This article was downloaded by: [Michigan State University] On: 11 February 2015, At: 21:46 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and Agricultural Wastes Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/lesb20
Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata ab
ab
ab
ab
Lili Fan , Kehe Fu , Chuanjin Yu , Jia Ma , Yaqian Li
ab
& Jie Chen
ab
a
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China b
National Key Laboratory of Microbial Metabolism, Shanghai, China Published online: 05 Jun 2014.
Click for updates To cite this article: Lili Fan, Kehe Fu, Chuanjin Yu, Jia Ma, Yaqian Li & Jie Chen (2014) Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata, Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and Agricultural Wastes, 49:8, 569-577, DOI: 10.1080/03601234.2014.911574 To link to this article: http://dx.doi.org/10.1080/03601234.2014.911574
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Journal of Environmental Science and Health, Part B (2014) 49, 569–577 Copyright © Taylor & Francis Group, LLC ISSN: 0360-1234 (Print); 1532-4109 (Online) DOI: 10.1080/03601234.2014.911574
Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata LILI FAN1,2, KEHE FU1,2, CHUANJIN YU1,2, JIA MA1,2, YAQIAN LI1,2 and JIE CHEN1,2 1
Downloaded by [Michigan State University] at 21:46 11 February 2015
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China 2 National Key Laboratory of Microbial Metabolism, Shanghai, China
Agrobacterium tumefaciens-mediated transformation (ATMT) was used to generate an insertional mutant library of the mycelial fungus Trichoderma harzianum. From a total of 450 mutants, six mutants that showed significant influence on maize resistance to C. lunata were analyzed in detail. Maize coated with these mutants was more susceptible to C. lunata compared with those coated with a wild-type (WT) strain. Similar to other fungal ATMT libraries, all six mutants were single copy integrations, which occurred preferentially in noncoding regions (except two mutants) and were frequently accompanied by the loss of border sequences. Two mutants (T66 and T312) that were linked to resistance were characterized further. Maize seeds coated with T66 and T312 were more susceptible to C. lunata than those treated with WT. Moreover, the mutants affected the resistance of maize to C. lunata by enhancing jasmonate-responsive gene expression. T66 and T312 induced maize resistance to C. lunata infection through a jasmonic acid-dependent pathway. Keywords: Curvularia lunata, Trichoderma harzianum, ATMT, pathogen resistance.
Introduction Maize is attacked by a wide variety of pathogenic microorganisms throughout its lifetime. Among these pathogenic microorganisms, Curvularia lunata is an important seed and soil-borne plant pathogen that causes grain mold and leaf spot diseases, resulting in significant economic loss.[1] Fungicide applications help control the disease. However, this practice has a highly negative environmental effect and increases the risk of selecting resistant pathogenic strains. Therefore, the use of biocontrol fungi (BCF) could reduce chemical inputs. The genus Trichoderma is a well-known BCF group that controls pathogens through multiple actions, such as competition, antibiosis, mycoparasitism and induction of plant defense responses.[2] Address correspondence to Jie Chen, Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai 200240, China; E-mail: [email protected] Received December 28, 2013. Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/lesb.
Systemic disease control provided by root-colonizing Trichoderma strains involves complex interactions among the host plants, the pathogen, the biocontrol agent and several different environmental factors.[3] The genus Trichoderma produces beneficial effects on plant growth, disease resistance and crop yields,[4] but the influence of Trichoderma on plant disease resistance is unclear. Pathogens and plants are locked in a co-evolutionary arms race, and the final outcome of the battle depends on the balance between the ability of the pathogen to suppress the plant’s immune system and the plant’s capacity to recognize the pathogen and activate effective defenses.[5] Therefore, plant disease resistance or susceptibility depends on the expression of plant defense-related genes, which may represent two sides of the same mechanism. ATMT has been used to transform over 50 different fungal species because of its high percentage of single-copyintegrated DNA insertions. The procedure also causes the least disruption to the microbial genome.[6] We performed an insertional mutagenesis of Trichoderma harzianum to generate a library of 450 mutants, and we identified six mutants that significantly influenced maize resistance to C. lunata.
570
Fan et al.
Table 1. Explanation of the five mutants. Mutant T14 T66 T119 T312 T431
Name and NCBI accession Thc6, KC887076 Thg2, KF833398
Site of integration Upstream ORF Upstream ORF Downstream
Putative gene function (BlastX) No similarity found, no conserved domains found Transcription factor ACEII Trichoderma reesei, E=9e-167 Serine carboxypeptidase S28 Trichoderma reesei, E=1e-168 Glycoside hydrolase family Thielavia terrestris, E=1e-05 Hypothetical protein
ORF, Open Reading Frame.
Material and methods
Downloaded by [Michigan State University] at 21:46 11 February 2015
Plasmids, strains and culture conditions Plasmid pCAMBIA1300 and A. tumefaciens strain AGL1 (a T-DNA donor) were kindly provided by Associate Professor Chu Long Zhang from the Institute of Biotechnology at Zhejiang University in Hangzhou, China. T. harzianum wild-type (WT) strain Th22 and C. lunata strain CX3 were stored in our laboratory. Huangzao 4, a susceptible maize inbred line, was kindly provided by Dr. Wang of the Academies of Agricultural Sciences in Shenyang, China. Czapek Agar (CA) medium consisted of 1 g K2HPO4, 2 g NaNO3, 0.5 g MgSO47H2O, 0.5 g KCl, 0.01 g FeSO47H2O, 30 g sucrose and 14 g agar per liter.
internal reference. Primers were designed with Primer Premier 5.0 software and synthesized by Sangon Inc. (Shanghai, China). The primers used in this study are listed in Appendix Table A1. Three biological replicates were analyzed. Cloning of the sequences flanking T-DNA insertions Reverse PCR was used to clone the sequences flanking T-DNA insertions. The genomic DNA of mutants was digested by a unique single enzyme and precipitated with absolute ethyl alcohol. The digested DNA was self-linked with T4 ligase at 4 C overnight. After absolute ethyl alcohol precipitation, the ligation products were used as templates for PCR amplification.
Nucleic acid manipulations DNA was extracted by a standard cetyltrimethylammonium bromide protocol. For Southern blot analysis, DNA was digested with restriction enzymes and separated on a 0.9% agarose gel. Gel blotting, probe labeling reactions and hybridization were performed with a Gene Images CDP-Star Detection Kit (RPN 3680, GE Healthcare, Fairfield, CT, USA). Total RNA was isolated with Trizol (Invitrogen, Grand Island, NY, USA), and qRT-PCR was performed with TaKaRa (Kyoto, Japan) PrimeScript RT-PCR kit (DRR081A) on a Biotech Ftc-3000 (Scarborough, ON, Canada). The PCR consisted of a total volume of 25 mL containing 12.5 mL SYBR Premix Ex Taq, 1mL forward primer, 1 mL reverse primer, 1 mL cDNA template and 9.5 mL deionized water. The PCR conditions were as follows: preheating at 95 C for 30 s, followed by 35 cycles of 95 C for 20 s, 55 C for 30 s and 72 C for 20 s. Gene expression levels were calculated relative to the WT strain as
Relative mRNA D 2 ¡ ððCtt ¡ CttiÞ ¡ ðCtw ¡ CtwiÞÞ ; where Ctt, Ctti, Ctw and Ctwi were the Ct values of the target gene, target gene internal reference, WT strain and WT strain internal reference, respectively. Three genes were analyzed, namely, pr1 (U82200), pal1 (L77912) and opr7 (AY921644). 18S rRNA was set as the
Construction of the random insertion plasmid pC1300th Plasmid pCAMBIA1300 was digested by EcoRI/XhoI to cut off the Camv35S promoter and hph ORF; the resulting fragment was gel-purified to produce plasmid pC1300-h. Subsequently, a 1345-bp fragment containing the hph ORF (1026 bp) and promoter (319 bp) was amplified from plasmid 1003 with HiFi polymerase and primers TkhU (upper) and TkhL (lower). An EcoRI site and an XhoI site were added to the upper primer and lower primer, respectively. After digestion with the appropriate restriction enzymes, the fragment was gel-purified and inserted into EcoRI/XhoI -digested pC1300-h to produce plasmid pC1300th (Fig. 1A). Construction of gene disruption plasmids and screening of knock out mutants A 1608-bp fragment containing the hph ORF (1026 bp), promoter regions (319 bp) and terminator of CAMV35S (263 bp) was amplified from plasmid 1003 by the HiFi polymerase using primers 13 khU (upper) and 13 khL (lower). An XbaI site and a BamHI site were added to upper primer and lower primer, respectively. After digestion with the appropriate restriction enzymes, the fragment was gel-purified and inserted into XbaI/BamHI-digested pC1300-h to produce plasmid pC1300kh. The 50 flanking fragment and 30 flanking fragment of Thc6 and Thg2 were
571
Downloaded by [Michigan State University] at 21:46 11 February 2015
Construction and functional analysis of Trichoderma mutants
Fig. 1. Graphical representation of plasmids and ATMT homologous recombination. (A) Plasmid used to construct ATMT mutants. (B) Plasmid for gene knockout. C: ATMT homologous recombination.
inserted into two sides of the hph replacement cassette. The knockout mutants were screened with PCR and Southern blotting according to Fu et al.[7] (Fig. 1B).
