expressed the recombinant antibodies stably were obtained in the DMEM medium supplemented with 300 lg/mL G418 for further evaluation. Gene integration test by PCR Total cellular RNAs were extracted from three cell lines by using the TRIzol LS (Invitrogen, USA) according to the manufacturer’s instructions. cDNA was synthesized by TranScript First-Strand cDNA Synthesis SuperMix Kit and oligo (dT)18 primers. VHexF-2C2/VHexR-2C2 and VHexF-5C12/VHexR-5C12 were used for amplification of VH gene fragments, respectively, and VLexF/VLexR primers were used for amplification of VL gene fragments. Based on IRESOF/IRESOR, ivs-IRES sequence was identified by PCR as well. Constitutively expressing test by ELISA According to modified Wilson method [32], SEA-His was labeled with horseradish peroxidase (HRP) for further

Immunol Res

determination. Both the supernatant and lysed cells of these three cell lines were collected every 3–5 days. Cells were immediately lysed by radio immunoprecipitation assay (RIPA, 50 mmol/L pH7.4 Tris, 150 mmol/L NaCl, 1 % Triton X-100, 1 % sodium deoxycholate, 0.1 % SDS, 1 mmol/L EDTA, 0.02 % protease inhibitors) on ice for 60 min. The lysed supernatants of three cells were diluted to a final concentration of 106 cell/mL with 0.2 mol/L pH9.5 carbonate buffer solution and then, respectively, coated on plates in 100 lL/well overnight at 4 °C. With the coating solution removed, the plates were then washed three times with pH7.4 PBS supplemented with 0.05 % (v/v) Tween-20 for 3 min each time and incubated with 100 lL 4 % FCS at room temperature for 1 h. 100 lL per well of SEA-His-HRP conjugate at 1:200 dilution was added to the ELISA plates. After incubation at 37 °C for 30 min and three times of additional washes, 100 lL tetramethylbenzidine (TMB) horseradish peroxidase color solution was added to the plates and kept in dark place for 10 min, and then, the reaction was stopped with 50 lL 2 mol/L H2SO4, and the absorbance was measured at 450 nm by microplate reader (Biorad Co.). The antibody secreted in culture supernatant of three cell lines was evaluated as same as the cell lysate except for a dilution at 1:10 with coating buffer. Identification and characterization of recombinant antibodies Indirect immunofluorescence assay The three BHK21 cell lines transfected with p2C2HILO, p5C12HILO, and pcDNA3.1(?) were treated respectively as follows: 106 cells were inoculated on coverslips put in 24 slot plates and were incubated at 37 °C with 5 % CO2 for 24 h, and then, the cell coverslips were fixed with cold methanol and treated with 0.1 % Triton X-100 PBS solution for 10 min. The treated cells were then incubated with 10 lg/mL natural SEA, SEA-His, SEG-His, SEK-His, SEO-His, SEQ-His, or SEU-His for 45 min, respectively. After incubation separately with chicken anti-SEs polyclonal antibodies, the cells were washed three times before functioning for 45 min with 5 lg/mL FITC-IB7 monoclonal antibody against chicken immunoglobulin conjugate containing 0.01 % Evans blue, and then, the stained cell coverslips were imaged using inverted fluorescent microscopy (Nikon TE2000) [20]. Flow cytometry assay 2 9 106 transfected BHK21 cells were collected and washed in cold PBS containing 2 % bovine serum albumin (BSA) and then washed in PBS buffer and fixed in 0.1 %

formaldehyde and 0.1 % Triton X-100 at 4 °C for 1 h. After three washes with PBS containing 0.1 % bovine serum albumin (BSA) and 0.01 % sodium azide (FACS buffer), the permeabilizing cells were incubated separately with 5 lg/mL natural SEA, recombinant SEA-His, SEGHis, SEK-His, SEO-His, SEQ-His, and SEU-His for intracellular staining 45 min at 4 °C. After being washed in FACS buffer, cells were incubated with chicken anti-SEs polyclonal antibodies in 5 lg/mL. Then, they were washed in FACS buffer and incubated with 5 lg/mL FITC-conjugated IB7 monoclonal antibody against chicken immunoglobulin prior to analysis in a FACS Calibur flow cytometer (Becton–Dickinson, San Jose, CA, USA). [12, 28]. The cell line was transformed with the empty plasmid pcDNA3.1(?) in FACS assay as negative control, too.

Suppression assays Staphylococcal superantigens are highly pro-inflammatory to human vaginal epithelial cells, and they can stimulate immortalized human adipocytes to produce chemokines [27, 46]. Porcine multi-systemic inflammation caused by staphylococcal enterotoxins is a universal problem in swine breeding industry. To determine whether porcine IPEC-J2 cells expressing chemokine ligands or chemokine receptors stimulated by superantigen are functionally inhibited by genetically engineered recombinant VH–VL antibodies, we tested the relative genetic expression of some chemokine using the comparative Ct method. 107 p2C2HILO-, p5C12HILO-, and pcDNA3.1(?)-transfected BHK21 cells were harvested in 200 lL RIPA lysis buffer containing 1 % proteinase inhibitor on ice. Lysates were centrifuged, and the supernatants were collected and named as the recombinant VH–VL engineered antibody (r5C12 and r2C2). 100 lg recombinant antibody or monoclonal antibody of 2C2 and 5C12(labeled as m2C2 and m5C12) was, respectively, mixed with 100 ng SEA protein in 500 lL cell culture medium for 2 h at 4 °C, and then, 100 lL of the reaction solution was inoculated to porcine IPEC-J2 cells cultured in 6 slot plates. Assays were performed in triplicate in 6-well plates in a final volume of 2 mL medium for 2 d at 37 °C in 5 % CO2 incubator. The SEA and PBS were inoculated as positive control and blank control, respectively. All the RNAs were extracted, and cDNA was obtained as previously described. Power SYBR green qRTPCR assay was adopted for mRNA quantification with help of StepOnePlus Real-Time PCR System (Applied Biosystems). The primers used are summarized in Table 2. With comparative Ct method, relative gene expression was calculated as 2DDCt where DCt = Ct (gene of interest) - Ct (normalizer = GAPDH) and the DDCt = Ct (sample) - Ct (calibrator = mean DCt of normals).

123

Immunol Res Table 2 Primers of cytokines for real-time PCR Gene

GenBank ID

MCP-1

X79416

Primer (50 –30 )

Annealing Tm (°C)

Product size (bp)

F: CTCCTGTGCCTGCTGCT

55

282

51.7

112

52.7

124

63.4

186

57.3

196

R: TTCAAGGCTTCGGAGTTT CXCL8

NM_213867

CCR2

AB119271

F: GCAGTTCTGGCAAGAGTAAG R: GGGGTCCACTCTCAATCAC F: AACATTCTGGTTACGCCTGT R: ATTCCCGAGTAGCAGACG

CCR10

DQ157761

F: AGGGCTGGAGTCTGGGAAGTGTCA R: ACACGACGACGGAGACCAAGTGTGC

GAPDH

AF017079

F: ATGACAACTTCGGCATCGT R: CCAGTGAGCTTCCCGTTGAG

Statistic analysis

PCR amplification on variable region genes of antibody

Comparative experiments were carried out for statistical significance together with unpaired Student’s t tests done with Prism software (version 5.0; GraphPad). P \ 0.05 was considered significant.

All the RNAs were extracted from six hybridoma cells and were then reverse-transcripted into cDNA, respectively. To retrieve those variable regions of rearranged immunoglobulin genes from cDNA, degenerate primer pairs that are complementary to the antibody framework segment 1 (FR1) and framework segment 4 (FR4) of immunoglobulin chain were taken to PCR amplification. All the VH and VL chain genes formed clear bands at about 350 bp (Fig. S1).

Results Generation of hybridoma cells

Sequence analysis of VH and VL genes The hybridomas were prepared with strict screening process as described above. Following the fusion of the isolated splenic lymphocytes with SP2/0, more than ten positive clones were obtained. Six monoclonal cell lines, including three hybridoma cells against SEA named 4A2, 7G5, and 2G7, one hybridoma cell against SEK named 2C2, and two hybridoma cells (1F10, 5C12) against SEO, were further proliferated for recombinant antibody construction.