Pathogen inoculation Maize seeds were sterilized in 10% sodium hypochlorous for 20 min and then in 70% ethanol for 30 s. Subsequently, the seeds were soaked in 1% sodium
carboxymethyl cellulose solution, and Trichoderma conidia were added into the solution (1 £ 106 conidia mL¡1). After inoculation for 12 h at 25 C in light culture, the seeds were transferred to a Petri dish (containing a filter paper bed with water) to germinate for 12h at 25 C in light culture. For the primary screening, the seeds were plugged in an aperture disk (32 holes, 125 cm3/hole, 8 holes per treatment) containing nutritive soil and incubated in a growth chamber at 25 C for 20 days (four- to five-leaf stage). For the secondary
572
Fan et al. Results Construction and screening of the mutant library
Downloaded by [Michigan State University] at 21:46 11 February 2015
Fig. 2. Southern blot of T-DNA insertions in six mutants. (A) Mutants digested with HindIII. 5: negative control. P: plasmid, positive control. (B) Mutant T66 (1) and T312 (2) digested with XbaI (repeated experiment).
screening, leaf infection assays were performed. C. lunata conidia were diluted to 2 £ 105 conidia/mL with sterile water and sprayed onto maize leaves. The infected maize was grown in a chamber under dark conditions and constant humidity for 24 h to allow the disease to develop. Disease index investigation Disease evaluation was based on a scale for leaf spot disease from grade zero to grade five. Grade zero: no disease spot; Grade 1: no more than 10%; Grade 2: 11–30%; Grade 3: 31–50%; Grade 4: 51–70%; and Grade 5: more than 70%. At 5th day after spray inoculation, all leaves were investigated. The disease index was calculated as follows:
A total of 450 random mutants were obtained by an optimized ATMT protocol. The mutants were genetically purified by five rounds of subculture on potato dextrose agar medium without hygromycin B, followed by two rounds of single spore isolation. Polymerase chain reaction (PCR) confirmed the integration of the hph gene from plasmid pCAMBIA1300th. The Southern blot analysis of randomly chosen mutants showed that most mutants contained single T-DNA integrations. In addition, T-DNA insertions were randomly integrated (Fig. 2). All mutants were prescreened in a living maize leaf inoculation (Fig. 3A) and divided into two classes: higher than WT and lower than WT (Fig. 3B). Most mutants showed disease indices higher or lower than WT within a 20% range, with no significant difference to WT. Only six mutants showed a disease index that was significantly higher or lower (>20%) than WT (Fig. 3C). Of these six, mutant T32 showed a disease index lower than WT, but the other five mutants had disease indices higher than WT. Among these five, mutants T66 and T312 showed the most obvious influence on maize, with disease indices 35.4% and 30.6% higher than WT (P < 0.001), respectively.
Rescue and analysis of T-DNA insertion
Disease index D
ðX ði D 0Þ 5iðNL "
#
i
iÞ
=ðTN HGÞ 100%;
where i D disease index, NL D number of diseased leaves for each grade, TN D total number of diseased leaves in all grades, and HG D the highest grade of disease index.
Because these five mutants clearly showed a single integration event, they were subjected to a detailed molecular study. To clone the genomic regions adjacent to the T-DNA borders, reverse PCR was performed in these mutants as described in the Materials and Methods. The five mutant border sequences (LB and RB) were analyzed to identify the genes targeted by ATMT (Table 1, Fig. 4). Only mutant T66 showed an integral T-DNA insertion, and no deletion occurred in genomic DNA. In the other four mutants, a small genomic DNA deletion of
Fig. 3. Screening of the ATMT mutants based on the disease index. (A) Disease index grades 0 to 5, according to the disease spot area. (B) Disease indices for all 450 mutants. (C) Primary screening of mutant functions. CK: no Trichoderma treatment. WT: wildtype strain treatment. Columns 3 to 9: different mutant treatments.
573
Downloaded by [Michigan State University] at 21:46 11 February 2015
Construction and functional analysis of Trichoderma mutants
Fig. 4. Diagram of T-DNA insertion sites and deletions in five mutants obtained by Agrobacterium tumefaciens-mediated transformation (ATMT). RB: right border of T-DNA. LB: left border of T-DNA.
15–22 bp was caused by the T-DNA insertion. Furthermore, a small deletion of 3–12 bp also occurred in the RB and LB of T-DNA fragments. We chose two mutants (T66 and T312) for further investigation.
Analysis of the T66 and T312 mutants Through five cycles of reverse PCR, the 7.5 kb and 6.9 kb fragments flanking the T-DNA insertions in mutants T66
Downloaded by [Michigan State University] at 21:46 11 February 2015
574 and T312, respectively, were obtained. According to NCBI BLAST and bioinformatics analysis, mutant T66 was linked to a zinc finger protein (Thc6, GenBank ID KC887076), which showed a 64% overall similarity to the Ace2 gene of T. reesei. This transcriptional regulator, activator of cellulase 2 (ace2), encodes a protein belonging to a class of zinc binuclear cluster proteins.[8] Ace2 mediates cellulase and xylanase expression. Cellulase, a cell wall degrading enzyme, participates in the induction of host plant resistance.[9–11] In contrast, mutant T312 was linked to a glycoside hydrolase family protein from Thielavia terrestris named Thg2 (E D 1e-05; GenBank ID KF833398). We also deleted the target genes identified in mutants T66 and T312. After gene knockouts by ATMT, PCR and Southern blot were used to screen the mutants. To verify whether the mutants T66 and T312 were responsible for the observed maize resistance phenotypes, WT and knockout mutants were assayed. Influence on the expression of defense-related genes in maize A systemic defense response is often triggered in plants to protect them against pathogen invasions. This long-lasting and broad-spectrum-induced disease resistance is referred to as systemic acquired resistance (SAR) and is characterized by the coordinated activation of a specific set of PR genes. In contrast to salicylic acid (SA)-dependent SAR, beneficial soil-borne microorganisms induce a phenotypically similar form of systemic immunity called induced systemic resistance, which is often regulated by jasmonic acid (JA)-dependent signaling pathways.[12] Therefore, we analyzed the expression of SA- and JA-
Fig. 5. qRT-PCR analysis of defense-related gene expression in maize leaves. CK: no treatment. MCWT: maize treated only with wild-type Trichoderma. MCC: maize treated only with C. lunata. WT, DThg2 and DThc6: maize pretreated with conidia from WT, DThg2 and DThc6 strains, respectively, and then treated with C. lunata.
Fan et al. related proteins to elucidate the potential involvement of signaling pathways. Previously, we found that the expression of pathogenesis-related genes were clearly changed after 24 h of pathogen inoculation (data not shown). We investigated the gene expression levels of resistance-related defense proteins at 24 h after leaf infection with C. lunata. The expression of pal1, opr7 and pr1 were maintained at a low level when the maize was pretreated with Trichoderma only (Fig. 5). After inoculation with C. lunata (MCC), all three genes were expressed at a higher level than in CK. However, when maize was pretreated with WT and then inoculated with C. lunata, the expression of these three genes was higher when maize was only inoculated with C. lunata (P < 0.01, Appendix Tables A2 and A3). Thus, Trichoderma pretreatment induced more intense defense responses to C. lunata. We also found that maize pretreated with DThc6 and DThg2 showed significantly lower expression of pal1 and opr7 compared with WT (p < 0.01). The 12-oxo-phytodienoic acid reductase gene (opr7) is implicated in JA biosynthesis.[13] This result suggested that Thc6 and Thg2 genes participated in regulating the maize defense response against C. lunata through the JA pathway.[14] Djonovic et al. found that T. virens induces systemic protection in maize leaves inoculated with Colletotrichum graminicola, and this protection is associated with the induction of JA and green leaf volatile-biosynthetic genes.