Fig. 2 Deduced amino acid sequences of six different VL and VH of SEs-binding antibody fragments and analysis of CDRs, FRs, and characteristic amino acids. a Multiple amino acids sequence alignment of VL genes; b multiple amino acids sequence alignment of VH genes. Conserved residues are represented by dots, cysteine regarded as characteristic amino acids are represented by a dash. All FRs and CDRs were determined by IMGT/VQUEST system

123

Twelve VH and VL coding sequences were inserted individually into the pUC T-simple vector and were then sequenced. The sequence alignment indicated that all of the retrieved VH and VL genes were highly homological with murine immunoglobulin genes (Fig. 2). The VL and VH sequences of hybridoma cell 2C2, SG7, 4A2, 7G5, 1F10, and 5C12 have been submitted to GenBank under accession numbers

Immunol Res

JX219401–JX219406 and JX287392–JX287397, respectively. All of the six VL genes were 333 bp, representing a functional V–J arrangement and belonging to the v-kappa21E subgroup (Table 3). V-gene of the six different VL genes exhibited homology to allele IGKV3-12*01 with a median homological percentage of 97.94–98.28 %. J-gene of the six different VL genes exhibited homology to allele IGKJ2*01 with a median homological percentage of 97.22 %. Multiple sequence alignment of VH genes revealed a low homology between 2C2-VH and others. Except for 2C2-VH that contained nucleotide of 342 bp, the VH region of other clones was 345 bp, representing a functional V–D–J arrangement and belonging to the V(H)-II subgroup (Table 4). D-gene of 2C2-VH chain genes could not match with any gene or allele reported in the database of International Immunogenetics Information System (IMGT), which might be a brand new type of D-gene of Ig. All the VH genes were functional V–D–J arrangement mode and belonged to the V(H)-II subgroup. Consistent with the classical structure of murine immunoglobulin germ-line genes, the amino acid sequences of VL and VH variable region fragments of all monoclonal antibodies contained three CDRs separated by four frame regions. The VL chain genes were identical with the coding amino acid sequences of six monoclonal hybridoma cells prepared by three different staphylococcal enterotoxins. The VL and VH sequences of antibody 2G7, 7G5, 1F10, 4A2, and 5C12 are surprisingly similar with each other with difference of only one amino acid found between VH-4A2 clone and the other clones mentioned above. However, by analyzing the distribution pattern of

specific amino acid, only one cysteine residue existed in the variable region VL fragments of all cell clones and three in VH domain (except for 2C2-VH), which was different from the classical structure of antibody variable region with ‘‘two cysteines’’ to generate the important disulfide peptide loop. Identification of eukaryotic co-expression vectors With the similarity of amino acid sequence among six VL chains and the low homology between 2C2-VH and others, the VH and VL variable region genes of hybridoma cells 2C2 and 5C12 were selected to generate the VH–VL tailparallel expression vectors. As previous results showed that the amount of proteins expressed in the downstream of IRES was only 30-50 % of those expressed in the upstream, insertion of an ivs sequence helped to balance those transcription levels. So the eukaryotic VH–VL tailparallel co-expression vectors based on the ‘‘50 -VH-ivsIRES-VL-30 ’’ mode were constructed and further confirmed by PCR and enzyme digestion (Fig. S2). The final recombinant plasmid was named p2C2HILO (Fig. 3) and p5C12HILO (Fig. S3). Positive clones selection and expression analysis 600 ng/mL G418 was supplemented to growth medium to screen the resistant BHK21 cell clones transfected with p2C2HILO, p5C12HILO, and pcDNA3.1(?) plasmids. Three recombinant clone cell lines including p2C2HILO,

Table 3 Homology analysis of VL germ-line genes Name of VL genes

V-gene

J-gene

Gene and allele

Identity %

Gene and allele

Identity %

2G7-VL

IGKV3-12*01

98.28

IGKJ2*01

97.22

4A2-VL

IGKV3-12*01

98.28

IGKJ2*01

97.22

7G5-VL

IGKV3-12*01

98.28

IGKJ2*01

97.22

1F10-VL

IGKV3-12*01

98.28

IGKJ2*01

97.22

5C12-VL

IGKV3-12*01

97.94

IGKJ2*01

97.22

2C2-VL

IGKV3-12*01

98.28

IGKJ2*01

97.22

Table 4 Homology analysis of VH germ-line genes Name of VH genes

V-gene Gene and allele

J-gene Identity %

D-gene

Gene and allele

Identity %

Gene and allele

Identity %

2C2-VH

IGHV1S33*01

99.25

IGHJ4*01

86.36

–

–

2G7-VH 4A2-VH

IGHV2-6*02 IGHV2-6*02

100.00 99.03

IGHJ2*02 IGHJ2*02

70.00 67.50

IGHD5-5*01 IGHD5-5*01

89.93 89.93

1F10-VH

IGHV2-6*02

98.95

IGHJ2*02

67.50

IGHD5-5*01

89.93

7G5-VH

IGHV2-6*02

98.99

IGHJ2*02

70.00

IGHD5-5*01

89.93

5C12-VH

IGHV2-6*02

98.95

IGHJ2*02

67.50

IGHD5-5*01

89.93

123

Immunol Res Fig. 3 Plasmid profile of recombinant eukaryotic expression p2C2HILO vector

A

0.400

0.000

3

6

9

12

15

20

25

30

35

40

45

35

40

45

Time of transfection (d)

Identification and characterization of recombinant antibodies

123

0.600

0.200

B

0.250

0.200

OD at 450nm

To analyze the affinity of 2C2 and 5C12 recombinant antibodies with different SEs, 10 lg/mL natural SEA, recombinant SEA-His, SEG-His, SEK-His, SEO-His, SEQHis, and SEU-His proteins were incubated with the antibody-expression cells, followed with detection by indirect immunofluorescence assay (IFA) and flow cytometry assay (FCM). No apparent green fluorescence was detected in the cells transfected with vector pcDNA3.1(?), but specific intracytoplasmic bright green fluorescence was observed evenly in plasma of the cells transfected with plasmids p2C2HILO and p5C12HILO (Fig. 5). Hence, 2C2 and 5C12 recombinant antibodies expressed in cytoplasm could bind different SEs specifically, including the natural SEA. The FCM results further confirmed the expression of micro-molecular antibody in those cells (Fig. 6). 2C2 recombinant antibodies had the similar ability of binding to SEs, but lower binding capacity was observed in recombinant 5C12 cells with SEK-His protein.

1.000

0.800

OD at 450nm

p5C12HILO, and pcDNA3.1 (?) were obtained by limiting dilution and proliferation culture method. The VH genes, ivs-IRES sequence, and VL genes could be measured from all the RNAs extracted from three cell lines by RT-PCR (Fig. S4), and the results showed that p2C2HILO, p5C12HILO, and pcDNA3.1(?) plasmids were integrated stably into BHK21 cells. Recombinant antibodies in cell lysate and supernatant were further analyzed by direct ELISA. The level of protein expression in cells transfected with p2CHILO or p5C12HILO was much higher and continually increased within 12 days in contrast with those transfected with pcDNA3.1(?) (Fig. 4a). Meanwhile, lower and no secreted antibody was detected in cell supernatant of three cells transfected with p2CHILO, p5C12HILO, or pcDNA3.1(?) plasmids (Fig. 4b).

0.150

0.100

0.050

0.000

3

6

9

12

15

20

25

30

Time of transfection (d)

Fig. 4 Direct ELISA showing binding of anti-SEs recombinant antibodies with SEA-His antigen. a Antibodies expression in the cell lysate transfected with plasmid p2C2HILO or p5C12HILO was much more higher than that of the pcDNA3.1(?)-transfected cell lysate and a continually increased expression product after 12 days posttransfection (PT) and tended to be constant later. b No conspicuous difference in the low secretion level among three cells. Both the recombinant antibodies were matrix protein expression and were able to bind SEA-His specifically

Immunol Res

Fig. 5 Detection of recombinant antibodies expressed in BHK21 cells by IFA. a–g The cells transfected with p2C2HILO(A) and p5C12HILO(B) individually bond to 10 lg/mL natural SEA, SEAHis, SEG-His, SEK-His, SEO-His, SEQ-His, and SEU-His. h The cells transfected with pcDNA3.1(?) bond to 10 lg/mL natural SEA

were present as the negative control. It was observed that 2C2 and 5C12 recombinant antibodies were able to specifically bind to the different serotype of SEs, especially the nature SEA, and located in cytoplasm

Suppression effects of r5C12 antibody to SEA stimulation

MCP-1) and two chemokine receptors (CCR2 and CCR10) produced by endothelial cells were measured to understand the roles of recombinant VH–VL micro-molecules antibody in blocking the SEA stimulation function of SEA to IPEC-J2 cells. mRNA CXCL8, CCR2, and CCR10 were significantly up-regulated after 48-h SEA treatment (Fig. 7). Compared with direct SEA stimulation, mRNA transcription level of

The chemokine ligand and receptors are highly expressed molecules in some local or chronic inflammatory diseases. Chemokines can be produced and released by many different types of cells [46]. Here, two chemokines (CXCL8 and

123

Immunol Res

Fig. 6 Detection recombinant antibodies expressed in BHK21 cells by FCM. 2C2 recombinant antibodies had the similar ability of binding to different serotype of SEs, including natural SEA and other SEs-His recombinant antigens, and so did the 5C12 recombinant antibodies display a lower affinity of SEK-His

CXCL8, MCP-1, CCR2, and CCR10 in SEA neutralization groups of r5C12 and m5C12 were significantly reduced (P \ 0.05), and no significant different was founded between SEA and SEA ? BHK21 groups.