Discussion ATMT-based random mutant libraries are an efficient strategy for identifying genes involved in different functions.[15–17] In this study, ATMT was used to identify new T. harzianum factors involved in maize resistance to C. lunata. This method resulted in a high transformation rate. In approximately 1.5% of the transformants, we obtained stable mutants that showed a significant influence on maize resistance. T-DNA integrates randomly at single sites in the genomes of yeasts, many filamentous fungi, and plants.[18,19] In our study, a high percentage of T-DNA integrations were single-copy events. Blaise et al.[20] have described the importance of preserving T-DNA borders during integration for the subsequent recovery of flanking sequences. Rolland also found that it is easier to rescue the sequence flanking then T-DNA LB in B. cinerea. In contrast, we obtained both regions adjacent to the T-DNA insertion sites via inverse PCR, although some mutants showed deletions at the T-DNA border. Trichoderma species are soil-borne fungi that are usually beneficial to plants. Trichoderma has been applied to a wide range of plant species for growth enhancement, with a positive effect on plant weight, and disease control.[21,22] To expand the use of Trichoderma in agriculture, we need a thorough examination of the complex interactions
Downloaded by [Michigan State University] at 21:46 11 February 2015
Construction and functional analysis of Trichoderma mutants between the host plant, pathogens and Trichoderma. A number of reports have focused on the systemic effects including T. asperellum T203, T. harzianum 382 and T. harzianum T39.[8] Systemic induction of plant defenses is the central mechanism by which Trichoderma spp. diminish foliar disease. Although the nature of systemic resistance remains unclear, the plant hormones salicylic acid (SA), jasmonic acid (JA), or ethylene (ET) play important roles. JA is involved in the interactions between Trichoderma and plants, and T. asperellum T203 induces disease resistance in cucumber in a JA-pathway-dependent manner.[9] Like other beneficial microorganisms, the Trichoderma sensitizes plants by “priming,” which is characterized by faster and/or stronger activation of cellular defenses upon pathogen or insect attack and results in enhanced resistance to invaders.[10] Our research also showed that the expression of SA-related and JA-related genes is generally weak. However, these defense genes were up-regulated by C. lunata. Furthermore, there were significant differences in opr7 expression in plants treated with WT, DThc6 and DThg2, which indicated that T66 and T312 inhibit maize disease resistance regulated by JA pathways. In future studies, we will focus on how Thg2 and Thc6 regulated the interactions between Trichoderma, maize and C. lunata.
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14] [15]
Funding [16]
This work was supported by grants from the National Natural Science Foundation of China (nos. 30971949, 31270155, 31171798 and 41001189) and China Agriculture Research System project (CARS-02).
References [1] Liu, T.; Xu, S.; Liu, L.; Zhou, F.; Hou, J.; Chen, J. Cloning and characteristics of Brn1 gene in Curvularia lunata causing leaf spot in maize. Eur. J. Plant Pathol. 2011, 131, 211–219. [2] Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma species-opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [3] Hermosa, R.; Woo, S.L.; Lorito, M.; Monte, E. Proteomic approaches to understand Trichoderma biocontrol mechanisms and plant interactions. Curr. Proteomics. 2010, 7, 298–305. [4] Holmes, K.A.; Schroers, H.J.; Thomas, S.E.; Evans, H.C.; Samuels, G.J. Taxonomy and biocontrol potential of a new species of Trichoderma from the Amazon basin of South America. Mycol. Prog. 2004, 3, 199–210. [5] Pieterse, C.M.; Leon-Reyes, A.; Van der Ent, S.; Van Wees, S.C. Networking by small-molecule hormones in plant immunity. Nat. Chem. Biol. 2009, 5, 308–316. [6] Giesbert, S.; Schumacher, J.; Kupas, V.; Espino, J.; Segm€ uller, N.; Haeuser-Hahn, I.; Schreier, P.; Tudzynski, P. Identification of pathogenesis-associated genes by T-DNA-mediated insertional mutagenesis in Botrytis cinerea: A type 2A phosphoprotein
[17]
[18]
[19]
[20]
[21]
[22]
575
phosphatase and an SPT3 transcription factor have significant impact on virulence. Mol. Plant Microbe. Interact. 2012, 25, 481– 495. Fu, K.; Fan, L.; Li, Y.; Gao, S.; Chen, J. Tmac1, a transcription factor which regulated high affinity copper transport in Trichoderma reesei. Microbiol. Res. 2012, 167, 536–543. Bailey, B.; Bae, H.; Strem, M.; Roberts, D.; Thomas, S.; Crozier, J.; Samuels, G.; Choi, I. Y.; Holmes, K. Fungal and plant gene expression during the colonization of cacao seedlings by endophytic isolates of four Trichoderma species. Planta. 2006, 224, 1449–1464. Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology. 2005, 95, 76–84. Conrath, U.; Beckers, G.J.; Flors, V.; Garcıa, A.P.; Jakab, G.; Mauch, F., Newman, M.A., Pieterse, C.M., Poinssot, B.; Pozo, M. J. Priming: getting ready for battle. Mol. Plant Microbe. Interact. 2006, 19, 1062–1071. Vinale, F.; Sivasithamparam, K.; Ghisalberti, E.L.; Marra, R.; Woo, S.L.; Lorito, M. Trichoderma–plant–pathogen interactions. Soil. Biol. Biochem. 2008, 40, 1–10. Van Wees, S.; Van der Ent, S.; Pieterse, C.M. Plant immune responses triggered by beneficial microbes. Curr. Opin. Plant. Biol. 2008, 11, 443–448. Djonovic, S.; Vargas, W.A.; Kolomiets, M.V.; Horndeski, M.; Wiest, A.; Kenerley, C.M. A proteinaceous elicitor Sm1 from the beneficial fungus Trichoderma virens is required for induced systemic resistance in maize. Plant Physiol. 2007, 145, 875–889 Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu. Rev. Plant. Biol. 2002, 53, 275–297. Michielse, C.B.; van Wijk, R.; Reijnen, L.; Cornelissen, B.; Rep, M. Insight into the molecular requirements for pathogenicity of Fusarium oxysporum f. sp. lycopersici through large-scale insertional mutagenesis. Genome. Biol. 2009, 10, R4. Idnurm, A.; Walton, F.J.; Floyd, A.; Reedy, J.L.; Heitman, J. Identification of ENA1 as a virulence gene of the human pathogenic fungus Cryptococcus neoformans through signature-tagged insertional mutagenesis. Eukaryot. Cell. 2009, 8, 315–326. Patel, M.; Dewey, R.E.; Qu, R. Enhancing Agrobacterium tumefaciens - mediated ransformation efficiency of perennial ryegrass and rice using heat and high maltose treatments during bacterial infection. Plant Cell. 2013, 114, 19–29. Betts, M.F.; Tucker, S.L.; Galadima, N.; Meng, Y.; Patel, G.; Li, L.; Donofrio, N.; Floyd, A.; Nolin, S.; Brown, D. Development of a high throughput transformation system for insertional mutagenesis in Magnaporthe oryzae. Fungal Genet. Biol. 2007, 44, 1035–1049. Rolland, S.; Jobic, C.; Fevre, M.; Bruel, C. Agrobacterium-mediated transformation of Botrytis cinerea, simple purification of monokaryotic transformants and rapid conidia-based identification of the transfer-DNA host genomic DNA flanking sequences. Curr. Genet. 2003, 44, 164–171. Blaise, F.; Remy, E.; Meyer, M.; Zhou, L.; Narcy, J.P.; Roux, J.; Balesdent, M.H.; Rouxel, T. A critical assessment of Agrobacterium tumefaciens-mediated transformation as a tool for pathogenicity gene discovery in the phytopathogenic fungus Leptosphaeria maculans. Fungal Genet. Biol. 2007, 44, 123–138. Contreras-Cornejo, H.A.; Macıas, R.L., Cortes, P.C.; L opez, B.J. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxindependent mechanism in Arabidopsis. Plant Physiol. 2009, 149, 1579–1592. Zhang, F.; Yuan, J.; Yang, X.M.; Cui, Y.Q.; Chen, L.H.; Ran, W.; Shen, Q.R. Putative Trichoderma harzianum mutant promotes cucumber growth by enhanced production of indole acetic acid and plant colonization. Plant Soil 2013, 368, 433–444.