Discussion In this study, we had cloned the VH and VL genes from six hybridoma cells secreting monoclonal antibody against SEs. [39]. The variable fragments VH and VL were cloned by reverse transcription of the cDNA as the template, and the conserved region sequences FR1 and FR4 as primers, whose sequence was altered by degenerate primers, are considered as a minor influence [11, 19, 26]. As a result, it is more effectual to reduce the scope of PCR amplification and avoid the cloning of unrelated genes, which guarantees the integrity of antigen-binding site without mutation. By means of homological analysis and multiple sequence alignment, the variable region genes from six different hybridomas against SEs were consistent with the classical structure of murine monoclonal antibodies. The

123

Fig. 7 Chemokine ligands or chemokine receptors expression of IPEC-J2 cells after superantigen SEA stimulation. a Comparison of CXCL8, MCP-1, CCR2, and CCR10 expression induction in porcine IPEC-J2 cells after r5C12, m5C12 and BHK21 cell lysate treatment for 48 h; b comparison of CXCL8, MCP-1, CCR2, and CCR10 expression induction in porcine IPEC-J2 cells after r2C2, m2C2 and BHK21 cell lysate treatment for 48 h. (*P \ 0.05 by unpaired twotailed t test). Data in all panels are representative of at least three independent experiments (mean ± SEM)

deduced amino acid sequences of six VL and five VH regions were of highly similar among all other five clones except for 2C2 (less than 38 % of amino acid similarity in VH sequence). On the basis of our data, it show that the VH plays a major role for specific binding to SEs, while the VL could, in some case, increase the final sensitivity of the assay in an order of magnitude. This was also described by Karsunke et al. [23]. Additionally, it might be a special effect for SEs, such a superantigen, to induce the rearrangement of VH chain genes. These six hybridoma cell lines 2G7, SG7, 4A2 (screened with SEA), 5C12, 1F10 (prepared with SEO), and 2C2 (prepared with SEK) were prepared by different staphylococcal enterotoxins, but the monoclonal antibody secreted by those cells could recognize all six recombinant SEs (SEK, SEG, SEO, SEA, SEU, and SEQ). The results showed that all those SEs containing at least two conserved cross-epitopes could react with them. The epitope recognized by 2C2, SG7, 4A2, 7G5, and 1F10 antibodies might be a primary epitope exposed on the

Immunol Res

surface of different SEs, and 2C2 monoclonal antibody could recognize another identical epitope. In general, CDR3 usually consists of 2–19 amino acids and has a great possibility of change (or mutation) to sequence and structure during the ontogenesis of B cells. The previous research indicated that complicated components on the surface of antigen may lead to longer CDR3 constitution to provide enough space for binding antigen specifically [11, 14], and all CDR3 region retrieved consisted of 10–11 amino acids, leading to the fact that SEs taken as a superantigen possess a large number of complex epitopes on the surface. To date, it is common to express genetically engineered recombinant antibodies in prokaryotic expression system. Without correct folding, it always leads to non-functional and unstable proteins, and undersized molecules [11, 40, 44]. Here, we changed the traditional approach of vector construction and the protein expression in mammalian cells. By inserting cysteine amino acids into the C-terminal of VH and VL polypeptides individually, co-expression vectors p2C2HILO and p5C12HILO with single promoter were constructed, and then, they were transfected into BHK21 cells. Following the cellular self-assembly, VH and VL peptides were connected with each other via the disulfide linkage formed by cysteine to generate a functional mature peptide. Compared with previous construction mode, the configuration of this micro-molecular antibody became more similar to natural antibody. In eukaryotic cells, cap-dependent scanning and internal ribosome entry are two major mechanisms of initiation of translation. A complex RNA structural element required by the latter mechanism is internal ribosome entry segment (IRES), which is located in the 50 untranslated region. With the presence of transacting factors, ribosomes can be recruited to an IRES site that is considerably distant from the cap structure [42, 45]. IRES has been widely used to co-express heterologous gene products under the control of a single promoter. However, the expression efficiency of IRES downstream genes is significantly lower than that of the upstream genes [31]. In order to improve the expression level of downstream genes, a tandem-linked synthetic intron IVS was inserted in front of IRES to stabilize mRNA [10]. Considering that VH genes may be more important in antigen-binding function than VL genes, we put the VH genes upstream of ivs-IRES-VL sequence to get the higher affinity of recombinant antibody. Both 2C2 and 5C12, the VL–VH tail-parallel genetically engineered antibodies, expressed as matrix proteins were detected in BHK21 cells via ELISA, IFA, and FCM techniques. And they can recognize different SEs well, including recombinant SEA-His, SEG-His, SEK-His, SEOHis, SEQ-His, SEU-His, and especially natural SEA. Both the antibodies had similar highly binding capacity to