576
Fan et al.
Appendix Table A1. Primers used in this study. Oligonucleotide Sequences (50 -30 )b
Length (bp)
GTATCATGATCGGTATGGGTCAGA TAGAAGGTGTGGTGCCAGATCTT CTACAACAACGGGCTCACCT CACGATGTAGGTGGACGACA TCAGCAAACAACAAACAATGG GGAGTGGATCAGCTTGCAGT GAGAAAGGTGGTTGATGCTGTT GGAGTTGGATACTTGCCATAGG GGGAATTCGGAGGTCAACACATCAAT GGCTCGAGCTATTCCTTTGCCCTCGG GGTCTAGAGGAGGTCAACACATCAAT GGGGATCCACAAATTGACGCTTAGAC GGAAGCTTCTGTTTCCGTTTGAGTGC GGGGATCCGGCGGATCAGTGCATGTT GGGGATCCCAACTCCAGCCGCATGCA GGGAGCTCTTGACAAATGCCTCCTC GGaagcttCTGCACCCACTGCTTGAT GGtctagaCTTGCCAAACAGTGAGTGA GGggatccCTCCATCAGAAGCGAGTG GGgagctcAAACAGGCTCGTTAGGAC CCAGCGTCACATCATTCA CGCTCGTCTGGCTAAGAT
116
Internal control
250
pal
233
pr1
189
opr7
1360 1608
PRChph ORF EcoRI/XhoI PRChph ORFCTE
961
50 flank of Thc6 knock out (XbaI/XbaI)
480
30 flank of Thc6 knock out (BamHI/SacI)
641
50 flank of Thg2 knock out (HindIII/XbaI)
1036
30 flank of Thg2 knock out (BamHI/SacI)
1624
hph fragment C fragment upper of Thc6 50 flank
Downloaded by [Michigan State University] at 21:46 11 February 2015
Primersa rRNAU rRNAL ZMPALU ZMPALL ZMPR1U ZMPR1L ZMOPR7U ZMOPR7L TkhU TkhL 13khU 13khL KOThc65U KOThc65L KOThc63U KOThc63L KOThg25U KOThg25L KOThg23U KOThg23L OThc6U OThc6L
Explainc
a
U means upper primer and L means lower primer. Underline marks the endonuclease site. c PR, promoter; ORF: open reading frame. b
Table A2. Anova analysis of relative mRNA level of pal1, opr7 and pr1. Test of homogeneity of variances
ANOVA
LS
df1
df2
Sig.
pal1
2.275
5
12
0.113
opr7
LS 2.682
df1 5.000
LS 2.181
df1 5
pr1
df2 12.000
Sig. 0.075
df2 12
Sig. 0.125
BG WG Total BG WG Total BG WG Total
SS
Df
MS
F
Sig.
46.887 0.220 47.107 SS 62.217 0.650 62.867 SS 41.238 0.167 41.405
5 12 17 Df 5 12 17 Df 5 12 17
9.377 0.018
511.682
0.000
MS 12.443 0.054
F 229.814
Sig. 0.000
MS 8.248 0.014
F 593.570
Sig. 0.000
Multiple Comparisons pal1 (Equal variance) Tukey comparison (I) group CK
opr7 (Equal variance) Tukey comparison
pr1 (Equal variance) Tukey comparison
(J) group
MD (I–J)
Std. Error
Sig.
MD (I–J)
Std. Error
Sig.
MD (I–J)
MCWT MCC WT DThc6
¡0.367 ¡3.302 ¡4.249 ¡2.315
0.111 0.111 0.111 0.111
0.053 0.000 0.000 0.000
¡0.419 ¡3.611 ¡5.346 ¡2.152
0.190 0.190 0.190 0.190
0.303 0.000 0.000 0.000
¡0.088 ¡2.936 ¡3.294 ¡3.383
Std. Error 0.096 0.096 0.096 0.096
Sig. 0.935 0.000 0.000 0.000
(Continued on next page)
577
Construction and functional analysis of Trichoderma mutants Table A2. Anova analysis of relative mRNA level of pal1, opr7 and pr1. (Continued) Test of homogeneity of variances
MCWT
Downloaded by [Michigan State University] at 21:46 11 February 2015
MCC
WT
DThc6
DThg2
ANOVA
LS
df1
df2
Sig.
DThg2 CK MCC WT DThc6 DThg2 CK MCWT WT DThc6 DThg2 CK MCWT MCC DThc6 DThg2 CK MCWT MCC WT DThg2 CK MCWT MCC WT DThc6
¡3.641 0.367 ¡2.935 ¡3.882 ¡1.948 ¡3.274 3.302 2.935 ¡0.947 0.987 ¡0.339 4.249 3.882 0.947 1.934 0.608 2.315 1.948 ¡0.987 ¡1.934 ¡1.326 3.641 3.274 0.339 ¡0.608 1.326
0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111
0.000 0.053 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.081 0.000 0.000 0.000 0.000 0.001 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.081 0.001 0.000
¡3.342 0.419 ¡3.192 ¡4.927 ¡1.733 ¡2.923 3.611 3.192 ¡1.735 1.458 0.269 5.346 4.927 1.735 3.193 2.004 2.152 1.733 ¡1.458 ¡3.193 ¡1.190 3.342 2.923 ¡0.269 ¡2.004 1.190
SS
Df
MS
0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190
0.000 0.303 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.719 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.719 0.000 0.000
¡3.344 0.088 ¡2.848 ¡3.206 ¡3.295 ¡3.256 2.936 2.848 ¡0.358 ¡0.447 ¡0.408 3.294 3.206 0.358 ¡0.089 ¡0.050 3.383 3.295 0.447 0.089 0.039 3.344 3.256 0.408 0.050 ¡0.039
F
Sig.
0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096
0.000 0.935 0.000 0.000 0.000 0.000 0.000 0.000 0.027 0.006 0.011 0.000 0.000 0.027 0.932 0.994 0.000 0.000 0.006 0.932 0.998 0.000 0.000 0.011 0.994 0.998
CK, maize without treatment; MCWT, maize pretreated with wild-type strain; MCC, maize inoculated with C. lunata; WT, DThc6 and DThg2, maize pretreated with WT, DThc6 and DThg2, respectively, and then inoculated with C. lunata.
Table A3. qRT-PCR efficiency of aoc, opr7, pal and pr1. pal1
CK
MCWT
MCC
WT DThc6 DThg2
opr7
pr1
Ct
PCR efficiency
Ct
PCR efficiency
Ct
PCR efficiency
27.013 27.293 27.192 26.002 26.412 26.231 25.542 25.466 25.732 24.958 25.313 25.465 25.880 26.314 26.365 24.476 24.799 24.786
1.641 1.606 1.639 1.672 1.696 1.681 1.654 1.579 1.673 1.666 1.562 1.624 1.719 1.598 1.626 1.700 1.658 1.664
29.344 29.562 29.311 28.352 28.415 28.414 27.777 27.549 27.841 27.062 27.265 27.309 28.316 28.554 28.631 27.019 27.134 26.922
1.711 1.700 1.688 1.768 1.684 1.732 1.660 1.699 1.733 1.709 1.681 1.611 1.711 1.716 1.718 1.752 1.733 1.640
29.171 28.504 29.131 28.516 28.006 28.438 27.865 26.776 27.793 27.422 26.753 27.736 27.674 27.100 27.883 26.763 26.028 26.864
1.645 1.615 1.668 1.581 1.587 1.659 1.749 1.732 1.763 1.692 1.700 1.770 1.646 1.689 1.621 1.691 1.694 1.687
CK, maize without treatment; MCWT, maize pretreated with wild-type strain; MCC, maize inoculated with C. lunata; WT, DThc6 and DThg2, maize pretreated with WT, DThc6 and DThg2, respectively, and then inoculated with C. lunata.
Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and Agricultural Wastes Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/lesb20
Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata ab
ab
ab
ab
Lili Fan , Kehe Fu , Chuanjin Yu , Jia Ma , Yaqian Li
ab
& Jie Chen
ab
a
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China b
National Key Laboratory of Microbial Metabolism, Shanghai, China Published online: 05 Jun 2014.
Click for updates To cite this article: Lili Fan, Kehe Fu, Chuanjin Yu, Jia Ma, Yaqian Li & Jie Chen (2014) Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata, Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and Agricultural Wastes, 49:8, 569-577, DOI: 10.1080/03601234.2014.911574 To link to this article: http://dx.doi.org/10.1080/03601234.2014.911574
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Journal of Environmental Science and Health, Part B (2014) 49, 569–577 Copyright © Taylor & Francis Group, LLC ISSN: 0360-1234 (Print); 1532-4109 (Online) DOI: 10.1080/03601234.2014.911574
Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata LILI FAN1,2, KEHE FU1,2, CHUANJIN YU1,2, JIA MA1,2, YAQIAN LI1,2 and JIE CHEN1,2 1
Downloaded by [Michigan State University] at 21:46 11 February 2015
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China 2 National Key Laboratory of Microbial Metabolism, Shanghai, China
Agrobacterium tumefaciens-mediated transformation (ATMT) was used to generate an insertional mutant library of the mycelial fungus Trichoderma harzianum. From a total of 450 mutants, six mutants that showed significant influence on maize resistance to C. lunata were analyzed in detail. Maize coated with these mutants was more susceptible to C. lunata compared with those coated with a wild-type (WT) strain. Similar to other fungal ATMT libraries, all six mutants were single copy integrations, which occurred preferentially in noncoding regions (except two mutants) and were frequently accompanied by the loss of border sequences. Two mutants (T66 and T312) that were linked to resistance were characterized further. Maize seeds coated with T66 and T312 were more susceptible to C. lunata than those treated with WT. Moreover, the mutants affected the resistance of maize to C. lunata by enhancing jasmonate-responsive gene expression. T66 and T312 induced maize resistance to C. lunata infection through a jasmonic acid-dependent pathway. Keywords: Curvularia lunata, Trichoderma harzianum, ATMT, pathogen resistance.
Introduction Maize is attacked by a wide variety of pathogenic microorganisms throughout its lifetime. Among these pathogenic microorganisms, Curvularia lunata is an important seed and soil-borne plant pathogen that causes grain mold and leaf spot diseases, resulting in significant economic loss.[1] Fungicide applications help control the disease. However, this practice has a highly negative environmental effect and increases the risk of selecting resistant pathogenic strains. Therefore, the use of biocontrol fungi (BCF) could reduce chemical inputs. The genus Trichoderma is a well-known BCF group that controls pathogens through multiple actions, such as competition, antibiosis, mycoparasitism and induction of plant defense responses.[2] Address correspondence to Jie Chen, Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai 200240, China; E-mail: [email protected] Received December 28, 2013. Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/lesb.
Systemic disease control provided by root-colonizing Trichoderma strains involves complex interactions among the host plants, the pathogen, the biocontrol agent and several different environmental factors.[3] The genus Trichoderma produces beneficial effects on plant growth, disease resistance and crop yields,[4] but the influence of Trichoderma on plant disease resistance is unclear. Pathogens and plants are locked in a co-evolutionary arms race, and the final outcome of the battle depends on the balance between the ability of the pathogen to suppress the plant’s immune system and the plant’s capacity to recognize the pathogen and activate effective defenses.[5] Therefore, plant disease resistance or susceptibility depends on the expression of plant defense-related genes, which may represent two sides of the same mechanism. ATMT has been used to transform over 50 different fungal species because of its high percentage of single-copyintegrated DNA insertions. The procedure also causes the least disruption to the microbial genome.[6] We performed an insertional mutagenesis of Trichoderma harzianum to generate a library of 450 mutants, and we identified six mutants that significantly influenced maize resistance to C. lunata.
570
Fan et al.
Table 1. Explanation of the five mutants. Mutant T14 T66 T119 T312 T431
Name and NCBI accession Thc6, KC887076 Thg2, KF833398
Site of integration Upstream ORF Upstream ORF Downstream
Putative gene function (BlastX) No similarity found, no conserved domains found Transcription factor ACEII Trichoderma reesei, E=9e-167 Serine carboxypeptidase S28 Trichoderma reesei, E=1e-168 Glycoside hydrolase family Thielavia terrestris, E=1e-05 Hypothetical protein
ORF, Open Reading Frame.
Material and methods
Downloaded by [Michigan State University] at 21:46 11 February 2015
Plasmids, strains and culture conditions Plasmid pCAMBIA1300 and A. tumefaciens strain AGL1 (a T-DNA donor) were kindly provided by Associate Professor Chu Long Zhang from the Institute of Biotechnology at Zhejiang University in Hangzhou, China. T. harzianum wild-type (WT) strain Th22 and C. lunata strain CX3 were stored in our laboratory. Huangzao 4, a susceptible maize inbred line, was kindly provided by Dr. Wang of the Academies of Agricultural Sciences in Shenyang, China. Czapek Agar (CA) medium consisted of 1 g K2HPO4, 2 g NaNO3, 0.5 g MgSO47H2O, 0.5 g KCl, 0.01 g FeSO47H2O, 30 g sucrose and 14 g agar per liter.
internal reference. Primers were designed with Primer Premier 5.0 software and synthesized by Sangon Inc. (Shanghai, China). The primers used in this study are listed in Appendix Table A1. Three biological replicates were analyzed. Cloning of the sequences flanking T-DNA insertions Reverse PCR was used to clone the sequences flanking T-DNA insertions. The genomic DNA of mutants was digested by a unique single enzyme and precipitated with absolute ethyl alcohol. The digested DNA was self-linked with T4 ligase at 4 C overnight. After absolute ethyl alcohol precipitation, the ligation products were used as templates for PCR amplification.
Nucleic acid manipulations DNA was extracted by a standard cetyltrimethylammonium bromide protocol. For Southern blot analysis, DNA was digested with restriction enzymes and separated on a 0.9% agarose gel. Gel blotting, probe labeling reactions and hybridization were performed with a Gene Images CDP-Star Detection Kit (RPN 3680, GE Healthcare, Fairfield, CT, USA). Total RNA was isolated with Trizol (Invitrogen, Grand Island, NY, USA), and qRT-PCR was performed with TaKaRa (Kyoto, Japan) PrimeScript RT-PCR kit (DRR081A) on a Biotech Ftc-3000 (Scarborough, ON, Canada). The PCR consisted of a total volume of 25 mL containing 12.5 mL SYBR Premix Ex Taq, 1mL forward primer, 1 mL reverse primer, 1 mL cDNA template and 9.5 mL deionized water. The PCR conditions were as follows: preheating at 95 C for 30 s, followed by 35 cycles of 95 C for 20 s, 55 C for 30 s and 72 C for 20 s. Gene expression levels were calculated relative to the WT strain as
Relative mRNA D 2 ¡ ððCtt ¡ CttiÞ ¡ ðCtw ¡ CtwiÞÞ ; where Ctt, Ctti, Ctw and Ctwi were the Ct values of the target gene, target gene internal reference, WT strain and WT strain internal reference, respectively. Three genes were analyzed, namely, pr1 (U82200), pal1 (L77912) and opr7 (AY921644). 18S rRNA was set as the
Construction of the random insertion plasmid pC1300th Plasmid pCAMBIA1300 was digested by EcoRI/XhoI to cut off the Camv35S promoter and hph ORF; the resulting fragment was gel-purified to produce plasmid pC1300-h. Subsequently, a 1345-bp fragment containing the hph ORF (1026 bp) and promoter (319 bp) was amplified from plasmid 1003 with HiFi polymerase and primers TkhU (upper) and TkhL (lower). An EcoRI site and an XhoI site were added to the upper primer and lower primer, respectively. After digestion with the appropriate restriction enzymes, the fragment was gel-purified and inserted into EcoRI/XhoI -digested pC1300-h to produce plasmid pC1300th (Fig. 1A). Construction of gene disruption plasmids and screening of knock out mutants A 1608-bp fragment containing the hph ORF (1026 bp), promoter regions (319 bp) and terminator of CAMV35S (263 bp) was amplified from plasmid 1003 by the HiFi polymerase using primers 13 khU (upper) and 13 khL (lower). An XbaI site and a BamHI site were added to upper primer and lower primer, respectively. After digestion with the appropriate restriction enzymes, the fragment was gel-purified and inserted into XbaI/BamHI-digested pC1300-h to produce plasmid pC1300kh. The 50 flanking fragment and 30 flanking fragment of Thc6 and Thg2 were
571
Downloaded by [Michigan State University] at 21:46 11 February 2015
Construction and functional analysis of Trichoderma mutants
Fig. 1. Graphical representation of plasmids and ATMT homologous recombination. (A) Plasmid used to construct ATMT mutants. (B) Plasmid for gene knockout. C: ATMT homologous recombination.
inserted into two sides of the hph replacement cassette. The knockout mutants were screened with PCR and Southern blotting according to Fu et al.[7] (Fig. 1B).