different SEs in FCM except for 5C12 with SEK-His, possibly because the epitope on SEK were significantly different from other SEs. The genetically engineered VL– VH tail-parallel antibodies against SEs provided a new routine to study the structure and property of superantigens. mRNA transcription of genes CXCL8, MCP-1, CCR2, and CCR10 in IPEC-J2 cells can be activated by SEA stimulation. In inflammatory diseases, increased CXCL8, MCP-1, CCR2, and CCR10 are also frequently associated with eosinophil infiltration in affected tissues [46]. Neutralized SEA with recombinant antibody or monoclonal antibody inhibited higher transcription of genes CXCL8, MCP-1, CCR2, and CCR10. The results of this study showed a good biological activity and effectiveness of the genetically engineered VL–VH tail-parallel antibodies against staphylococcal enterotoxins. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31272540) and Tianjin science and technology support key project plan (13ZCZDNC08800) in China. Conflict of interest The author (s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

References 1. al-Daccak R, Mehindate K, Poubelle PE, Mourad W. Signalling via MHC class II molecules selectively induces IL-1 beta over IL-1 receptor antagonist gene expression. Biochem Biophys Res Commun. 1994;201:855–60. 2. Assenmacher M, Lohning M, Scheffold A, Manz RA, Schmitz J, Radbruch A. Sequential production of IL-2, IFN-gamma and IL10 by individual staphylococcal enterotoxin B-activated T helper lymphocytes. Eur J Immunol. 1998;28:1534–43. 3. Babaei A, Zarkesh-Esfahani SH, Gharagozloo M. Production of a recombinant anti-human CD4 single-chain variable-fragment antibody using phage display technology and its expression in Escherichia coli. J Microbiol Biotechnol. 2011;21:529–35. 4. Baines JE, McGovern RM, Persing D, Gostout BS. Consensusdegenerate hybrid oligonucleotide primers (CODEHOP) for the detection of novel papillomaviruses and their application to esophageal and tonsillar carcinomas. J Virol Methods. 2005;123:81–7. 5. Baker MD, Papageorgiou AC, Titball RW, Miller J, White S, Lingard B, Lee JJ, Cavanagh D, Kehoe MA, Robinson JH, Acharya KR. Structural and functional role of threonine 112 in a superantigen Staphylococcus aureus enterotoxin B. J Biol Chem. 2002;277:2756–62. 6. Betley MJ, Borst DW, Regassa LB. Staphylococcal enterotoxins, toxic shock syndrome toxin and streptococcal pyrogenic exotoxins: a comparative study of their molecular biology. Chem Immunol. 1992;55:1–35. 7. Boyce R, Chilana P, Rose TM. iCODEHOP: a new interactive program for designing COnsensus-DEgenerate Hybrid Oligonucleotide Primers from multiply aligned protein sequences. Nucleic Acids Res. 2009;37:W222–8. 8. Buzby JC, Roberts T. Economic costs and trade impacts of microbial foodborne illness. World Health Statistics Q (Rapport trimestriel de statistiques sanitaires mondiales). 1997;50:57–66. 9. Carlsson R, Sjogren HO. Kinetics of IL-2 and interferon-gamma production, expression of IL-2 receptors, and cell proliferation in

123

Immunol Res

10.

11.

12. 13.

14.

15.

16.

17.

18. 19.

20.

21.

22.

23.

24.

25. 26.

27.

human mononuclear cells exposed to staphylococcal enterotoxin A. Cell Immunol. 1985;96:175–83. Chen L, Altman A, Mier W, Lu H, Zhu R, Haberkorn U. 99mTcpertechnetate uptake in hepatoma cells due to tissue-specific human sodium iodide symporter gene expression. Nucl Med Biol. 2006;33:575–80. Cheng M, Chan SY, Zhao Q, Chan EY, Au SW, Lee SS, Cheung WT. Construction and characterization of single-chain variable fragment antibody library derived from germline rearranged immunoglobulin variable genes. PLoS ONE. 2011;6:e27406. Comas-Riu J, Rius N. Flow cytometry applications in the food industry. J Ind Microbiol Biotechnol. 2009;36:999–1011. Dellabona P, Peccoud J, Kappler J, Marrack P, Benoist C, Mathis D. Superantigens interact with MHC class II molecules outside of the antigen groove. Cell. 1990;62:1115–21. Demarest SJ, Glaser SM. Antibody therapeutics, antibody engineering, and the merits of protein stability. Curr Opin Drug Discov Devel. 2008;11:675–87. Druar C, Saini SS, Cossitt MA, Yu F, Qiu X, Geisbert TW, Jones S, Jahrling PB, Stewart DI, Wiersma EJ. Analysis of the expressed heavy chain variable-region genes of Macaca fascicularis and isolation of monoclonal antibodies specific for the Ebola virus’ soluble glycoprotein. Immunogenetics. 2005;57:730–8. Du J, Zhang C, Fu J, Chen Z, Xiao Q. Preparation of a monoclonal antibody against polyhedrin of Ectropis obliqua nucleopolyhedrovirus. Chin J Biotechnol (Sheng wu gong cheng xue bao). 2012;28:76–85. Evenson ML, Hinds MW, Bernstein RS, Bergdoll MS. Estimation of human dose of staphylococcal enterotoxin A from a large outbreak of staphylococcal food poisoning involving chocolate milk. Int J Food Microbiol. 1988;7:311–6. Fraser JD. High-affinity binding of staphylococcal enterotoxins A and B to HLA-DR. Nature. 1989;339:221–3. Froyen G, Hendrix D, Ronsse I, Fiten P, Martens E, Billiau A. Effect of VH and VL consensus sequence-specific primers on the binding and neutralizing potential of a single-chain FV directed towards HuIFN-gamma. Mol Immunol. 1995;32:515–21. Hense M, Domann E, Krusch S, Wachholz P, Dittmar KE, Rohde M, Wehland J, Chakraborty T, Weiss S. Eukaryotic expression plasmid transfer from the intracellular bacterium Listeria monocytogenes to host cells. Cell Microbiol. 2001;3:599–609. Huang J, Liu Y, Liu Y, Sun Y, Zhuang S, Wang J, Zhang L. Distribution detecton, expression & purification of staphylococcal enterotoxin K SEK. Chinese J Cell Mol Immunol. 2010;26(3): 220–2. Kappler J, Kotzin B, Herron L, Gelfand EW, Bigler RD, Boylston A, Carrel S, Posnett DN, Choi Y, Marrack P. V beta-specific stimulation of human T cells by staphylococcal toxins. Science. 1989;244:811–3. Karsunke XY, Wang H, Weber E, McLean MD, Niessner R, Hall JC, Knopp D. Development of single-chain variable fragment (scFv) antibodies against hapten benzo[a]pyrene: a binding study. Anal Bioanal Chem. 2012;402:499–507. Kong T, Li XB, Liu GW, Xie GH, Wang Z, Zhang ZG, Zhang Y, Sun J, Tang J. Preparation of specific monoclonal antibodies against chelated copper ions. Biol Trace Elem Res. 2012;145: 388–95. Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res (GMR). 2003;2:63–76. Li J, Wang Y, Wang Z, Dong Z. Effect of VL and VH consensus sequence-specific primers on the binding and expression of a mini-molecule antibody directed towards human gastric cancer. Chin Med Sci J/Chin Acad Med Sci (Chung-kuo i hsueh k’o hsueh tsa chih). 2000;15:133–9. Lin YC, Anderson MJ, Kohler PL, Strandberg KL, Olson ME, et al. Proinflammatory exoprotein characterization of toxic shock

123

28.

29.

30.

31.

32.

33.

34. 35.

36.

37. 38.

39.

40.

41.

42.

43.