Pathogen inoculation Maize seeds were sterilized in 10% sodium hypochlorous for 20 min and then in 70% ethanol for 30 s. Subsequently, the seeds were soaked in 1% sodium
carboxymethyl cellulose solution, and Trichoderma conidia were added into the solution (1 £ 106 conidia mL¡1). After inoculation for 12 h at 25 C in light culture, the seeds were transferred to a Petri dish (containing a filter paper bed with water) to germinate for 12h at 25 C in light culture. For the primary screening, the seeds were plugged in an aperture disk (32 holes, 125 cm3/hole, 8 holes per treatment) containing nutritive soil and incubated in a growth chamber at 25 C for 20 days (four- to five-leaf stage). For the secondary
572
Fan et al. Results Construction and screening of the mutant library
Downloaded by [Michigan State University] at 21:46 11 February 2015
Fig. 2. Southern blot of T-DNA insertions in six mutants. (A) Mutants digested with HindIII. 5: negative control. P: plasmid, positive control. (B) Mutant T66 (1) and T312 (2) digested with XbaI (repeated experiment).
screening, leaf infection assays were performed. C. lunata conidia were diluted to 2 £ 105 conidia/mL with sterile water and sprayed onto maize leaves. The infected maize was grown in a chamber under dark conditions and constant humidity for 24 h to allow the disease to develop. Disease index investigation Disease evaluation was based on a scale for leaf spot disease from grade zero to grade five. Grade zero: no disease spot; Grade 1: no more than 10%; Grade 2: 11–30%; Grade 3: 31–50%; Grade 4: 51–70%; and Grade 5: more than 70%. At 5th day after spray inoculation, all leaves were investigated. The disease index was calculated as follows:
A total of 450 random mutants were obtained by an optimized ATMT protocol. The mutants were genetically purified by five rounds of subculture on potato dextrose agar medium without hygromycin B, followed by two rounds of single spore isolation. Polymerase chain reaction (PCR) confirmed the integration of the hph gene from plasmid pCAMBIA1300th. The Southern blot analysis of randomly chosen mutants showed that most mutants contained single T-DNA integrations. In addition, T-DNA insertions were randomly integrated (Fig. 2). All mutants were prescreened in a living maize leaf inoculation (Fig. 3A) and divided into two classes: higher than WT and lower than WT (Fig. 3B). Most mutants showed disease indices higher or lower than WT within a 20% range, with no significant difference to WT. Only six mutants showed a disease index that was significantly higher or lower (>20%) than WT (Fig. 3C). Of these six, mutant T32 showed a disease index lower than WT, but the other five mutants had disease indices higher than WT. Among these five, mutants T66 and T312 showed the most obvious influence on maize, with disease indices 35.4% and 30.6% higher than WT (P < 0.001), respectively.
Rescue and analysis of T-DNA insertion
Disease index D
ðX ði D 0Þ 5iðNL "
#
i
iÞ
=ðTN HGÞ 100%;
where i D disease index, NL D number of diseased leaves for each grade, TN D total number of diseased leaves in all grades, and HG D the highest grade of disease index.
Because these five mutants clearly showed a single integration event, they were subjected to a detailed molecular study. To clone the genomic regions adjacent to the T-DNA borders, reverse PCR was performed in these mutants as described in the Materials and Methods. The five mutant border sequences (LB and RB) were analyzed to identify the genes targeted by ATMT (Table 1, Fig. 4). Only mutant T66 showed an integral T-DNA insertion, and no deletion occurred in genomic DNA. In the other four mutants, a small genomic DNA deletion of
Fig. 3. Screening of the ATMT mutants based on the disease index. (A) Disease index grades 0 to 5, according to the disease spot area. (B) Disease indices for all 450 mutants. (C) Primary screening of mutant functions. CK: no Trichoderma treatment. WT: wildtype strain treatment. Columns 3 to 9: different mutant treatments.
573
Downloaded by [Michigan State University] at 21:46 11 February 2015
Construction and functional analysis of Trichoderma mutants
Fig. 4. Diagram of T-DNA insertion sites and deletions in five mutants obtained by Agrobacterium tumefaciens-mediated transformation (ATMT). RB: right border of T-DNA. LB: left border of T-DNA.
15–22 bp was caused by the T-DNA insertion. Furthermore, a small deletion of 3–12 bp also occurred in the RB and LB of T-DNA fragments. We chose two mutants (T66 and T312) for further investigation.
Analysis of the T66 and T312 mutants Through five cycles of reverse PCR, the 7.5 kb and 6.9 kb fragments flanking the T-DNA insertions in mutants T66
Downloaded by [Michigan State University] at 21:46 11 February 2015
574 and T312, respectively, were obtained. According to NCBI BLAST and bioinformatics analysis, mutant T66 was linked to a zinc finger protein (Thc6, GenBank ID KC887076), which showed a 64% overall similarity to the Ace2 gene of T. reesei. This transcriptional regulator, activator of cellulase 2 (ace2), encodes a protein belonging to a class of zinc binuclear cluster proteins.[8] Ace2 mediates cellulase and xylanase expression. Cellulase, a cell wall degrading enzyme, participates in the induction of host plant resistance.[9–11] In contrast, mutant T312 was linked to a glycoside hydrolase family protein from Thielavia terrestris named Thg2 (E D 1e-05; GenBank ID KF833398). We also deleted the target genes identified in mutants T66 and T312. After gene knockouts by ATMT, PCR and Southern blot were used to screen the mutants. To verify whether the mutants T66 and T312 were responsible for the observed maize resistance phenotypes, WT and knockout mutants were assayed. Influence on the expression of defense-related genes in maize A systemic defense response is often triggered in plants to protect them against pathogen invasions. This long-lasting and broad-spectrum-induced disease resistance is referred to as systemic acquired resistance (SAR) and is characterized by the coordinated activation of a specific set of PR genes. In contrast to salicylic acid (SA)-dependent SAR, beneficial soil-borne microorganisms induce a phenotypically similar form of systemic immunity called induced systemic resistance, which is often regulated by jasmonic acid (JA)-dependent signaling pathways.[12] Therefore, we analyzed the expression of SA- and JA-
Fig. 5. qRT-PCR analysis of defense-related gene expression in maize leaves. CK: no treatment. MCWT: maize treated only with wild-type Trichoderma. MCC: maize treated only with C. lunata. WT, DThg2 and DThc6: maize pretreated with conidia from WT, DThg2 and DThc6 strains, respectively, and then treated with C. lunata.
Fan et al. related proteins to elucidate the potential involvement of signaling pathways. Previously, we found that the expression of pathogenesis-related genes were clearly changed after 24 h of pathogen inoculation (data not shown). We investigated the gene expression levels of resistance-related defense proteins at 24 h after leaf infection with C. lunata. The expression of pal1, opr7 and pr1 were maintained at a low level when the maize was pretreated with Trichoderma only (Fig. 5). After inoculation with C. lunata (MCC), all three genes were expressed at a higher level than in CK. However, when maize was pretreated with WT and then inoculated with C. lunata, the expression of these three genes was higher when maize was only inoculated with C. lunata (P < 0.01, Appendix Tables A2 and A3). Thus, Trichoderma pretreatment induced more intense defense responses to C. lunata. We also found that maize pretreated with DThc6 and DThg2 showed significantly lower expression of pal1 and opr7 compared with WT (p < 0.01). The 12-oxo-phytodienoic acid reductase gene (opr7) is implicated in JA biosynthesis.[13] This result suggested that Thc6 and Thg2 genes participated in regulating the maize defense response against C. lunata through the JA pathway.[14] Djonovic et al. found that T. virens induces systemic protection in maize leaves inoculated with Colletotrichum graminicola, and this protection is associated with the induction of JA and green leaf volatile-biosynthetic genes.
Discussion ATMT-based random mutant libraries are an efficient strategy for identifying genes involved in different functions.[15–17] In this study, ATMT was used to identify new T. harzianum factors involved in maize resistance to C. lunata. This method resulted in a high transformation rate. In approximately 1.5% of the transformants, we obtained stable mutants that showed a significant influence on maize resistance. T-DNA integrates randomly at single sites in the genomes of yeasts, many filamentous fungi, and plants.[18,19] In our study, a high percentage of T-DNA integrations were single-copy events. Blaise et al.[20] have described the importance of preserving T-DNA borders during integration for the subsequent recovery of flanking sequences. Rolland also found that it is easier to rescue the sequence flanking then T-DNA LB in B. cinerea. In contrast, we obtained both regions adjacent to the T-DNA insertion sites via inverse PCR, although some mutants showed deletions at the T-DNA border. Trichoderma species are soil-borne fungi that are usually beneficial to plants. Trichoderma has been applied to a wide range of plant species for growth enhancement, with a positive effect on plant weight, and disease control.[21,22] To expand the use of Trichoderma in agriculture, we need a thorough examination of the complex interactions
Downloaded by [Michigan State University] at 21:46 11 February 2015
Construction and functional analysis of Trichoderma mutants between the host plant, pathogens and Trichoderma. A number of reports have focused on the systemic effects including T. asperellum T203, T. harzianum 382 and T. harzianum T39.[8] Systemic induction of plant defenses is the central mechanism by which Trichoderma spp. diminish foliar disease. Although the nature of systemic resistance remains unclear, the plant hormones salicylic acid (SA), jasmonic acid (JA), or ethylene (ET) play important roles. JA is involved in the interactions between Trichoderma and plants, and T. asperellum T203 induces disease resistance in cucumber in a JA-pathway-dependent manner.[9] Like other beneficial microorganisms, the Trichoderma sensitizes plants by “priming,” which is characterized by faster and/or stronger activation of cellular defenses upon pathogen or insect attack and results in enhanced resistance to invaders.[10] Our research also showed that the expression of SA-related and JA-related genes is generally weak. However, these defense genes were up-regulated by C. lunata. Furthermore, there were significant differences in opr7 expression in plants treated with WT, DThc6 and DThg2, which indicated that T66 and T312 inhibit maize disease resistance regulated by JA pathways. In future studies, we will focus on how Thg2 and Thc6 regulated the interactions between Trichoderma, maize and C. lunata.
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14] [15]
Funding [16]
This work was supported by grants from the National Natural Science Foundation of China (nos. 30971949, 31270155, 31171798 and 41001189) and China Agriculture Research System project (CARS-02).
References [1] Liu, T.; Xu, S.; Liu, L.; Zhou, F.; Hou, J.; Chen, J. Cloning and characteristics of Brn1 gene in Curvularia lunata causing leaf spot in maize. Eur. J. Plant Pathol. 2011, 131, 211–219. [2] Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma species-opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [3] Hermosa, R.; Woo, S.L.; Lorito, M.; Monte, E. Proteomic approaches to understand Trichoderma biocontrol mechanisms and plant interactions. Curr. Proteomics. 2010, 7, 298–305. [4] Holmes, K.A.; Schroers, H.J.; Thomas, S.E.; Evans, H.C.; Samuels, G.J. Taxonomy and biocontrol potential of a new species of Trichoderma from the Amazon basin of South America. Mycol. Prog. 2004, 3, 199–210. [5] Pieterse, C.M.; Leon-Reyes, A.; Van der Ent, S.; Van Wees, S.C. Networking by small-molecule hormones in plant immunity. Nat. Chem. Biol. 2009, 5, 308–316. [6] Giesbert, S.; Schumacher, J.; Kupas, V.; Espino, J.; Segm€ uller, N.; Haeuser-Hahn, I.; Schreier, P.; Tudzynski, P. Identification of pathogenesis-associated genes by T-DNA-mediated insertional mutagenesis in Botrytis cinerea: A type 2A phosphoprotein
[17]
[18]
[19]
[20]
[21]
[22]
575
phosphatase and an SPT3 transcription factor have significant impact on virulence. Mol. Plant Microbe. Interact. 2012, 25, 481– 495. Fu, K.; Fan, L.; Li, Y.; Gao, S.; Chen, J. Tmac1, a transcription factor which regulated high affinity copper transport in Trichoderma reesei. Microbiol. Res. 2012, 167, 536–543. Bailey, B.; Bae, H.; Strem, M.; Roberts, D.; Thomas, S.; Crozier, J.; Samuels, G.; Choi, I. Y.; Holmes, K. Fungal and plant gene expression during the colonization of cacao seedlings by endophytic isolates of four Trichoderma species. Planta. 2006, 224, 1449–1464. Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology. 2005, 95, 76–84. Conrath, U.; Beckers, G.J.; Flors, V.; Garcıa, A.P.; Jakab, G.; Mauch, F., Newman, M.A., Pieterse, C.M., Poinssot, B.; Pozo, M. J. Priming: getting ready for battle. Mol. Plant Microbe. Interact. 2006, 19, 1062–1071. Vinale, F.; Sivasithamparam, K.; Ghisalberti, E.L.; Marra, R.; Woo, S.L.; Lorito, M. Trichoderma–plant–pathogen interactions. Soil. Biol. Biochem. 2008, 40, 1–10. Van Wees, S.; Van der Ent, S.; Pieterse, C.M. Plant immune responses triggered by beneficial microbes. Curr. Opin. Plant. Biol. 2008, 11, 443–448. Djonovic, S.; Vargas, W.A.; Kolomiets, M.V.; Horndeski, M.; Wiest, A.; Kenerley, C.M. A proteinaceous elicitor Sm1 from the beneficial fungus Trichoderma virens is required for induced systemic resistance in maize. Plant Physiol. 2007, 145, 875–889 Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu. Rev. Plant. Biol. 2002, 53, 275–297. Michielse, C.B.; van Wijk, R.; Reijnen, L.; Cornelissen, B.; Rep, M. Insight into the molecular requirements for pathogenicity of Fusarium oxysporum f. sp. lycopersici through large-scale insertional mutagenesis. Genome. Biol. 2009, 10, R4. Idnurm, A.; Walton, F.J.; Floyd, A.; Reedy, J.L.; Heitman, J. Identification of ENA1 as a virulence gene of the human pathogenic fungus Cryptococcus neoformans through signature-tagged insertional mutagenesis. Eukaryot. Cell. 2009, 8, 315–326. Patel, M.; Dewey, R.E.; Qu, R. Enhancing Agrobacterium tumefaciens - mediated ransformation efficiency of perennial ryegrass and rice using heat and high maltose treatments during bacterial infection. Plant Cell. 2013, 114, 19–29. Betts, M.F.; Tucker, S.L.; Galadima, N.; Meng, Y.; Patel, G.; Li, L.; Donofrio, N.; Floyd, A.; Nolin, S.; Brown, D. Development of a high throughput transformation system for insertional mutagenesis in Magnaporthe oryzae. Fungal Genet. Biol. 2007, 44, 1035–1049. Rolland, S.; Jobic, C.; Fevre, M.; Bruel, C. Agrobacterium-mediated transformation of Botrytis cinerea, simple purification of monokaryotic transformants and rapid conidia-based identification of the transfer-DNA host genomic DNA flanking sequences. Curr. Genet. 2003, 44, 164–171. Blaise, F.; Remy, E.; Meyer, M.; Zhou, L.; Narcy, J.P.; Roux, J.; Balesdent, M.H.; Rouxel, T. A critical assessment of Agrobacterium tumefaciens-mediated transformation as a tool for pathogenicity gene discovery in the phytopathogenic fungus Leptosphaeria maculans. Fungal Genet. Biol. 2007, 44, 123–138. Contreras-Cornejo, H.A.; Macıas, R.L., Cortes, P.C.; L opez, B.J. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxindependent mechanism in Arabidopsis. Plant Physiol. 2009, 149, 1579–1592. Zhang, F.; Yuan, J.; Yang, X.M.; Cui, Y.Q.; Chen, L.H.; Ran, W.; Shen, Q.R. Putative Trichoderma harzianum mutant promotes cucumber growth by enhanced production of indole acetic acid and plant colonization. Plant Soil 2013, 368, 433–444.