44.

syndrome Staphylococcus aureus. Biochemistry. 2011;50: 7157–67. Masuko K, Okazaki S, Satoh M, Tanaka G, Ikeda T, Torii R, Ueda E, Nakano T, Danbayashi M, Tsuruoka T, Ohno Y, Yagi H, Yabe N, Yoshida H, Tahara T, Kataoka S, Oshino T, Shindo T, Niwa S, Ishimoto T, Baba H, Hashimoto Y, Saya H, Masuko T. Anti-tumor effect against human cancer xenografts by a fully human monoclonal antibody to a variant 8-epitope of CD44R1 expressed on cancer stem cells. PLoS ONE. 2012;7:e29728. McCormick JK, Yarwood JM, Schlievert PM. Toxic shock syndrome and bacterial superantigens: an update. Annu Rev Microbiol. 2001;55:77–104. Mead PS, Slutsker L, Griffin PM, Tauxe RV. Food-related illness and death in the united states reply to dr. hedberg. Emerg Infect Dis. 1999;5:841–2. Mizuguchi H, Xu Z, Ishii-Watabe A, Uchida E, Hayakawa T. IRES-dependent second gene expression is significantly lower than cap-dependent first gene expression in a bicistronic vector. Mol Therapy J Am Soc Gene Therapy. 2000;1:376–82. Nehlsen K, Herrmann S, Zauers J, Hauser H, Wirth D. Toxinantitoxin based transgene expression in mammalian cells. Nucleic Acids Res. 2010;38(5):e32. Ortega E, Abriouel H, Lucas R, Ga´lvez A. Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins. 2010;2:2117–31. Pinchuk IV, Beswick EJ, Reyes VE. Staphylococcal enterotoxins. Toxins. 2010;2:2177–97. Sasaki T, Terano Y, Shibata T, Kawamoto H, Kuzuguchi T, Kohyama E, Watanabe T, Ohyama T, Gemba M. Establishment of highly specific and quantitative immunoassay systems for staphylococcal enterotoxin A, B, and C using newly-developed monoclonal antibodies. Microbiol Immunol. 2005;49:589–97. Scherrer D, Corti S, Muehlherr JE, Zweifel C, Stephan R. Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet Microbiol. 2004;101:101–7. Schlievert PM. Role of superantigens in human disease. J Infect Dis. 1993;167:997–1002. Scholl P, Diez A, Mourad W, Parsonnet J, Geha RS, Chatila T. Toxic shock syndrome toxin 1 binds to major histocompatibility complex class II molecules. Proc Natl Acad Sci USA. 1989;86:4210–4. Shen J, Vil MD, Jimenez X, Iacolina M, Zhang H, Zhu Z. Single variable domain-IgG fusion. A novel recombinant approach to Fc domain-containing bispecific antibodies. J Biol Chem. 2006;281: 10706–14. Singh PK, Agrawal R, Kamboj DV, Gupta G, Boopathi M, Goel AK, Singh L. Construction of a single-chain variable-fragment antibody against the superantigen Staphylococcal enterotoxin B. Appl Environ Microbiol. 2010;76:8184–91. Spaulding AR, Salgado-Pabon W, Kohler PL, Horswill AR, Leung DY, Schlievert PM. Staphylococcal and streptococcal superantigen exotoxins. Clin Microbiol Rev. 2013;26:422–47. Stoneley M, Willis AE. Cellular internal ribosome entry segments: structures, trans-acting factors and regulation of gene expression. Oncogene. 2004;23:3200–7. Thomas DY, Jarraud S, Lemercier B, Cozon G, Echasserieau K, Etienne J, Gougeon ML, Lina G, Vandenesch F. Staphylococcal enterotoxin-like toxins U2 and V, two new staphylococcal superantigens arising from recombination within the enterotoxin gene cluster. Infect Immun. 2006;74:4724–34. Urushibata Y, Itoh K, Ohshima M, Seto Y. Generation of Fab fragment-like molecular recognition proteins against staphylococcal enterotoxin B by phage display technology. Clin Vaccine Immunol (CVI). 2010;17:1708–17.

Immunol Res 45. Vagner S, Galy B, Pyronnet S. Irresistible IRES. Attracting the translation machinery to internal ribosome entry sites. EMBO Rep. 2001;2:893–8. 46. Vu BG, Gourronc FA, Bernlohr DA, Schlievert PM, Klingelhutz AJ. Staphylococcal superantigens stimulate immortalized human adipocytes to produce chemokines. PLoS ONE. 2013;8(10):e77988.

47. Wood AC, Todd I, Cockayne A, Arbuthnott JP. Staphylococcal enterotoxins and the immune system. FEMS Microbiol Immunol. 1991;3:121–33.

123