576
Fan et al.
Appendix Table A1. Primers used in this study. Oligonucleotide Sequences (50 -30 )b
Length (bp)
GTATCATGATCGGTATGGGTCAGA TAGAAGGTGTGGTGCCAGATCTT CTACAACAACGGGCTCACCT CACGATGTAGGTGGACGACA TCAGCAAACAACAAACAATGG GGAGTGGATCAGCTTGCAGT GAGAAAGGTGGTTGATGCTGTT GGAGTTGGATACTTGCCATAGG GGGAATTCGGAGGTCAACACATCAAT GGCTCGAGCTATTCCTTTGCCCTCGG GGTCTAGAGGAGGTCAACACATCAAT GGGGATCCACAAATTGACGCTTAGAC GGAAGCTTCTGTTTCCGTTTGAGTGC GGGGATCCGGCGGATCAGTGCATGTT GGGGATCCCAACTCCAGCCGCATGCA GGGAGCTCTTGACAAATGCCTCCTC GGaagcttCTGCACCCACTGCTTGAT GGtctagaCTTGCCAAACAGTGAGTGA GGggatccCTCCATCAGAAGCGAGTG GGgagctcAAACAGGCTCGTTAGGAC CCAGCGTCACATCATTCA CGCTCGTCTGGCTAAGAT
116
Internal control
250
pal
233
pr1
189
opr7
1360 1608
PRChph ORF EcoRI/XhoI PRChph ORFCTE
961
50 flank of Thc6 knock out (XbaI/XbaI)
480
30 flank of Thc6 knock out (BamHI/SacI)
641
50 flank of Thg2 knock out (HindIII/XbaI)
1036
30 flank of Thg2 knock out (BamHI/SacI)
1624
hph fragment C fragment upper of Thc6 50 flank
Downloaded by [Michigan State University] at 21:46 11 February 2015
Primersa rRNAU rRNAL ZMPALU ZMPALL ZMPR1U ZMPR1L ZMOPR7U ZMOPR7L TkhU TkhL 13khU 13khL KOThc65U KOThc65L KOThc63U KOThc63L KOThg25U KOThg25L KOThg23U KOThg23L OThc6U OThc6L
Explainc
a
U means upper primer and L means lower primer. Underline marks the endonuclease site. c PR, promoter; ORF: open reading frame. b
Table A2. Anova analysis of relative mRNA level of pal1, opr7 and pr1. Test of homogeneity of variances
ANOVA
LS
df1
df2
Sig.
pal1
2.275
5
12
0.113
opr7
LS 2.682
df1 5.000
LS 2.181
df1 5
pr1
df2 12.000
Sig. 0.075
df2 12
Sig. 0.125
BG WG Total BG WG Total BG WG Total
SS
Df
MS
F
Sig.
46.887 0.220 47.107 SS 62.217 0.650 62.867 SS 41.238 0.167 41.405
5 12 17 Df 5 12 17 Df 5 12 17
9.377 0.018
511.682
0.000
MS 12.443 0.054
F 229.814
Sig. 0.000
MS 8.248 0.014
F 593.570
Sig. 0.000
Multiple Comparisons pal1 (Equal variance) Tukey comparison (I) group CK
opr7 (Equal variance) Tukey comparison
pr1 (Equal variance) Tukey comparison
(J) group
MD (I–J)
Std. Error
Sig.
MD (I–J)
Std. Error
Sig.
MD (I–J)
MCWT MCC WT DThc6
¡0.367 ¡3.302 ¡4.249 ¡2.315
0.111 0.111 0.111 0.111
0.053 0.000 0.000 0.000
¡0.419 ¡3.611 ¡5.346 ¡2.152
0.190 0.190 0.190 0.190
0.303 0.000 0.000 0.000
¡0.088 ¡2.936 ¡3.294 ¡3.383
Std. Error 0.096 0.096 0.096 0.096
Sig. 0.935 0.000 0.000 0.000
(Continued on next page)
577
Construction and functional analysis of Trichoderma mutants Table A2. Anova analysis of relative mRNA level of pal1, opr7 and pr1. (Continued) Test of homogeneity of variances
MCWT
Downloaded by [Michigan State University] at 21:46 11 February 2015
MCC
WT
DThc6
DThg2
ANOVA
LS
df1
df2
Sig.
DThg2 CK MCC WT DThc6 DThg2 CK MCWT WT DThc6 DThg2 CK MCWT MCC DThc6 DThg2 CK MCWT MCC WT DThg2 CK MCWT MCC WT DThc6
¡3.641 0.367 ¡2.935 ¡3.882 ¡1.948 ¡3.274 3.302 2.935 ¡0.947 0.987 ¡0.339 4.249 3.882 0.947 1.934 0.608 2.315 1.948 ¡0.987 ¡1.934 ¡1.326 3.641 3.274 0.339 ¡0.608 1.326
0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111 0.111
0.000 0.053 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.081 0.000 0.000 0.000 0.000 0.001 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.081 0.001 0.000
¡3.342 0.419 ¡3.192 ¡4.927 ¡1.733 ¡2.923 3.611 3.192 ¡1.735 1.458 0.269 5.346 4.927 1.735 3.193 2.004 2.152 1.733 ¡1.458 ¡3.193 ¡1.190 3.342 2.923 ¡0.269 ¡2.004 1.190
SS
Df
MS
0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190 0.190
0.000 0.303 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.719 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.719 0.000 0.000
¡3.344 0.088 ¡2.848 ¡3.206 ¡3.295 ¡3.256 2.936 2.848 ¡0.358 ¡0.447 ¡0.408 3.294 3.206 0.358 ¡0.089 ¡0.050 3.383 3.295 0.447 0.089 0.039 3.344 3.256 0.408 0.050 ¡0.039
F
Sig.
0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096 0.096
0.000 0.935 0.000 0.000 0.000 0.000 0.000 0.000 0.027 0.006 0.011 0.000 0.000 0.027 0.932 0.994 0.000 0.000 0.006 0.932 0.998 0.000 0.000 0.011 0.994 0.998
CK, maize without treatment; MCWT, maize pretreated with wild-type strain; MCC, maize inoculated with C. lunata; WT, DThc6 and DThg2, maize pretreated with WT, DThc6 and DThg2, respectively, and then inoculated with C. lunata.
Table A3. qRT-PCR efficiency of aoc, opr7, pal and pr1. pal1
CK
MCWT
MCC
WT DThc6 DThg2
opr7
pr1
Ct
PCR efficiency
Ct
PCR efficiency
Ct
PCR efficiency
27.013 27.293 27.192 26.002 26.412 26.231 25.542 25.466 25.732 24.958 25.313 25.465 25.880 26.314 26.365 24.476 24.799 24.786
1.641 1.606 1.639 1.672 1.696 1.681 1.654 1.579 1.673 1.666 1.562 1.624 1.719 1.598 1.626 1.700 1.658 1.664
29.344 29.562 29.311 28.352 28.415 28.414 27.777 27.549 27.841 27.062 27.265 27.309 28.316 28.554 28.631 27.019 27.134 26.922
1.711 1.700 1.688 1.768 1.684 1.732 1.660 1.699 1.733 1.709 1.681 1.611 1.711 1.716 1.718 1.752 1.733 1.640
29.171 28.504 29.131 28.516 28.006 28.438 27.865 26.776 27.793 27.422 26.753 27.736 27.674 27.100 27.883 26.763 26.028 26.864
1.645 1.615 1.668 1.581 1.587 1.659 1.749 1.732 1.763 1.692 1.700 1.770 1.646 1.689 1.621 1.691 1.694 1.687
CK, maize without treatment; MCWT, maize pretreated with wild-type strain; MCC, maize inoculated with C. lunata; WT, DThc6 and DThg2, maize pretreated with WT, DThc6 and DThg2, respectively, and then inoculated with C. lunata.
